| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Department of Obstetrics and Gynaecology, The University of British Columbia, Vancouver, Canada V6H 3V5
Address all correspondence and requests for reprints to: Peter C. K. Leung, Ph.D., Department of Obstetric and Gynaecology, The University of British Columbia, 2H30-4490 Oak Street, British Columbia Womens Hospital, Vancouver, Canada, V6H 3V5. E-mail: . peleung{at}interchange.ubc.ca
Abstract
A dose- and time-dependent increase in the human GnRH receptor (GnRHR) promoter activity after forskolin treatment was observed after transient transfection of human placental choriocarcinoma JEG-3 cells with a 2297-bp human GnRHR promoter-luciferase construct (p2300-LucF). This stimulatory effect was mimicked by administrating of cholera toxin, cAMP analog, or human chorionic gonadotropin. A specific adenylate cyclase inhibitor or protein kinase A inhibitor pretreatment reversed the forskolin- and human chorionic gonadotropin-induced increase in the human GnRHR promoter activity. Progressive 5' deletion assays identified a 412-bp fragment (-577 to -167) in the human GnRHR 5'-flanking region that is essential in maintaining the basal responsiveness to cAMP. Mutagenesis, coupled with functional studies, has identified two putative activating protein-1 (AP-1)/cAMP-responsive element (CRE) binding protein binding sites, namely human GnRHR (hGR)-AP/CRE-1 and hGR-AP/CRE-2, mediating the cAMP-stimulatory effect. Mutation of the putative hGR-AP/CRE-1 and hGR-AP/CRE-2 resulted in 32% and 35% decreases in the forskolin-induced stimulation, respectively. The binding of CRE binding protein to these motifs was confirmed by gel mobility shift assay and antibody supershift assay.
THE ISOLATION OF GnRH from the placenta (1, 2, 3) and its role in stimulating the secretion of human chorionic gonadotropin (hCG) through a receptor-mediated process (4, 5, 6, 7) suggest an autocrine/paracrine role of GnRH in the placenta. Using solution hybridization protection assay and in situ hybridization assay, the level of GnRH mRNA was found to remain constant throughout gestation (8). In contrast, other studies have demonstrated dynamic changes in human GnRH receptor (GnRHR) number and mRNA levels in the placental trophoblast cells at various gestation ages that are functionally correlated to hCG secretion from placental cells (9, 10). Taken together, these results suggest that the regulation of GnRHR gene expression plays an important role in mediating placental GnRH functions. We have recently reported the cloning and characterization of the full-length human GnRHR cDNA from human placental cells, including a choriocarcinoma cell line JEG-3, immortalized extravillous trophoblasts, and first-trimester cytotrophoblast cells in primary culture (7).
Early studies using a transient transfection system have demonstrated an increase in the rat (11) and mouse (12) GnRHR promoter activity in pituitary cells after forskolin, cholera toxin (CTX), or cAMP stimulation. Further studies have identified a putative cAMP-responsive element (CRE) in the mouse GnRHR promoter that is responsible for cAMP-mediated transcriptional activation (13). Deletion of this putative CRE in mouse GnRHR promoter significantly decreased the promoter activity, compared with the wild-type counterpart (14). Using a gel mobility shift assay (GMSA), two specific DNA-protein complexes were formed with a digoxigenin-end-labeled oligonucleotide probe containing the putative CRE (14). Addition of anti-CRE binding protein (anti-CREB) antibody blocked the formation of these complexes, suggesting the binding of CREB to the putative CRE in the mouse GnRHR promoter (14).
The increase in GnRHR mRNA levels in placental JEG-3 and immortalized extravillous trophoblast cells after forskolin treatment suggests a possible regulation of GnRHR gene transcription by cAMP/protein kinase A (PKA) pathway (7). We have observed an increase in human GnRHR promoter activity after forskolin, CTX, or cAMP analog treatment and identified two putative CREs that were important in mediating the cAMP stimulatory effect in the pituitary level (15). In the present study, the potential role of the cAMP/PKA pathway and these two putative CRE in controlling human GnRHR gene transcription in the placental JEG-3 cells were examined.
Materials and Methods
Cells and cell culture
Human choriocarcinoma JEG-3 cells, obtained from American Type Culture Collection (Manassas, VA), were maintained in Roswell Park Memorial Institute (RPMI) 1640 containing 10% FBS. Cultures were maintained at 37 C in a humidified atmosphere of 5% CO2 in air. Cells were passaged when they reached about 90% confluence using a trypsin/EDTA solution (0.05% trypsin, 0.53 mM EDTA).
Preparation of human GnRHR promoter-luciferase constructs
Human GnRHR-luciferase construct (p2300-LucF) and progressive 5' deletion constructs were prepared as previously described (16). Plasmid DNA for transfection studies was prepared using Plasmid Maxi Kits (QIAGEN, Mississauga, Ontario, Canada), following the manufacturers suggested procedure. The concentration and integrity of DNA were determined by measuring absorbance at 260 nm and agarose gel electrophoresis, respectively. Purified plasmid DNA was then dissolved in 0.1x TE [1 mM Tris-Cl (pH 7.5) and 0.1 mM EDTA] to a final concentration of 1 µg/µl.
Transient transfections and reporter assay
Transfections were carried out using the calcium phosphate precipitation methodology as previously described (7). To correct for different transfection efficiencies of various luciferase constructs, the Rouse sarcoma virus (RSV)-lacZ plasmid was cotransfected into cells with the GnRHR promoter-luciferase construct. Briefly, 1.5 x 105 JEG-3 cells were seeded into six-well tissue culture plates before the day of transfection. Two micrograms of the GnRHR promoter-luciferase construct and 0.5 µg RSV-lacZ were dissolved in 50 µl 0.1x TE containing 0.25 M CaCl2 and mixed with 50 µl 2x BES [50 mM N,N-bis-(2-hydroxyethyl)-2- aminoethanesulforic acid, 280 mM NaCl, and 1.5 mM Na2HPO4 (pH 6.95)]. The DNA mixture was incubated for 20 min at room temperature and then applied to the cells. Incubation of the cells with transfection medium was continued for approximately 16 h at 37 C in 3% CO2. After transfection, the cells were washed twice with culture medium and incubated for an additional 6 h with normal culture medium containing 10% FBS. Cellular lysates were collected with 200 µl cell lysis buffer and immediately assayed for luciferase activity with the Enhanced Lifers Assay Kit (PharMingen, Mississauga, Canada). Luminescence was measured using a Lumat LB 9507 luminometer (EG&G, Berthold, Germany). ß-Galactosidase activity was also measured and used to normalize for varying transfection efficiencies. Promoter activity was calculated as luciferase activity/ß-galactosidase activity. A promoterless pGL2-Basic vector was included as a control in the transfection experiments.
Site-directed mutagenesis
Human GnRHR 5' flanking region -707 to +1 (related to translation start site) subcloned into pBSK II (+) vector (Stratagene, La Jolla, CA) was used as a template for mutagenesis reaction. Mutations were introduced by a three-step PCR mutagenesis method as described previously (17), using universal primers UP-T3F (5'GTGCCTCTCCTGAACAGGCCTCAAGCAATTAACCCTCACTAAAGG3'), UP (5'GTGCCTCTCCTGAACAGGCCTCAA3'), T7R (5'CGTAATACGACTCACTATAGG3'), and mutagenic primers (a NotI site introduced was underlined) for mP-CRE-1 (5'GTTTTCCTTTTCAAAGCGGCCGCTGAGCACTCGAACACTGGAC3') and mP-CRE-2 (5'AAACTATTAGTGTTAGTCGGCCGTCCAACATACAGATGTA3'). Mutation was confirmed by restriction enzyme and sequence analysis.
Pharmacological treatments
Pharmacological reagents, including forskolin, 8-bromoadenosine-cAMP (8-Br-cAMP), and CTX, human CG (hCG) were purchased from Sigma-Aldrich Corp. (Mississauga, Ontario, Canada). Adenylate cyclase inhibitor (ACI) (SQ22536) and cell permeable PKA inhibitor (PKAI) 1422 amide, myristoylated were purchased from Calbiochem (La Jolla, CA). In experiments wherein the effect of hCG, forskolin, 8-Br-cAMP, and CTX on GnRHR-Luc activity were studied, the cells will be treated with various amounts of chemical for 3 h after transfection. To study the role of PKA and AC, transfected cells were preincubated with the corresponding inhibitor for 30 min before corresponding treatments.
GMSA
Oligodeoxynucleotides corresponding to the putative and mutated hGR-AP/CRE-1 (5'AATAATTTTAAGTGAATATATT3') and hGR-AP/CRE-2 (5'AATATCATGACTGACATTTTAA3') at the human GnRHR 5' flanking region and its complements were synthesized by the Oligonucleotide Synthesis Laboratory (University of British Columbia, Canada) and annealed to form a double-stranded DNA. Consensus and mutated AP-1 and CRE oligonucleotide DNAs and antibodies for CREB, c-Jun, c-Fos, and Oct-1 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Oligonucleotide DNAs for nuclear factor-
B (NF-
B) and transcription factor IID (TFIID) were purchased from Promega Corp. (Nepal, Ontario, Canada). Probes for GMSA were end-radiolabeled with (P32)-ATP by T4 polynucleotide kinase (Life Technologies, Inc., Burlington, Ontario, Canada) and separated from unincorporated radionucleotides by passage over Sephadex G-25 column. Nuclear extracts was prepared according to the method described previously (18). Protein concentrations were determined by a modified Bradford assay (Bio-Rad Laboratories, Inc., Mississauga, Ontario, Canada). GMSAs were carried out in 20 µl containing 20 mM HEPES (pH 7.5), 20 mM KCl, 20 mM NaCl, 1.5 mM MgCl2, 1 mM dithiothreitol, 1 mM EDTA, 10% glycerol, 2 µg poly dI:dC, 5 µg nuclear proteins, 2 mg/ml BSA, and radiolabeled probe.
For the competition assays, the unlabeled DNA was added simultaneously with the labeled probe. Antibodies used in supershift experiments were added to the nuclear extract at room temperature for 1 h before the addition of labeled probe. The binding mixture was incubated at room temperature for 20 min and separated in 6% polyacrylamide gel containing 1x TBE [Tris-borate-EDTA: 0.09 M Tris-borate and 2 mM EDTA (pH 8.0)]. Before loading of samples, the gel was prerun for 90 min at 100 V at 4 C. Electrophoresis was carried out at 30 mA at 4 C. The gel was then dried under vacuum and exposed to x-ray film (X-OMAT AR film; Eastman Kodak Co., Rochester, NY) at -70 C.
Data analysis
Data shown are the means of triplicate assays in three individual experiments and are presented as the mean ± SEM. The data were analyzed by one-way ANOVA followed by Tukeys multiple-range test, P < 0.05 being considered significant.
Results
Effects of forskolin and 8-Br-cAMP on GnRHR promoter activity
A time- and dose-dependent increase in the GnRHR- promoter activity was observed after stimulation with forskolin (Fig. 1
). A substantial increase (5.8-fold, P < 0.001) in luciferase activity was observed after 3 h of forskolin treatment (10-5 M). However, extended forskolin stimulation (624 h) did not further increase the promoter activity (Fig. 1A
). Instead, a decrease in forskolin-induced stimulation in promoter activity was observed. Further studies have shown that the induction of promoter activity was dependent on the dosage, with the maximum increase achieved at 10 µM forskolin (Fig. 1B
). This stimulatory effect was mimicked by administrating cAMP analog, 8-Br-cAMP, and CTX (Fig. 2
). Taken together, these results suggest that increased intracellular cAMP concentrations were important for the stimulation of GnRHR gene expression in JEG-3 cells. This notion was further supported by demonstrating the increase in GnRHR-promoter activity in transfected JEG-3 cells by hCG treatments (Fig. 3
).
|
|
|
A 54% (P < 0.001 vs. forskolin only) decrease and a 31.5% (P < 0.01 vs. forskolin only) decrease in forskolin-induced stimulation on GnRHR promoter activity were observed after pretreating JEG-3 cells with ACI (0.5 mM) and PKAI (8 µM), respectively (Fig. 4
). These results not only suggested the importance of cAMP production in stimulating human GnRHR promoter activity but also implicated the role of PKA in mediating this effect.
|
To localize the specific promoter region that mediates the responsiveness to cAMP/PKA up-regulation of GnRHR promoter activity, progressive 5' deletion constructs containing fragments of the human GnRHR promoter were fused to a luciferase reporter gene and transfected into JEG-3 cells (Fig. 5A
). Removal of the DNA sequence between -2297 to -1346 (relative to translation start site) resulted in a 14.4% decrease in forskolin-induced increase in promoter activity (Fig. 5B
). Interestingly, the maximum response to forskolin stimulation was restored after deletion of the DNA fragment from -1346 to -707 (Fig. 5B
). Further deletion to 577 bases away from translation start site did not significantly affect the forskolin-stimulatory effect. However, deletion of the DNA sequence between -577 to -277 eliminated the forskolin action (Fig. 5B
). These data suggest that the complete responsiveness toward cAMP stimulation was controlled by interaction of various regions in the human GnRHR, whereas the DNA fragment between -577 and -277 plays an essential role in maintaining the basal forskolin-induced stimulatory effect.
|
Sequence analysis of this 301-bp fragment (-577 to -277) did not identify any consensus CRE (19) but two putative AP-1/CREB binding sites, namely hGR-AP/CRE-1 (located at -568 to -561, 5'TTAAGTGA3', in complementary orientation, with 75% and 71.5% homology to consensus CRE and AP-1, respectively) and hGR-AP/CRE-2 (located at -340 to -333, 5'TGACTGAC3', with 50% and 86% homology to consensus CRE and AP-1, respectively). To examine the role of these binding sites in mediating the forskolin stimulatory effects, the two putative AP-1/CREB binding sites were mutated in Sty-HLuc (Fig. 6
). Mutation of hGR-AP/CRE-1 and hGR-AP/CRE-2, respectively, resulted in a 32% (P < 0.01) and 35% decrease in responding to forskolin stimulation (Fig. 6
). Double mutation of both AP-1/CREB binding sites further reduced the responsiveness to forskolin stimulation (Fig. 6
). In addition, mutation of a putative progesterone response element (PRE) did not affect the forskolin-induced increase in promoter activity, suggesting the specificity of these two elements in mediating the forskolin stimulation.
|
The identity of the transcription factor bound to these putative AP-1/CREB binding sites was examined by GMSA using synthetic oligonucleotide containing hGR-AP/CRE-1 or hGR-AP/CRE-2, in the presence of consensus and mutated AP-1 and CRE, nonrelated oligonucleotide, or antibodies against CREB, c-Jun, c-Fos, and Oct-1. Generally, there was an increase in DNA-protein complex intensity with nuclear extract isolated after forskolin treatment (Figs. 7
and 8
). Using hGR-AP/CRE-1 as a probe, two DNA-protein complexes were obtained (Fig. 7
, indicated by the arrow, A and B), which were eliminated with the addition of (200-fold in excess) competitor DNA containing consensus CRE (lanes 5 and 12) but not with a competitor containing mutated AP-1 (lanes 2 and 9), consensus AP-1 (lanes 3 and 10), mutated CRE (lanes 4 and 11), nonrelated sequence NF-
B (lane 6 and 13), or TFIID (lanes 7 and 14). Similar results were observed in hGR-AP/CRE-2 probe (Fig. 8
).
|
|
|
In human trophoblast cells, cAMP plays a critical role in controlling placenta-specific gene expression. Characterization of the human CRH gene promoter (20), the human cytochrome P450 side-chain cleavage (CYP11A) gene promoter (21), and the human glycoprotein hormone
-subunit gene promoter (22, 23) revealed that the CRE is essential for the gene expression in the placenta. Although the placental GnRHR gene expression was increased after cAMP/PKA pathway activation (7), the molecular mechanism that leads to this up-regulation remains unclear. In the present study, a luciferase reporter gene vector containing a 2294-bp human GnRHR 5' flanking region was used to examine the transcriptional up-regulation of human GnRHR gene in the placental JEG-3 cells. The present data confirmed the transcription activation of placental GnRHR gene through the cAMP/PKA pathway. As shown in Figs. 1
and 2
, GnRHR-Luc gene expression is stimulated by treatment of pharmacological activators that activate the cAMP/PKA pathway. However, prolonged activation of PKA by forskolin (24 h) did not further increase the GnRHR promoter activity. It has been demonstrated that activation of PKA was capable of regulating the expression of PKA subunits (24, 25). A decrease in catalytic subunits and increase in regulatory subunit levels were observed in responding to sustained activation of the PKA system by forskolin and cAMP analogy (25, 26, 27). This negative feedback regulatory mechanism helps to maintain cellular homeostasis under prolonged hormonal or neurohormonal stimulation and prevents it from overstimulation.
A pharmacological approach was used to further define the signaling pathway in controlling the up-regulation of GnRHR gene expression by the forskolin stimulation. By the use of specific inhibitors for PKA and AC, the forskolin-induced increase in human GnRHR promoter activity was demonstrated to be PKA- and AC-dependent. Because hCG is well known to exact its action in via cAMP production after binding to its receptor, the expression of hCG receptor mRNA in JEG-3 cells (data not shown) provides a potential model to examine this regulatory mechanism. The demonstration of an increase in human GnRHR promoter activity after hCG treatment and the reversion of this stimulation by ACI administration further support the role of cAMP/PKA in regulating the GnRHR gene transcription. Taken together, the results in the present study suggested the possibility of regulating human GnRHR gene expression in the placenta by hormones that activate the cAMP/PKA pathway.
Progressive 5' deletion assay revealed several potential cAMP-responding regions. Among them, the sequence between -577 to -167 seems to play a major role in maintaining the basal cAMP stimulation. Although no CRE consensus motif was located within this region, two putative AP-1/CREB binding sites were identified. Site-directed mutagenesis coupled with functional studies suggested that these two AP-1/CREB binding sites in human GnRHR promoter played a role in mediating the forskolin-stimulatory effect. Using consensus AP-1 and CRE motifs (as well as antibodies against CREB, c-Jun, and c-Fos), hGR-AP/CRE-1 and -2 were found to bind CREB. These data confirm the role of this motif in mediating cAMP action. Although double mutation of both AP-1/CRE binding sites further reduced the responsiveness to forskolin stimulation, it did not completely eliminate this effect. These data suggest that other regulatory elements were involved in attaining the maximal response. It has been shown that other transcription factors, such as AP-2, NF-
B, and Sp1, can also mediate cAMP stimulation in gene expression (28, 29).
The physiological effects of cAMP are mediated by activation PKA that phosphorylates numerous proteins including members of the CREB families, which, when phosphorylated, can induce transcription in genes containing cAMP-responsive element, CRE (28). Although CREB is one of the best-studied links between activation of cAMP/PKA pathway and gene expression, it is now clear that the versatility of the nuclear response to cAMP is provided by interplay of additional transcription factors, including cAMP response element modulator (CREM) (28). Both CREB and CREM are originally identified as being responsive to cAMP-dependent signaling pathway (30) and showed a high degree of sequence homology (28). Furthermore, these factors belong to the basic leucine zipper protein class; hence, it may allow potential dimerization between different transcription factors (28). Interestingly, the CREM family not only contains trans-activator but also negative repressor (31). It has been demonstrated that the CREM
, ß, and
functioned as antagonists of cAMP-induced transcription, either by binding to CRE as nonactivating homodimers or heterodimers, thereby blocking CRE-binding activator (31). By the use of an alternative promoter, a truncated product, inducible cAMP early repressor (ICER) is produced from the CREM gene (32). This protein contains only the DNA-binding domain and does not depend on phosphorylation by PKA for its activation (32). The intact DNA-binding domain directs specific ICER binding to the consensus CRE. Importantly, ICER is able to heterodimerize with other members in the CREM and CREB family and functions as a powerful repressor of cAMP-induced transcription (32). Hence, the differential expression of these CREBs in the placental cells will certainly affect the expression of GnRHR after cAMP/PKA activation.
In summary, we have demonstrated an increase of the human GnRHR promoter activity after activation of cAMP/PKA pathway in placental JEG-3 cells. The activation of PKA pathway is shown to be important for transcriptional up-regulation of the human GnRHR gene. In addition, two putative AP/CRE-1 and -2 binding sites within the human GnRHR 5' flanking region (-577 to -167) have been functionally identified to mediate the molecular mechanism of this up-regulation.
Footnotes
This work was supported by the Canadian Institutes of Health Research Grants. P.C.K.L. is a career investigator of the British Columbia Research Institute of Childrens and Womens Health.
Abbreviations: ACI, Adenylate cyclase inhibitor; AP-1, activating protein-1; 8-Br-cAMP, 8-bromoadenosine-cAMP; CRE, cAMP-responsive element; CREB, CRE binding protein; CREM, cAMP response element modulator; CTX, cholera toxin; GMSA, gel mobility shift assay; GnRHR, GnRH receptor; hCG, human chorionic gonadotropin; hGR, human GnRHR; ICER, inducible cAMP early repressor; NF-
B, nuclear factor-
B; PKA, protein kinase A; PKAI, PKA inhibitor; PRE, progesterone response element; RSV, Rouse sarcoma virus.
Received June 5, 2001.
Accepted March 23, 2002.
References
- and ß-messenger ribonucleic acid levels are stimulated by exogenous gonadoliberin pulse applied to first trimester placenta in a superfusion culture system. J Clin Endocrinol Metab 73:8492
-subunit gene in placenta required a functional cyclic AMP response element, whereas a different cis-acting element mediates pituitary-specific expression. Mol Cell Biol 9:51135122
- and ß-isoforms of cyclic adenosine 3',5'-monophosphate-dependent protein kinase subunits present in the anterior pituitary: regulation of RIIß and C
gene expression by the cyclic nucleotide and phorbol ester. Endocrinology 133:10101019This article has been cited by other articles:
![]() |
C. K. Cheng and P. C. K. Leung Molecular Biology of Gonadotropin-Releasing Hormone (GnRH)-I, GnRH-II, and Their Receptors in Humans Endocr. Rev., April 1, 2005; 26(2): 283 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Cheng, B. K. C. Chow, and P. C. K. Leung An Activator Protein 1-Like Motif Mediates 17{beta}-Estradiol Repression of Gonadotropin-Releasing Hormone Receptor Promoter via an Estrogen Receptor {alpha}-Dependent Mechanism in Ovarian and Breast Cancer Cells Mol. Endocrinol., December 1, 2003; 17(12): 2613 - 2629. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |