| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
-Hydroxylase Expression in Normal and Pathological Parathyroid Glands
Department of Surgical Sciences, Endocrine Unit, Uppsala University Hospital, SE-751 85 Uppsala, Sweden
Address all correspondence and requests for reprints to: Gunnar Westin, Ph.D., Department of Surgical Sciences, Endocrine Unit, Uppsala University Hospital, Klinisk forskningsavdelning 2, ingang 70, plan 3, lab 9, SE-751 85 Uppsala, Sweden. E-mail: . gunnar.westin{at}surgsci.uu.se
Abstract
Active vitamin D, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3], plays a pivotal role in calcium homeostasis and bone metabolism. Circulating levels of 1,25(OH)2D3 are thought to be dependent mainly on the activity of the renal cytochrome P450 enzyme 25-hydroxyvitamin D3-1
-hydroxylase (1
-hydroxylase), which is potently induced by PTH. However, 1
-hydroxylase activity or expression has also been reported at several extrarenal sites, at which local synthesis of 1,25(OH)2D3 appears to fulfill autocrine or paracrine functions. This includes tissues such as placenta and brain that also express LRP-2/megalin, an endocytic receptor for multiple ligands, which is involved in the renal uptake of the substrate for 1
-hydroxylase, 25-hydroxyvitamin D3. We have previously demonstrated LRP-2/megalin in parathyroid cells, and here we present results from RT-PCR and immunohistochemical analyses showing coincident expression of 1
-hydroxylase in normal and pathological parathyroid tissue. With real-time quantitative RT-PCR analysis, the expression of 1
-hydroxylase mRNA was higher in the majority of parathyroid adenomas and secondary hyperplastic glands but lower in parathyroid carcinomas, compared with normal parathyroid tissue. The findings imply that in addition to feedback control by circulating 1,25(OH)2D3 levels, parathyroid cells may also be influenced by local 1
-hydroxylase activity with possible growth regulatory and differentiating effects.
THE ACTIVE FORM of vitamin D, 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] is essential for the maintenance of calcium and phosphate homeostasis, normal bone formation, cellular growth control, and differentiation of various tissues (1, 2). In the parathyroids 1,25(OH)2D3 inhibits PTH transcription, secretion, and cell proliferation (3, 4). This is central to the feedback regulation of 1,25(OH)2D3 synthesis, which is primarily due to PTH-induced 1
-hydroxylation of the major circulating form of vitamin D, 25-hydroxyvitamin D3 [25(OH)D3], in the kidney. 1
-Hydroxylation is catalyzed by the mitochondrial cytochrome P450 enzyme 25-(OH)D3-1
-hydroxylase (1
-hydroxylase) with ferredoxin and ferredoxin reductase (1, 2). In addition to being expressed throughout the kidney (5), 1
-hydroxylase has been reported at several extrarenal sites, notably in keratinocytes (6, 7), testis (6), brain (6), cultured bone cells (8), macrophages (9, 10), placenta (11, 12), prostate cells (13), colon adenocarcinoma (14), non-small-cell lung carcinomas (15), and islet cells of the pancreas (16). The function of 1
-hydroxylase in these tissues has yet to be fully defined but appears to involve local production of 1,25(OH)2D3 for autocrine or paracrine regulation (17). However, the precise relationship between the rather widespread extrarenal expression of 1
-hydroxylase and actual local synthesis of 1,25(OH)2D3 remains unclear. Recent studies have shown that the endocytic receptor low-density lipoprotein receptor-related protein (LRP)-2/megalin mediates reabsorption of 25(OH)D3, in complex with the vitamin D-binding protein, from the glomerular filtrate to provide the precursor for synthesis of 1,25(OH)2D3 by 1
-hydroxylase in proximal kidney tubule cells (18).
In addition to renal tubular cells, LRP-2/megalin is expressed in several other specialized epithelia, including type II pneumocytes, epididymal epithelial cells, placental cytotrophoblasts, and parathyroid cells (19, 20, 21). On the basis of these observations, we decided to look for 1
-hydroxylase expression in the parathyroid glands and evaluate a possible role for the enzyme in parathyroid tumorigenesis. Here we describe expression of 1
-hydroxylase mRNA and protein in human parathyroid glands, aberrant expression in parathyroid adenomas, and hyperplastic glands of primary and secondary hyperparathyroidism (HPT) and in parathyroid carcinomas. We suggest that elevated expression levels of 1
-hydroxylase may have growth-controlling effects and possibly differentiating effects in parathyroid lesions of primary and secondary HPT.
Subjects and Methods
Tissue specimens
Immunohistochemistry and RT-PCR were performed on normal parathyroid gland biopsy, parathyroid adenomas, and hyperplastic glands from patients with secondary HPT. Human kidney and liver were used as positive and negative control tissues, respectively. Real-time quantitative RT-PCR was performed on 15 parathyroid adenomas, 10 hyperplastic glands of secondary HPT, 5 parathyroid carcinomas (3 primary tumors and 2 metastases), and 5 normal parathyroid glands (Table 1
). All tumors were acquired from patients diagnosed and operated on in the clinical routine. The tissue was intraoperatively snap frozen. Normal parathyroid tissue was obtained from glands inadvertently removed in conjunction with thyroid surgery in which autotransplantation was not required or as normal parathyroid gland biopsies in patients subjected to parathyroidectomy. The diagnosis of parathyroid carcinoma was unequivocal according to histopathological evaluation and/or occurrence of metastases at diagnosis or follow-up. Informed consent and approval of ethical committee was achieved.
|
Total RNA was extracted from frozen tissue with TriZol reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturers instructions, and the RNA was subsequently treated with RQ1 DNase I (Promega Corp., Madison, WI) and proteinase K. Messenger RNA-specific oligonucleotide primers with sequences from different exons were designed for the RT-PCR analysis using the published gene sequence for human 1
-hydroxylase (GenBank accession no. AB 006987): forward primer 5'-GCTACACGAGCTGCAGGTGCAGGGC-3', reverse primer 5'-AGCGGGGCCAGGAGACTGCGGAGCC-3'. These primers generated a 252-bp RT-PCR product with complete homology to the published human 1
-hydroxylase sequence (22), as determined by DNA sequence analysis on ABI 373A using the ABI Prism Dye terminator cycle sequencing ready reaction kit (PE Applied Biosystems, Foster City, CA). Reverse transcription of 2 µg total RNA was performed with hexamer random primers using the First-Strand cDNA synthesis kit (Amersham Pharmacia Biotech, Uppsala, Sweden) according to the manufacturers instructions. PCR reactions contained a tenth of the cDNA reaction, 0.50 pmol/µl primers, 0.2 mM dNTP (Life Technologies, Inc.), 1x PCR buffer, 1.5 mM MgCl2, 1.25 U AmpliTaq Gold DNA polymerase (PE Applied Biosystems), and 5% dimethyl sulfoxide in a final volume of 50 µl. The reactions were performed in a GeneAmp 9600 thermal cycler (PE Applied Biosystems) as follows: denaturation at 95 C for 10 min, followed by 37 cycles of annealing at 64 C for 30 sec, extension at 72 C for 30 sec, and denaturation at 95 C for 30 sec, followed by a 7-min final extension at 72 C. The entire PCR reaction was separated on a 1% agarose gel. RT-PCR analysis was performed according to standard procedures also with primers for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward primer 5'-CCACCATGGAGAAGGCTGGGGCTCA-3' and reverse primer 5'-ATCACGCCACAGTTTCCCGGAGGGG -3'). The size of the RT-PCR product for GAPDH was 287 bp.
Immunohistochemistry
Cryosections of 6 µm were fixed in acetone, followed by quenching of endogenous peroxidase activity in 0.3% H2O2 in methanol for 15 min and blocked with an avidin-biotin blocking kit (Vector Laboratories, Inc., Burlingame, CA). The specific (see below) 1
-hydroxylase (5, 23) polyclonal peptide antiserum (1:300) was applied to the tissue sections and incubated for 90 min at room temperature (the antisera were diluted in 0.1 M Tris (pH 7.4) containing 10% normal swine serum). The slides were then exposed for 30 min to biotin-labeled donkey antisheep IgG (1:500), after which an avidin-biotin complex (Vector Laboratories, Inc.) was applied. Slides were developed using 3-amino-9-ethylcarbazole and counterstained with Mayers hematoxylin. Control sections included use of primary 1
-hydroxylase antiserum preincubated with an excess of immunizing peptide (RHVELREGEAAMRNQGKPEEDMPS). Histologically normal human kidney tissue (5) was used as positive control. Synthesis of a 1
-hydroxylase antibody was carried out using an antigenic region of the reported mouse amino acid sequence (peptide 266289) that was highly specific for 1
-hydroxylase (5, 23). An IgG fraction was subsequently prepared from the immune serum (The Binding Site, Birmingham, UK). Preliminary studies using a human proximal tubule cell line (HKC-8) that expresses 1
-hydroxylase activity confirmed the specificity of the IgG antiserum fraction. Western blot analyses identified a single 56-kDa 1
-hydroxylase protein species in these cells, and expression of this was down-regulated in the presence of 10 nM 1,25(OH)2D3 and up-regulated by forskolin. These changes in protein expression correlated with changes in actual 1
-hydroxylase activity. In contrast, changes in protein expression correlated inversely with activity of the related enzyme 24-hydroxylase, indicating that the antiserum did not cross-react with this enzyme.
Real-time quantitative RT-PCR
The principle of real-time quantitative PCR has previously been described in detail (24). Briefly, fluorescent-labeled probes are designed to hybridize to the cDNA amplified by the two PCR primers. Each probe has a fluorescent reporter dye and a quencher dye attached. For intact probe the presence of quencher inhibits reporter dye emission by quenching energy emission. During the PCR extension phase, the annealed probe is cleaved by the 5' to 3' exonuclease activity of Taq DNA polymerase. The cleavage produces an increase of reporter dye fluorescence emission. A charge-coupled device camera monitors the emission data every few seconds and the software analyzes the data. Quantification of the amount of target in unknown samples is accomplished by using a standard curve. We measured the mRNA levels of 1
-hydroxylase in tumor and normal cDNAs and compared with the corresponding levels for GAPDH mRNA. The following mRNA-specific PCR primers and sequences of the labeled probes (5'FAM-sequence-3'TAMRA) were used: F-1
-hydroxylase, TTGCTATTGGCGGGAGTGG; R-1
-hydroxylase, TGCCGGGAGAGCTCATACAG; probe-1
-hydroxylase, ACGGTGTCCAACACGCTCTCTTGGG; F-GAPDH, GAAGGTGAAGGTCGGAGTC; R-GAPDH, GAAGATGGTGATGGGATT TC; and probe-GAPDH, CAAGCTTCCCGTTCTCAGCC. All PCR reactions were performed on ABI PRISM 7700 sequence detection system (PE Applied Biosystems) in a final volume of 50 µl. The PCR mixture contained 5 µl cDNA template; 1x TaqMan buffer A; 5.5 mM MgCl2; 200 µM dATP, dCTP, and dGTP; 400 µM deoxyuridine-5'-triphosphate; 100 nM probe; 200 nM of each primer; 0.01 U AmpErase UNG; and 0.05 U AmpliTaq Gold. All reagents were supplied in the TaqMan PCR core reagent kit (PE Applied Biosystems). Each cDNA sample was analyzed in triplicate. Standard curves for 1
-hydroxylase and GAPDH were established by amplifying a purified PCR fragment covering the sites for probes and primers.
Statistical analyses
Unpaired t test was used for all statistical analyses. All data were calculated with Stat View 5.0 (SAS Institute, Inc., Cary NC). Values are presented as arithmetical mean ± SEM or as geometrical mean (in parentheses) multiplicative SD for gland weight.
Results
1
-hydroxylase mRNA is expressed in normal and pathological parathyroid tissue
To identify 1
-hydroxylase transcripts, RT-PCR analysis was done with mRNA-specific primers (Fig. 1A
) on the basis of human 1
-hydroxylase gene sequence (22). RT-PCR analysis of total RNA from a normal parathyroid gland biopsy, two parathyroid adenomas, and two different kidney RNA preparations yielded PCR products of the expected size, whereas no such product was obtained from normal human liver (Fig. 1B
). The DNA sequence of the PCR products was determined and found to be identical with the published one (22). To control for integrity of the RNA/cDNA preparations, RT-PCR was also performed using primers for GAPDH (Fig. 1B
). The 1
-hydroxylase mRNA seems to be present in low amounts in the investigated tissues because Northern blotting and RNase protection assay on total RNA failed to identify the transcript (data not shown).
|
-hydroxylase protein
Immunohistochemical analysis of 1
-hydroxylase protein expression on frozen tissue sections with a specific polyclonal peptide antiserum (5, 23) revealed specific immunoreactivity (Fig. 2
, representative immunostainings). Normal parathyroid chief cells displayed strong cytoplasmic and more or less evenly distributed staining, whereas fat cells and fibroblastic cells were unstained (Fig. 2A
). Thirteen of 17 analyzed parathyroid adenomas stained strongly but with more irregular pattern and variable intensity (Fig. 2D
), but four adenomas were generally weakly stained (Fig. 2E
). Eleven hyperplastic glands from patients with secondary hyperparathyroidism showed irregularly distributed strong immunoreactivity, with less intense staining in hyperplastic nodules than in surrounding areas (Figs. 2, B and C
). No immunoreactivity was observed when the 1
-hydroxylase antiserum was preincubated with the immunizing peptide (Fig. 2F
). Immunohistochemical analysis of 1
-hydroxylase expression in lesions of parathyroid cancer exhibited very weak staining for all five specimens analyzed (data not shown). Control immunostaining of normal human kidney tissue sections are shown in Fig. 2, G and H
.
|
-hydroxylase expression in parathyroid tumors
To quantify expression of 1
-hydroxylase, we determined the relative 1
-hydroxylase/GAPDH mRNA levels in 35 parathyroid tissue specimens, including 5 normal parathyroid gland biopsies, 15 adenomas of primary HPT, 10 hyperplastic glands of secondary HPT (8 with nodular and 2 with diffuse hyperplasia), and 5 parathyroid carcinomas. Serum (s)-calcium, s-creatinine, and s-PTH were preoperatively measured in all patients, and the clinical characteristics are shown in Table 1. The results from the real-time quantitative RT-PCR analysis (Fig. 3
), using mRNA-specific primers, showed higher 1
-hydroxylase/GAPDH ratio in the lesions from both primary (80.2 ± 18.0, P = 0.03) and secondary (49.3 ± 12.8, P = 0.03) HPT, compared with normal parathyroid tissues (5.1 ± 1.9). On the contrary, the parathyroid carcinomas exhibited lower 1
-hydroxylase expression than normal glands (0.4 ± 0.11, P = 0.04). Ten of 15 (67%) parathyroid adenomas and 8 of 10 (80%) secondary hyperplasias, respectively, showed more than 2-fold higher 1
-hydroxylase/GAPDH ratio, compared with normal glands. The remaining number of lesions (five and two, respectively) displayed a lower expression level, compared with normal glands, as did the five analyzed carcinomas (Fig. 3
).
|
-hydroxylase/GAPDH ratios obtained among the adenomas and secondary hyperplasias, we repeated the real-time quantitative RT-PCR analysis again for all 35 specimens in triplicate. Consistent results were obtained and with the same discontinuity within the two tumor groups. Confidently, large differences among 1
-hydroxylase/GAPDH ratios were due to differences of 1
-hydroxylase values and not of GAPDH. Furthermore, the immunoreactivity for 1
-hydroxylase varied consistently with the mRNA expression profile for individual lesions, with very weak staining for those with lower 1
-hydroxylase mRNA levels than normal glands (26 of a total of 35 lesions were stained). No correlations between 1
-hydroxylase mRNA expression level and gland weight, s-PTH, s-calcium, or s-creatinine were found. Apart from weaker 1
-hydroxylase immunoreactivity in some adenomas and nodules of secondary hyperplastic glands, there were no other obvious histopathological or clinical features explaining low or high expression in these glandular specimens. Discussion
In the present study, we have demonstrated 1
-hydroxylase mRNA and protein expression in normal parathyroid chief cells and pathological parathyroid tissue. The presence of LRP-2/megalin (21, 25) is consistent with a putative capacity for local synthesis of 1,25-(OH)2D3 in the parathyroid glands and may suggest an autocrine role for 1
-hydroxylase that is distinct from its renal counterpart. Moreover, recent studies have substantiated an autocrine/paracrine role of 1
-hydroxylase in certain cells, such as activated macrophages and keratinocytes (17), in contrast to the distinct endocrine actions of the enzyme in kidney tubule cells.
1,25(OH)2D3 and its intracellular receptor, the vitamin D receptor (VDR), play important roles in the feedback regulation of parathyroid function by suppression of PTH gene transcription and inhibition of PTH secretion. Moreover, 1,25(OH)2D3 is known to inhibit parathyroid cell proliferation and may have substantial differentiating effects by influence on secretory set-point in parathyroid cells (1, 2, 4, 26, 27, 28, 29). Decreased renal 1,25(OH)2D3 production and high phosphate levels are considered to be the principal cause of parathyroid glandular enlargement in patients with HPT secondary to uremia (28, 30 .) Treatment with active vitamin D suppresses PTH levels and may result in involution of the hyperplastic parathyroid tissue but may be inefficient in nodular hyperplastic glands with reduced VDR expression. Recent reports suggest that vitamin D may play a role in parathyroid tumor development in primary HPT because reduced VDR expression has been demonstrated also in some parathyroid adenomas (31, 32). Significant inverse relationship between serum levels of 25(OH)D3 and adenoma size has been described (33), which may be important in the context of extrarenal 1
-hydroxylase activity, that may not be subjected to the same feedback control as its renal counterpart (17). Local concentrations of 1,25(OH)2D3 in extrarenal tissues may depend primarily on the availability of its substrate 25(OH)D3 and presence of 1
-hydroxylase in parathyroid tissue may explain the relation between parathyroid adenoma size and serum levels of 25(OH)D3(33).
Relative to normal glands, we found an increased expression level of 1
-hydroxylase in the majority of parathyroid lesions from primary and secondary HPT. We therefore speculated that increased enzyme levels may lead to increased local production of 1,25(OH)2D3 in an effort to control parathyroid cell proliferation. Consistent with immunostaining five of the adenomas, two of the secondary hyperplasias and the five analyzed parathyroid carcinomas displayed lower 1
-hydroxylase mRNA expression than normal glands. Previous studies in prostate cancer have revealed lower levels of 1
-hydroxylase activity in tumor tissue, compared with normal prostate (13). Moreover, recent studies of colorectal carcinoma have shown increased 1
-hydroxylase and VDR expression in early-phase carcinogenesis but low levels of both these mRNAs in poorly differentiated carcinoma (34). Although it is difficult to completely rule out that lower 1
-hydroxylase/GAPDH ratios observed for five adenomas and two secondary hyperplastic glands may be due to differences in handling or storage of the specimens, it is clear from the analysis of GAPDH mRNA that the overall quality of the mRNA preparations were good.
We also repeated the quantitative mRNA analysis for all specimens with consistent results. It is therefore likely that low or high expression of 1
-hydroxylase mRNA reflects the physiology of the particular tissue specimen. No obvious relationships between 1
-hydroxylase expression level and histopathological or clinical data such as gland weight, s-PTH, s-calcium, or s-creatinine were found. The mechanisms involved in stimulating or attenuating 1
-hydroxylase expression in normal and pathological parathyroid cells as well as other neoplastic tissues are yet unknown but have awaked considerable interest. It is possible that the few adenomas and hyperplastic parathyroid glands with low 1
-hydroxylase expression, like the parathyroid carcinomas, represent tumor entities with less pronounced endogenous response to tumor progress, as has been depicted for poorly differentiated colorectal carcinoma (34). The factors responsible for transcriptional and translational regulation of 1
-hydroxylase should be of considerable interest to elucidate because they may constitute important means for endogenous differentiation of parathyroid cells and other tumors.
In conclusion, we have shown for the first time that human parathyroid cells express the enzyme 1
-hydroxylase. This enzyme is overexpressed in a number of parathyroid adenomas of primary HPT and in hyperplastic glands of secondary HPT and underexpressed in parathyroid carcinomas, compared with normal parathyroid glands. We suggest that overexpression of 1
-hydroxylase leads to increased local production of 1,25(OH)2D3 and to growth-controlling effects on parathyroid lesions of primary and secondary HPT.
Acknowledgments
We are greatly indebted to Birgitta Bondeson, Peter Lillhager, and Daniel Lindberg for excellent technical assistance. We also thank Dr. Anders Knutson for initial discussions.
Footnotes
This work was supported by the Swedish Medical Research Council (Grant 12574), Swedish Cancer Society (Grant 2499), Lions Fund for Cancer Research, and Ingrid Thuring Foundation.
1 U.S. and P.C. contributed equally to this work. ![]()
2 Present address for M.H.: Department of Medicine, Institute of Clinical Research, University of Birmingham, Birmingham, United Kingdom B15 2TT. ![]()
3 Present address for H.D.: Department of General Surgery, Martin-Luther-University of Halle-Wittenberg, 06097 Halle/Saale, Germany. ![]()
Abbreviations: 1
-Hydroxylase, 25-Hydroxyvitamin D3-1
-hydroxylase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HPT, hyperparathyroidism; 1,25(OH)2D3, 1,25-dihydroxyvitamin D3; 25(OH)D3, 25-hydroxyvitamin D3; s, serum; VDR, vitamin D receptor.
Received February 7, 2001.
Accepted March 7, 2002.
References
This article has been cited by other articles:
![]() |
A. W Norman From vitamin D to hormone D: fundamentals of the vitamin D endocrine system essential for good health Am. J. Clinical Nutrition, August 1, 2008; 88(2): 491S - 499S. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Romagnoli, M. L. Mascia, C. Cipriani, V. Fassino, F. Mazzei, E. D'Erasmo, V. Carnevale, A. Scillitani, and S. Minisola Short and Long-Term Variations in Serum Calciotropic Hormones after a Single Very Large Dose of Ergocalciferol (Vitamin D2) or Cholecalciferol (Vitamin D3) in the Elderly J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 3015 - 3020. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Carter, S. E. O'Riordan, G. L. Eaglestone, M. P. Delaney, and E. J. Lamb Bone mineral metabolism and its relationship to kidney disease in a residential care home population: a cross-sectional study Nephrol. Dial. Transplant., June 10, 2008; (2008) gfn302v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Krajisnik, P. Bjorklund, R. Marsell, O. Ljunggren, G. Akerstrom, K. B Jonsson, G. Westin, and T. E Larsson Fibroblast growth factor-23 regulates parathyroid hormone and 1{alpha}-hydroxylase expression in cultured bovine parathyroid cells J. Endocrinol., October 1, 2007; 195(1): 125 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zajickova, J. Vrbikova, L. Canaff, P. D. Pawelek, D. Goltzman, and G. N. Hendy Identification and Functional Characterization of a Novel Mutation in the Calcium-Sensing Receptor Gene in Familial Hypocalciuric Hypercalcemia: Modulation of Clinical Severity by Vitamin D Status J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2616 - 2623. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shiizaki, N. Hayakawa, I. Imazeki, I. Hatamura, T. Okada, S. Negi, T. Sakaguchi, T. Shigematsu, and T. Akizawa Binding of highly concentrated maxacalcitol to the nuclear vitamin D receptors of parathyroid cells Nephrol. Dial. Transplant., April 1, 2007; 22(4): 1078 - 1086. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fournier, L. Harbouche, J. Mansour, and I. Shahapuni Impact of calcium and vitamin D therapy on arterial and cardiac disease in young adults with childhood-onset end stage renal disease Nephrol. Dial. Transplant., March 1, 2007; 22(3): 956 - 957. [Full Text] [PDF] |
||||
![]() |
P. Bjorklund, G. Akerstrom, and G. Westin Accumulation of Nonphosphorylated {beta}-Catenin and c-myc in Primary and Uremic Secondary Hyperparathyroid Tumors J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 338 - 344. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. van Driel, M. Koedam, C. J. Buurman, M. Hewison, H. Chiba, A. G. Uitterlinden, H. A. P. Pols, and J. P. T. M. van Leeuwen Evidence for auto/paracrine actions of vitamin D in bone: 1{alpha}-hydroxylase expression and activity in human bone cells FASEB J, November 1, 2006; 20(13): 2417 - 2419. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Bonne, J. Mansour, I. S. Philippe Moriniere, and A. Fournier Current treatment options in secondary renal hyperparathyroidism Nephrol. Dial. Transplant., October 1, 2006; 21(10): 2987 - 2989. [Full Text] [PDF] |
||||
![]() |
B Moosgaard, P Vestergaard, L Heickendorff, F Melsen, P Christiansen, and L Mosekilde Plasma 25-hydroxyvitamin D and not 1,25-dihydroxyvitamin D is associated with parathyroid adenoma secretion in primary hyperparathyroidism: a cross-sectional study. Eur. J. Endocrinol., August 1, 2006; 155(2): 237 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Bikle For Whom the Bugs Toll; They Toll for D IBMS BoneKEy, April 1, 2006; 3(4): 12 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Khadzkou, P. Buchwald, G. Westin, H. Dralle, G. Akerstrom, and P. Hellman 25-Hydroxyvitamin D3 1{alpha}-Hydroxylase and Vitamin D Receptor Expression in Papillary Thyroid Carcinoma J. Histochem. Cytochem., March 1, 2006; 54(3): 355 - 361. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grey, J. Lucas, A. Horne, G. Gamble, J. S. Davidson, and I. R. Reid Vitamin D Repletion in Patients with Primary Hyperparathyroidism and Coexistent Vitamin D Insufficiency J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2122 - 2126. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Evans, H. Taylor, D. Zehnder, M. D. Kilby, J. N. Bulmer, F. Shah, J. S. Adams, and M. Hewison Increased Expression of 25-Hydroxyvitamin D-1{alpha}-Hydroxylase in Dysgerminomas: A Novel Form of Humoral Hypercalcemia of Malignancy Am. J. Pathol., September 1, 2004; 165(3): 807 - 813. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Komuro, M. Sato, and H. Kanamaru DISPOSITION AND METABOLISM OF F6-1{alpha},25(OH)2 VITAMIN D3 AND 1{alpha},25(OH)2 VITAMIN D3 IN THE PARATHYROID GLANDS OF RATS DOSED WITH TRITIUM-LABELED COMPOUNDS Drug Metab. Dispos., August 1, 2003; 31(8): 973 - 978. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Holick The Parathyroid Hormone D-Lema J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3499 - 3500. [Full Text] [PDF] |
||||
![]() |
R. Vieth, Y. Ladak, and P. G. Walfish Age-Related Changes in the 25-Hydroxyvitamin D Versus Parathyroid Hormone Relationship Suggest a Different Reason Why Older Adults Require More Vitamin D J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 185 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Hanley Puzzling vitamin D results Can. Med. Assoc. J., October 15, 2002; 167(8): 849 - 850. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |