help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamamoto, N.
Right arrow Articles by Strauss, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamamoto, N.
Right arrow Articles by Strauss, J. F., III
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 6 2849-2856
Copyright © 2002 by The Endocrine Society


Other Original Articles

Growth Differentiation Factor-9 Inhibits 3'5'-Adenosine Monophosphate-Stimulated Steroidogenesis in Human Granulosa and Theca Cells

Noriko Yamamoto, Lane K. Christenson, Jan M. MCAllister and Jerome F. Strauss, III

Center for Research on Reproduction and Women’s Health (N.Y., L.K.C., J.F.S.), University of Pennsylvania Medical Center, Philadelphia, Pennsylvania 19104; and Milton S. Hershey Medical Center (J.M.M.), The Pennsylvania State University College of Medicine, Department of Cellular and Molecular Physiology, Hershey, Pennsylvania 17033

Address all correspondence and requests for reprints to: Jerome F. Strauss, III, M.D., Ph.D., Director, Center for Research on Reproduction and Women’s Health, 1354 Biomedical Research Building II/III, 421 Curie Boulevard, Philadelphia, Pennsylvania 19104. E-mail: . jfs3{at}mail.med.upenn.edu

Abstract

Growth differentiation factor-9 (GDF-9), a member of the transforming growth factor superfamily, modulates the development and function of granulosa and theca cells. Targeted deletion of GDF-9 in the mouse revealed that GDF-9 was essential for the establishment of the thecal cell layer during early folliculogenesis. During later stages of follicular development, the roles of GDF-9 are less well understood, but it has been postulated that oocyte-derived GDF-9 may prevent premature luteinization of follicular cells, based on its ability to modulate steroidogenesis by rodent ovarian cells. In the rodent, GDF-9 is expressed solely by the oocyte from the early primary follicular stage through ovulation. Recent studies in the rhesus monkey demonstrated that granulosa cells express GDF-9, suggesting a broader role for this protein in ovarian function in primates. We examined the effect of recombinant GDF-9 on proliferating human granulosa and thecal cell steroidogenesis and the expression of steroidogenic acute regulatory protein (StAR), P450 side-chain cleavage, and P450 aromatase. We also examined granulosa cell GDF-9 expression by quantitative RT-PCR and by Western analysis. GDF-9 inhibited 8-Br-cAMP-stimulated granulosa progesterone synthesis by approximately 40%, but did not affect basal progesterone production. Concordant with reduced steroid production, 8-Br-cAMP-stimulated StAR protein expression was reduced approximately 40% in granulosa cells, as were expression of StAR mRNA and StAR promoter activity. Additionally, GDF-9 inhibited 8-Br-cAMP-stimulated expression of P450 side-chain cleavage and P450 aromatase. Human granulosa cells expressed GDF-9, as determined by RT-PCR and Western analysis. Treatment of human thecal cells with GDF-9 blocked forskolin-stimulated progesterone, 17{alpha}-hydroxyprogesterone, and dehydroepiandrosterone synthesis. Thecal cells exhibited greater sensitivity to GDF-9, suggesting that this cell may be a primary target of GDF-9. Moreover, GDF-9 increased thecal cell numbers during culture, but had no effect on granulosa cell growth. Our findings implicate GDF-9 in the modulation of follicular steroidogenesis, especially theca cell function. Because GDF-9 mRNA and protein are detectable in granulosa-lutein cells after the LH surge, the concept of GDF-9 as a solely oocyte-derived luteinization inhibitor needs to be reevaluated.

DURING THE PERIOVULATORY period, there is a dramatic shift in the steroidogenic mission of the Graffian follicle as it is converted from an estrogen synthetic tissue to an organ that predominantly synthesizes progesterone. One of the unique features of the shift in steroidogenic activity of luteinizing granulosa cells is the acquisition of proteins necessary to take up and process cholesterol into progesterone. Though it is well established that luteinization of granulosa and thecal cells is initiated by the preovulatory surge of gonadotropins, the role that factors produced in the follicle play in modulating gonadotropin action is only now being revealed. In addition to somatic cell-derived growth factors, oocyte-derived growth factors are thought to influence follicular development. Indeed, removal of the oocyte from a preovulatory follicle initiates the process of luteinization, suggesting that the oocyte secretes a substance(s) that inhibits luteinization (1, 2). Furthermore, bidirectional communication between the oocyte and the surrounding steroidogenic cells seems to be critical not only for normal oocyte development but also for normal granulosa and thecal cell function (3, 4).

Several oocyte-derived factors have been established to play critical roles in the initial organization and development of follicles, through the analysis of mice with targeted gene deletion (5, 6). One such factor is growth differentiation factor-9 (GDF-9), a member of the bone morphogenetic protein (BMP) subfamily of proteins that belongs to the transforming growth factor ß-superfamily (7, 8). In vivo experiments confirmed that exogenous GDF-9 influences early follicular cell proliferation and subsequent follicle development in rodents (9). Immature rats treated with GDF-9 exhibited a significant increase in ovarian weight, increased numbers of primary and small preantral follicles, and increased expression of thecal cell CYP17 (9). Recent studies demonstrate that rat recombinant GDF-9 can also promote the growth, development, and survival of human ovarian follicles in an organ culture system (10). However, the continued presence of GDF-9 in oocytes throughout folliculogenesis and in ovulated cumulus-enclosed oocytes suggested a broader role for this oocyte-derived growth factor (7). To determine whether GDF-9 modulates follicular cell steroidogenesis, the effects of exogenous GDF-9 on steroid production by rat and mouse granulosa cells has been investigated in cell culture systems (11, 12, 13, 14, 15). GDF-9 was shown to stimulate granulosa cell proliferation and basal steroidogenesis; in contrast, GDF-9 inhibited FSH-stimulated progesterone biosynthesis as well as other actions of FSH. Other members of the BMP-receptor superfamily (including BMP-4, -6, -7, and -15) have been shown to inhibit hormone-stimulated rodent thecal and granulosa progesterone biosynthesis (16, 17, 18, 19, 20, 21).

Studies of BMP effects on human ovarian cell steroidogenesis are limited to a single report in which BMP-4 treatment was found to decrease forskolin-stimulated androgen synthesis by a human ovarian thecal-like tumor cell line (19). Because of the marked differences in the regulation of folliculogenesis between rodent and primate species, we tested the effect of recombinant GDF-9 on human granulosa and thecal cell steroidogenesis. A recent study demonstrated that GDF-9 was expressed by macaque granulosa cells (22); and therefore, we also examined whether GDF-9 expression occurs in human granulosa cells. Here, we show that GDF-9 inhibits cAMP-dependent steroidogenesis in proliferating human granulosa and thecal cells, accompanied by decreased expression of steroidogenic acute regulatory protein (StAR), the protein which controls the rate-limiting step in steroidogenesis.

Materials and Methods

Cell isolation and cell culture

Human granulosa cells obtained from the University of Pennsylvania’s in vitro fertilization program, as approved by the Institutional Review Board, were either propagated and maintained in long-term culture, as previously described, or immediately processed for protein/RNA samples (freshly-isolated granulosa-lutein cells) (23). Granulosa cells were obtained from patients with normal cycles and infertility caused by structural disorders. The controlled ovarian stimulation protocol for in vitro fertilization patients includes luteal-phase lupron (10 mg, twice daily; Abbott Laboratories, Abbott Park, IL), followed by recombinant FSH stimulation (Gonal-F, Serono Laboratories, Inc., Geneva, Switzerland), with doses varying from 150–450 IU, depending on the patient response. Human CG was administered when at least three follicles were 17–18 mm in diameter; oocyte retrieval was completed 36 h after human CG injection. Briefly, human granulosa-lutein cells were isolated from the follicular aspirate by centrifugation, followed by the removal of contaminating red blood cells by centrifugal separation using the Ficoll reagent. The granulosa cell layer was then resuspended in PBS and washed two times to remove the Ficoll reagent. Granulosa cells were propagated in a growth medium that consisted of a 1:1 mix of DMEM (low glucose, Life Technologies, Inc., Grand Island, NY) and Ham’s F-12 medium containing 5% FBS (Life Technologies, Inc.), 5% horse serum (Irvine Scientific, Santa Anna, CA), 2% UltroSer G (Bio Sepra, Cergy-Saint-Cristophe, France), 20 nM insulin, 20 nM selenium, 1.0 µM vitamin E (Sigma, St. Louis, MO), and 1% antibiotic penicillin-streptomycin-fungizone (Life Technologies, Inc.). Cells were maintained at 37 C, in a humidified incubator, under an atmosphere of 5% CO2-95% air. When cells reached confluence, they were dispersed, using 0.05% trypsin, and then used in experiments, or aliquots of these cells were frozen at -150 C for subsequent studies. Human theca cells were isolated and cultured as previously described (23). The thecal cells from three patients were cultured in the same medium as described above for the granulosa cells, the only difference in culture conditions being the use of a 5% CO2-5% O2-90% nitrogen environment.

Before initiation of treatments, granulosa cells were plated in 12-well plates, at 5.0 x 104 cells/well, in the growth medium for 24 h. Cells were washed 2 times with serum-free media (SFM; 1:1 mixture of DMEM and Ham’s F-12 medium containing 1.0 mg/ml BSA (Sigma), 100 µg/ml transferrin (human 98%, Sigma), 20 nM insulin, 20 nM selenium, 1 µM vitamin E, and 1% antibiotic solution, before treatment protocols were initiated. Granulosa and theca cells were exposed to various combinations of 1 mM 8-Br-cAMP (Sigma), 10 µM forskolin (Sigma), and 10–400 ng/ml recombinant rat-GDF-9 (generously provided by Dr. Aaron Hsueh, Stanford University, CA). After 48 h culture, an aliquot of the medium was collected and frozen at -20 C for subsequent steroid analysis. An estimate of cellular proliferation was determined for granulosa cells (total protein) and for thecal cells (Coulter counter) at the completion of the treatment protocol. Cells were then used for isolation of protein for Western analysis or for RNA as described below.

Steroid analysis

Media progesterone, 17{alpha}-hydroxyprogesterone, and dehydroepiandrosterone (DHEA) concentrations were assayed using the respective Coat-A-Count tubes and regents (Diagnostic Products, Los Angeles, CA) as described by the manufacturer.

Real-time RT-PCR

Granulosa cell total RNA was isolated using TRIzol reagent (Life Technologies, Inc.) 48 h after treatment with GDF-9 and/or 8-Br-cAMP. One to 5 µg of total RNA was treated with RQ1 ribonuclease-free deoxyribonuclease (Promega Corp., Madison, WI), for 30 min at 37 C, before RT with Moloney murine leukemia virus reverse transcriptase (Promega Corp.), as described by the manufacturer. The resulting cDNA was diluted 10-fold in sterile water, and aliquots were subjected to quantitative real-time PCR. PCR primer pairs and probes for the analysis were designed with the Primer Express 1.5 software that accompanies the Model 7700 sequence detector (PE Applied Biosystems). Quantitative RT-PCR for human StAR used the TaqMan Universal Master Mix (PE Applied Biosystems, Foster City, CA) and 900 nM of the forward (CCACCCCTAGCACGTGGAT, bases 254–272) and reverse primers (TCCTGGTCACTGTAGAGAGTCTCTTC, bases 341–316) and 200 nM of the fluorescent probe (FAM-CGGAGCTCTCTACTCGGTTCTC-TAMRA, bases 289–313).

Primers for detection of the human P450 side-chain cleavage (P450scc) cDNA (forward, TGGGTCGCCTATCACCAGTAT, bases 420–440; reverse, CCACCCGGTCTTTCTTCCA, bases 501–483), human P450 aromatase (P450arom) cDNA (forward, ACCCTTCTGCGTCGTGTCA, bases 313–331; reverse, GAACTTCTATGGCATCTTTCAAA TCC, bases 405–380), and human GDF-9 (forward, TGTTCGGCTCTTCACCCC, bases 339–356; reverse, AGGATTCCTGTTACCTGGTCTCC, bases 404–382) were detected using the SYBR green reagent. Primer concentrations for each target cDNA were determined empirically, and agarose gel electrophoresis indicated the presence of a single PCR product. To account for differences in starting material, the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers and probe reagents from PE Applied Biosystems were used. The experimental and GAPDH PCR reactions were done in separate tubes in triplicate, and the average threshold cycle for the triplicate was used in subsequent calculations.

The relative differences among the treatment groups were determined as outlined in the PE Applied Biosystems protocol for RT-PCR. Briefly, the experimental results [threshold cycle, (CT)] were adjusted by subtracting the CT value for the GAPDH, yielding a {Delta}CT value for each sample. Subtracting the {Delta}CT for the control from each experimental {Delta}CT yields a {Delta}CT value that can then be directly converted to a fold increase over the control by raising 2 to the {Delta}|gDCT power.

Promoter activity studies

Proliferating human granulosa cells (50,000 cells/well) were plated into 12-well plates and transfected with the FuGENE-6 (Roche Applied Science, Indianapolis, IN) protocol as described previously (24). The 1.3-kb human StAR promoter and the -885 and -235 StAR promoter constructs fused to the pGL2-luciferase reporter vector have been previously described (25). Briefly, cells were transfected with 25 ng Renilla luciferase control reporter vector (pRL-TK, Promega Corp.) and 500 ng pGL2 luciferase reporter vectors. After overnight exposure to the plasmid/FuGENE complexes, the cells were washed in SFM twice, then incubated with SFM containing 1 mM 8-Br-cAMP and/or 200 ng/ml GDF-9. After 12 h culture, cells were harvested with Luciferase Passive Lysis Buffer (Promega Corp.) for luciferase assay using the dual-assay luciferase reporter assay system (Promega Corp.) as described by the manufacturer.

Western blot analysis

Protein extracts from granulosa and theca cells were generated as previously described (26). Protein concentrations of the extracts were determined by the bicinchoninic acid protein assay, using the BCA assay kit (Pierce Chemical Co., Rockford, IL). Equal amounts of protein (15 µg) were loaded onto 10% SDS-PAGE gels for electrophoresis. After electrophoresis, gels were transferred to polyvinylidene difluoride membranes for probing with rabbit polyclonal anti-StAR antibody, the rabbit polyclonal anti-P450scc, or the goat polyclonal anti-GDF-9 antibody. The detection of StAR/P450scc-antibody complexes was carried out using the Vistra ECF Western Blotting Kit (Amersham Pharmacia Biotech, Arlington Heights, IL), and the chemifluorescence signal was detected with a Storm PhosphoImager using the blue fluorescence/chemifluorescence mode as previously described (27). The intensities of each band were quantified using the Image Quant 1.1 software. For detection of antibody bound to GDF-9, we used the SuperSignal Femto West (Pierce Chemical Co.) reagent as described by the manufacturer.

Data analysis

Results of steroid assays, cell proliferation, Western blot analyses, real-time RT-PCR, and promoter activity were analyzed by ANOVA using the JMP3.1 program (SAS Institute, Inc., Cary, NC). After observation of a significant (P < 0.05) F-test, differences between means were determined using the Tukey-Kramer mean-separation test. Results are presented as fold changes over control values.

Results

GDF-9 inhibits 8-Br-cAMP-stimulated steroidogenesis and expression of genes involved in steroidogenesis in human granulosa and theca cells

Increasing doses of recombinant GDF-9 caused a dose-dependent inhibition of 8-Br-cAMP-stimulated progesterone synthesis by human granulosa cells, but had no measurable effect on basal progesterone production (Fig. 1AGo). A dose of 200 ng/ml GDF-9, studied in five different primary granulosa cell cultures, caused a decline of approximately 40% (P < 0.05) in 8-Br-cAMP-stimulated progesterone production. Granulosa cell total protein levels for control-treated cells (92.7 ± 15.7 µg/well; means ± SE, n = 5) were not different from 8-Br-cAMP-treated cells (96.1 ± 19.2 µg/well) or the 200 ng GDF-9-treated cells (87.4 ± 13.6 µg/well), indicating that treatment did not affect cell proliferation. Likewise, no combined effects of GDF-9 and 8-Br-cAMP on total cellular protein levels were observed (89.45 ± 16.2 µg/well).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Effects of GDF-9 on human granulosa cell progesterone production. A, Concentration-dependent effects of GDF-9 on basal and 8-Br-cAMP-stimulated human granulosa cell progesterone production. Cells were treated with 8-Br-cAMP (1 mM) plus GDF-9 in increasing doses (10–200 ng/ml) for 48 h as described in Materials and Methods. The experiment was conducted with granulosa cells from three different patients, and similar effects of 8-Br-cAMP/forskolin and GDF-9 were observed. Data presented are for a representative experiment. Each data point represents the mean ± SEM of replicate dishes (n = 3) from a single patient. B, Effect of a maximal inhibitory dose of GDF-9 (200 ng/ml) on human granulosa cell basal and 8-Br-cAMP-stimulated progesterone synthesis. Cells from five patients were treated with GDF-9 alone and 8-Br-cAMP ± GDF-9 and compared with control (nontreated cells). Data are expressed as the fold change in progesterone production over that observed in the control treated samples (represented by the dashed line). a, b, and c, Means ± SEM with different superscripts are significantly different (P < 0.05).

 
Treatment of proliferating theca cells with GDF-9 also markedly reduced forskolin-stimulated progesterone, 17{alpha}-hydroxyprogesterone, and DHEA production (Fig. 2Go). Unlike granulosa cells, GDF-9 treatment also caused a decline of approximately 5-fold in basal progesterone and 17{alpha}hydroxyprogesterone production in theca cells during the 48-h treatment period, but it did not effect basal DHEA production. Forskolin treatment of thecal cells caused a 36.2 ± 0.4% decline in cell numbers. Conversely, GDF-9 increased thecal cell numbers in a dose-dependent manner, irrespective of forskolin treatment (Fig. 2DGo). GDF-9 augmentation of thecal cell numbers ranged from 7.3–17.5% for the 50- to 400-ng/ml treatments.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Effects of GDF-9 on proliferating theca cell steroidogenesis and StAR protein expression. Thecal cells were treated with forskolin (10 µM) or 8-Br-cAMP (1 mM) plus GDF-9 in increasing doses (10–400 ng/ml) for 48 h; and progesterone (A), 17{alpha}-hydroxyprogesterone (B), and DHEA (C) were measured as described in Materials and Methods. D, Cell count represents the total number of cells/well. E, Western analysis of StAR protein expression in theca cells treated with GDF-9 and 8-Br-cAMP. Experiments were conducted with cells from two different patients, and similar effects of 8-Br-cAMP/forskolin and GDF-9 were observed. Data presented are for a representative experiment. Each steroid and cell count data point represents the mean ± SEM of replicate dishes (n = 3) from a single patient.

 
Western blot analysis revealed that StAR protein levels in human granulosa cells increased about 5-fold after treatment with 8-Br-cAMP. The 30-kDa mature StAR protein, but not the 37-kDa preprotein, was detected in these analyses. GDF-9 caused a dose-dependent reduction in the 8-Br-cAMP-stimulated 30-kDa StAR protein accumulation (Fig. 3AGo). Quantitative analysis of the StAR protein levels in five different primary granulosa cell cultures demonstrated that a 200 ng/ml dose of GDF-9 caused a decline of approximately 40% (P < 0.05) in the amount of the 30-kDa StAR protein in 8-Br-cAMP-stimulated cells (Fig. 3AGo), consistent with the degree of inhibition of progesterone production. Theca cell StAR protein levels were also examined; and, similar to granulosa cells, 8-Br-cAMP-stimulated StAR protein was reduced by approximately 50% after treatment with 200 ng/ml GDF-9 (Fig. 2EGo). In addition to decreasing StAR protein levels, GDF-9 treatment also inhibited 8-Br-cAMP-stimulated accumulation of P450scc in human granulosa cells (Fig. 3BGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. StAR and P450scc protein expression in human granulosa cells treated with GDF-9 and 8-Br-cAMP. A, Representative StAR Western blot and histogram, depicting the quantitative analysis of the StAR protein levels in human granulosa cells. Cells from five patients were treated with GDF-9 (200 ng/ml) alone or in combination with 8-Br-cAMP and were compared with control (nontreated) cells. B, Representative P450scc Western blot and histogram for quantitative analysis of the StAR protein levels in human granulosa cells (experiment was repeated three times). Data are expressed as the fold change in progesterone production over that observed in the control samples. a, b, and c, Means ± SEM with different superscripts are significantly different (P < 0.05).

 
Quantitative real-time RT-PCR analysis demonstrated that StAR mRNA levels were unaffected by GDF-9 (200 ng/ml) treatment alone and were increased 6.8-fold after 8-Br-cAMP treatment (Table 1Go). StAR mRNA levels in human granulosa cells treated with a combination of 8-Br-cAMP and GDF-9 were approximately 50% of those observed with the 8-Br-cAMP treatment alone. The 8-Br-cAMP treatment caused a 4.5-fold increase in P450scc expression, and GDF-9 treatment alone had no effect on P450scc transcripts, whereas GDF-9 inhibited 8-Br-cAMP-stimulated increases in P450scc mRNA levels by 45% (Table 1Go). Additionally, we measured the levels of P450arom mRNA within the human granulosa cells under the same treatment conditions described above. We observed no effect of GDF-9 treatment alone, a prominent increase (33-fold) in response to 8-Br-cAMP treatment, and a reduction of approximately 3-fold in the 8-Br-cAMP response when cells were simultaneously treated with GDF-9 and 8-Br-cAMP (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Quantitative analysis of StAR, P450scc, and P450arom mRNA expression in human granulosa cells treated with GDF-9 and 8-Br-cAMP

 
GDF-9 impairs 8-Br-cAMP stimulation of StAR promoter activity

To determine whether GDF-9 was restraining 8-Br-cAMP-stimulated StAR mRNA expression by decreasing transcription, we transiently transfected human granulosa cells with human StAR promoter constructs fused to a luciferase reporter vector and then treated the cells with 8-Br-cAMP or a combination of 8-Br-cAMP and GDF-9. The 1.3-kb StAR promoter construct exhibited a 2.75-fold increase in activity after 8-Br-cAMP treatment, and simultaneous administration of GDF-9 resulted in a 30% decline in StAR promoter activity (Table 2Go). In contrast, when shorter StAR promoter constructs were tested, GDF-9 had no effect on 8-Br-cAMP-stimulated promoter activity (Table 2Go). These observations suggest that GDF-9 influences the action of transcription factors lying upstream from the proximal promoter.


View this table:
[in this window]
[in a new window]
 
Table 2. StAR promoter activity in human granulosa cells treated with 8-Br-cAMP and GDF-9 (fold change in comparison with control cells)

 
Expression of GDF-9

Until recently, GDF-9 was thought to be an oocyte-specific factor. To determine whether human granulosa cells are capable of expressing GDF-9 mRNA, we used two different sets of PCR primers and verified the identity of the amplicon by sequencing. One set of PCR primers spanned the single 1581-bp intron in the GDF-9 gene and yielded a single PCR fragment of the appropriate size and sequence (data not shown). We were also able to detect GDF-9 transcripts in proliferating luteinized human granulosa cells and in freshly isolated human granulosa-lutein cells using a set of real-time PCR primers (Fig. 4AGo). We were unable to detect an effect of 8-Br-cAMP or GDF-9 treatment on GDF-9 expression in proliferating human granulosa cells (Fig. 4BGo). GDF-9 protein (28 kDa) was detected in freshly isolated human granulosa cells (Fig. 4CGo).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 4. GDF-9 expression in human granulosa cells. A, GDF-9 real-time RT-PCR products from proliferating (cultured) human granulosa cells and freshly isolated human granulosa-lutein cells (n = 2). B, Histogram depicts the real-time RT-PCR data from proliferating granulosa cells obtained from three different patients. Cells were treated with GDF-9 alone and 8-Br-cAMP ± GDF-9 and compared with control (nontreated) cells. Data are expressed as the relative fold change of GDF-9 transcripts over that observed in the control samples (represented by the dashed line). No significant effect of GDF-9 or 8-Br-cAMP treatment was observed on GDF-9 expression. C, Western analysis of GDF-9 in freshly isolated human granulosa cells. The expected 28-kDa GDF-9 band was observed in all five of the samples examined (three are shown).

 
Discussion

These experiments examined, for the first time, the effects that GDF-9 has on human granulosa and theca cell steroidogenesis and expression of key steroidogenic proteins. GDF-9 inhibited steroidogenesis in both human granulosa and thecal cells by blocking the hormonal (cAMP) dependent-expression of StAR, P450scc, and P450arom mRNA. In granulosa cells, GDF-9 inhibited cAMP-dependent expression of StAR mRNA by approximately 40% and reduced protein levels by approximately 50%, consistent with the reduction of approximately 40% in cAMP-dependent progesterone synthesis by GDF-9. Our experiments also demonstrated that GDF-9 had similar effects on expression of P450scc and P450arom mRNAs in human granulosa cells, implying that GDF-9 produces a global reduction in steroidogenesis by blocking a key step in the cAMP-dependent/protein kinase A pathway.

Although GDF-9 caused a decline of approximately 40% in 8-Br-cAMP-stimulated steroidogenesis by human ovarian granulosa cells, it did not affect basal steroid production. Similarly, in rat granulosa cells obtained after equine CG treatment of immature animals, GDF-9 caused a reduction of approximately 56% in FSH-stimulated progesterone synthesis. The inhibition of steroidogenesis caused by GDF-9 was not unexpected, because many members of the TGF-ß receptor superfamily that have been localized within ovarian tissue (including TGF-ß, activins, and BMP-4, -6, -7 and -15) inhibit granulosa and/or thecal cell steroidogenesis (16, 19, 28). However, in contrast to our observations with proliferating human granulosa cells, Vitt et al. (15) reported that GDF-9 treatment of preovulatory rat granulosa cells did not inhibit forskolin-stimulated progesterone synthesis. However, these investigators showed that GDF-9 blocked FSH-stimulated production of cAMP (15). Elvin and co-workers (11, 12) found that GDF-9 did not affect mouse granulosa cell FSH-stimulated progesterone production but increased basal progesterone synthesis. The observed differences in GDF-9 effects on rat and mouse granulosa cell steroidogenesis highlight the importance of species differences and the need for studies on human cells. Our studies with proliferating human granulosa cells demonstrate an inhibitory effect of GDF-9 on cAMP-dependent progesterone secretion. The apparent discrepancies regarding the action of GDF-9 on rodent and human ovarian cells may be a result of differences in the control of follicular growth in a monoovulatory species vs. that of a multiovulatory species. However, these differences cannot explain the differential effects of GDF-9 on ovarian follicular function in the mouse and rat. Thus, GDF-9 may exhibit species-specific effects on granulosa cell function. Alternatively, the divergent responses of human, rat, and mouse granulosa cells to GDF-9 may be a result of differences in granulosa cell maturation and/or culture conditions.

GDF-9 inhibited steroid production by proliferating human thecal cells. These results are not consistent with observations on forskolin-stimulated primary rat thecal cells, where progesterone and androgen accumulation were not affected by GDF-9 (14). Conversely, GDF-9 treatment of transformed rat theca-interstitial cells enhanced forskolin-stimulated androgen secretion while simultaneously inhibiting accumulation of progesterone (14). The enhancement of androgen synthesis after in vitro treatment with recombinant GDF-9 is consistent with in vivo observations in immature PMSG-treated rats, where GDF-9 increased CYP17 expression (9). Our studies showed that GDF-9 treatment of human theca cells inhibited both basal and forskolin-stimulated progesterone biosynthesis as well as reducing the production of 17{alpha}-hydroxyprogesterone and DHEA. Therefore, it again seems that GDF-9 exhibits significant species-specific effects on steroidogenesis. Alternatively, the discordant responses observed after GDF-9 treatment of human and rodent thecal cells might be attributable to different maturation states of the cells used in the experiments. The importance of differentiation is illustrated by the effects of GDF-9 on primary thecal cells vs. transformed rat thecal-interstitial cells.

Evidence for a differential effect of a member of the BMP family of proteins on ovarian steroidogenesis already exists. The closely related member of the TGF-ß family, BMP-15, which shares a high degree of homology (52% amino acid sequence identity) to GDF-9, also inhibits FSH-stimulated (but not basal) steroidogenesis by rat granulosa cells (18). Similarly, BMP-6, another oocyte-derived growth factor, was shown to inhibit FSH-stimulated progesterone biosynthesis (17). BMP-15 blocks FSH-stimulated steroidogenesis by preventing the synthesis of FSH receptors, but it failed to inhibit forskolin or 8-Br-cAMP-stimulated progesterone production (18). Similar to BMP-15, BMP-6 also inhibited FSH-stimulated steroidogenesis. However, in contrast to BMP-15, BMP-6 inhibited forskolin-stimulated progesterone production but not 8-Br-cAMP-stimulated progesterone synthesis (17). These results suggest that BMP-6 functions downstream of adenylate cyclase activation but upstream of 8-Br-cAMP action. GDF-9’s ability to block human granulosa and thecal steroidogenesis in our experiments, at a point downstream of 8-Br-cAMP-dependent activation, suggests that a common point of inhibition may be targeted in these two cell types. However, the responsiveness of thecal and granulosa cells to the effects of GDF-9 was substantially different. This differential effect of GDF-9 was evidenced by the greater sensitivity and greater extent of inhibition of steroidogenesis in the proliferating human thecal cells vs. proliferating human granulosa cells. Moreover, thecal cell growth was evidently enhanced by GDF-9 treatment, as reflected by the increase in cell number during culture, whereas GDF-9 had no apparent effect on human granulosa cell growth. These experiments suggest that the thecal cell may be a primary target for GDF-9. In support of such a role, the synthesis of GDF-9 by the oocyte early in folliculogenesis is essential for development of the thecal cell layer (8). The expression of GDF-9 by the oocyte has been shown to precede or occur concurrently with the establishment of the thecal cell layer in mice, domestic animals, and humans (7, 29, 30, 31). Moreover, in order for the oocyte to best control follicular estrogen biosynthesis, it would be advantageous to regulate the cells involved in the early steps of steroid production.

Granulosa and thecal cell steroidogenesis was inhibited by GDF-9, most likely at the transcriptional level, as evidenced by reduced expression of StAR, P450scc, and P450arom mRNAs. Given that StAR mediates the rate-limiting step in steroidogenesis, the transfer of cholesterol from the outer to inner mitochondrial membrane (32, 33), it is therefore a likely downstream target for a growth factor that inhibits steroidogenesis. Expression of StAR increased as expected in both granulosa and thecal cells after 8-Br-cAMP treatment. Our studies are the first to show that the inhibitory effects of GDF-9 on 8-Br-cAMP-stimulated steroidogenesis result in a reduction in StAR protein levels, and this decline was a result of decreased StAR mRNA expression. Previous studies have shown that cAMP stimulates transcription of the StAR gene (34, 35). The cAMP-dependent effects on human StAR gene expression require the orphan nuclear receptor, steroidogenic factor-1 (36, 37). Our transient transfection assays with the StAR promoter-luciferase reporter construct indicate that GDF-9 inhibits StAR promoter activity. This inhibitory effect was seen with the -1300 StAR promoter construct and not with the -885 or -235 StAR promoter constructs. Previous studies with the human StAR promoter indicated the presence of an inhibitory region residing between base pairs -1300 and -885 of the promoter (24, 38). Our results suggest that this region confers the ability of GDF-9 to inhibit StAR expression. However, the steroidogenic factor-1 (SF-1) response element located in this region mediates only a fraction of the cAMP-dependent effects of SF-1; the two additional SF-1 sites, located at bp -104 and -42 of the StAR promoter, account for more than 95% of the SF-1-cAMP dependence of this gene (39). Interestingly, GDF-9 was able to inhibit several other SF-1-responsive genes in our study (P450scc and P450arom). Because of SF-1’s known role in cAMP-dependent activity of these promoters, it is possible that GDF-9 modifies SF-1 responsiveness, either directly or indirectly turning the transcription factor into a repressor rather than a transcriptional activator. Further studies will be required to elucidate the elements involved in the inhibitory action of GDF-9 on StAR gene expression as well as the possible involvement of SF-1.

The action of exogenous GDF-9 on ovarian cells could be influenced by several factors (including the levels of GDF-9 receptor and/or downstream intracellular effectors; expression of GDF-9/BMP antagonists; and possibly, different levels of expression of endogenous GDF-9 in the case of granulosa cells). Because the identity of the GDF-9 receptor is unknown at this time, we were unable to evaluate this aspect of GDF-9 action as a determinant of cell sensitivity. Recently, Duffy and Stouffer (22) demonstrated that primate (rhesus monkey) granulosa cells express GDF-9. Using the same primers, we were able to detect an RT-PCR product in several of our proliferating human granulosa cell preparations as well as freshly isolated human granulosa cells. However, we were not able to find significant differences among the patients in GDF-9 expression when we evaluated GDF-9 mRNA levels by real-time RT-PCR, nor did we observe any effects of exogenous GDF-9 or 8-Br-cAMP on GDF-9 expression. Thus, although we have shown that human granulosa cells express modest levels of GDF-9 mRNA and that the protein is present (as detected by Western analysis), our findings suggest that the variability in the inhibition of cAMP-stimulated steroidogenesis by exogenous GDF-9 does not involve alterations in production of endogenous GDF-9. The detection of GDF-9 mRNA expression in human granulosa cells contrasts with findings of previous investigations in which early human follicular material was examined (30, 40). The use of more sensitive RT-PCR methods in the present study may have contributed to our identification of GDF-9 transcripts. Further studies will be needed to determine when granulosa cell GDF-9 expression begins, what regulates it, and the relative contributions of granulosa cells and the oocyte to the accumulation of GDF-9 in the follicular environment.

In conclusion, we have shown that GDF-9 inhibits cAMP-induced steroid production and expression of genes encoding steroidogenic proteins in human granulosa and thecal cells. Our findings implicate GDF-9 in the modulation of follicular steroidogenesis. Because GDF-9 mRNA and protein are detectable in granulosa-lutein cells after the LH surge, the concept of GDF-9 as a solely oocyte-derived luteinization inhibitor needs to be reevaluated.

Acknowledgments

We thank Dr. Aaron Hsueh for providing the recombinant GDF-9 used in these experiments.

Footnotes

This work was supported by NIH Grants HD-34449 (National Cooperative Program in Infertility Research) and HD-06274.

Abbreviations: BMP, Bone morphogenetic protein; CT, threshold cycle; DHEA, dehydroepiandrosterone; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GDF-9, growth differentiation factor-9; P450arom, P450 aromatase; P450scc, P450 side-chain cleavage; SF-1, steroidogenic factor-1; SFM, serum-free media; StAR, steroidogenic acute regulatory protein.

Received October 24, 2001.

Accepted February 25, 2002.

References

  1. el-Fouly MA, Cook B, Nekola M, Nalbandov AV 1970 Role of the ovum in follicular luteinization. Endocrinology 87:286–293[Medline]
  2. Nekola MV, Nalbandov AV 1971 Morphological changes of rat follicular cells as influenced by oocytes. Biol Reprod 4:154–160[Abstract]
  3. Eppig JJ, Wigglesworth K, Pendola F, Hirao Y 1997 Murine oocytes suppress expression of luteinizing hormone receptor messenger ribonucleic acid by granulosa cells. Biol Reprod 56:976–984[Abstract]
  4. Vanderhyden BC, Cohen JN, Morley P 1993 Mouse oocytes regulate granulosa cell steroidogenesis. Endocrinology 133:423–426[Abstract/Free Full Text]
  5. Yan C, Matzuk MM 2001 Transgenic models of ovarian failure. J Soc Gynecol Invest 8:S30–S33
  6. Matzuk MM 2000 Revelations of ovarian follicle biology from gene knockout mice. Mol Cell Endocrinol 163:61–66[CrossRef][Medline]
  7. McGrath SA, Esquela AF, Lee SJ 1995 Oocyte-specific expression of growth/differentiation factor-9. Mol Endocrinol 9:131–136[Abstract/Free Full Text]
  8. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM 1996 Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 383:531–535[CrossRef][Medline]
  9. Vitt UA, McGee EA, Hayashi M, Hsueh AJ 2000 In vivo treatment with GDF-9 stimulates primordial and primary follicle progression and theca cell marker CYP17 in ovaries of immature rats. Endocrinology 141:3814–3820[Abstract/Free Full Text]
  10. Hreinsson JG, Scott JE, Rasmussen C, Swahn ML, Hsueh AJW, Hovatta O 2002 Growth differentiation factor-9 promotes the growth, development, and survival of human ovarian follicles in organ culture. J Clin Endocrinol Metab 87:316–320[Abstract/Free Full Text]
  11. Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM 1999 Paracrine actions of growth differentiation factor-9 in the mammalian ovary. Mol Endocrinol 13:1035–1048[Abstract/Free Full Text]
  12. Elvin JA, Yan C, Matzuk MM 2000 Growth differentiation factor-9 stimulates progesterone synthesis in granulosa cells via a prostaglandin E2/EP2 receptor pathway. Proc Natl Acad Sci USA 97:10288–10293[Abstract/Free Full Text]
  13. Hayashi M, McGee EA, Min G, Klein C, Rose UM, van Duin M, Hsueh AJ 1999 Recombinant growth differentiation factor-9 (GDF-9) enhances growth and differentiation of cultured early ovarian follicles. Endocrinology 140:1236–1244[Abstract/Free Full Text]
  14. Solovyeva EV, Hayashi M, Margi K, Barkats C, Klein C, Amsterdam A, Hsueh AJ, Tsafriri A 2000 Growth differentiation factor-9 stimulates rat theca-interstitial cell androgen biosynthesis. Biol Reprod 63:1214–1218[Abstract/Free Full Text]
  15. Vitt UA, Hayashi M, Klein C, Hsueh AJ 2000 Growth differentiation factor-9 stimulates proliferation but suppresses the follicle-stimulating hormone-induced differentiation of cultured granulosa cells from small antral and preovulatory rat follicles. Biol Reprod 62:370–377[Abstract/Free Full Text]
  16. Elvin JA, Yan C, Matzuk MM 2000 Oocyte-expressed TGF-ß superfamily members in female fertility. Mol Cell Endocrinol 159:1–5[CrossRef][Medline]
  17. Otsuka F, Moore RK, Shimasaki S 2001 Biological function and cellular mechanism of bone morphogenetic protein-6 in the ovary. J Biol Chem 276:32889–32895[Abstract/Free Full Text]
  18. Otsuka F, Yamamoto S, Erickson GF, Shimasaki S 2001 Bone morphogenetic protein-15 inhibits follicle-stimulating hormone (FSH) action by suppressing FSH receptor expression. J Biol Chem 276:11387–11392[Abstract/Free Full Text]
  19. Dooley CA, Attia GR, Rainey WE, Moore DR, Carr BR 2000 Bone morphogenetic protein inhibits ovarian androgen production. J Clin Endocrinol Metab 85:3331–3337[Abstract/Free Full Text]
  20. Lee WS, Otsuka F, Moore RK, Shimasaki S 2001 Effect of bone morphogenetic protein-7 on folliculogenesis and ovulation in the rat. Biol Reprod 65:994–999[Abstract/Free Full Text]
  21. Shimasaki S, Zachow RJ, Li D, Kim H, Iemura S, Ueno N, Sampath K, Chang RJ, Erickson GF 1999 A functional bone morphogenetic protein system in the ovary. Proc Natl Acad Sci USA 96:7282–7287[Abstract/Free Full Text]
  22. Duffy DM, Stouffer RL 2001 Growth differentiation factor-9 (GDF-9) is expressed by the primate follicle throughout the periovulatory interval. Biol Reprod 64:296 (Abstract)
  23. McAllister JM, Byrd W, Simpson ER 1994 The effects of growth factors and phorbol esters on steroid biosynthesis in isolated human theca interna and granulosa-lutein cells in long term culture. J Clin Endocrinol Metab 79:106–112[Abstract]
  24. Christenson LK, Osborne TF, McAllister JM, Strauss 3rd JF 2001 Conditional response of the human steroidogenic acute regulatory protein gene promoter to sterol regulatory element binding protein-1a. Endocrinology 142:28–36[Abstract/Free Full Text]
  25. Sugawara T, Holt JA, Kiriakidou M, Strauss 3rd JF 1996 Steroidogenic factor 1-dependent promoter activity of the human steroidogenic acute regulatory protein (StAR) gene. Biochemistry 35:9052–9059[CrossRef][Medline]
  26. Arakane F, King SR, Du Y, Kallen CB, Walsh LP, Watari H, Stocco DM, Strauss 3rd JF 1997 Phosphorylation of steroidogenic acute regulatory protein (StAR) modulates its steroidogenic activity. J Biol Chem 272:32656–32662[Abstract/Free Full Text]
  27. Devoto L, Christenson LK, McAllister JM, Makrigiannakis A, Strauss 3rd JF 1999 Insulin and insulin-like growth factor-I and -II modulate human granulosa-lutein cell steroidogenesis: enhancement of steroidogenic acute regulatory protein (StAR) expression. Mol Hum Reprod 5:1003–1010[Abstract/Free Full Text]
  28. Josso N, di Clemente N 1999 TGF-ß family members and gonadal development. Trends Endocrinol Metab 10:216–222[CrossRef][Medline]
  29. Bodensteiner KJ, Clay CM, Moeller CL, Sawyer HR 1999 Molecular cloning of the ovine growth/differentiation factor-9 gene and expression of growth/differentiation factor-9 in ovine and bovine ovaries. Biol Reprod 60:381–386[Abstract/Free Full Text]
  30. Aaltonen J, Laitinen MP, Vuojolainen K, Jaatinen R, Horelli-Kuitunen N, Seppa L, Louhio H, Tuuri T, Sjoberg J, Butzow R, Hovata O, Dale L, Ritvos O 1999 Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF- 9B are expressed in oocytes during early folliculogenesis. J Clin Endocrinol Metab 84:2744–2750[Abstract/Free Full Text]
  31. Dube JL, Wang P, Elvin J, Lyons KM, Celeste AJ, Matzuk MM 1998 The bone morphogenetic protein 15 gene is X-linked and expressed in oocytes. Mol Endocrinol 12:1809–1817[Abstract/Free Full Text]
  32. Strauss 3rd JF, Kallen CB, Christenson LK, Watari H, Devoto L, Arakane F, Kiriakidou M, Sugawara T 1999 The steroidogenic acute regulatory protein (StAR): a window into the complexities of intracellular cholesterol trafficking. Recent Prog Horm Res 54:369–395
  33. Stocco DM 2001 StAR protein and the regulation of steroid hormone biosynthesis. Annu Rev Physiol 63:193–213[CrossRef][Medline]
  34. Christenson LK, Strauss 3rd JF 2000 Steroidogenic acute regulatory protein (StAR) and the intramitochondrial translocation of cholesterol. Biochim Biophys Acta 1529:175–187[Medline]
  35. Stocco DM, Clark BJ, Reinhart AJ, Williams SC, Dyson M, Dassi B, Walsh LP, Manna PR, Wang X, Zeleznik AJ, Orly J 2001 Elements involved in the regulation of the StAR gene. Mol Cell Endocrinol 177:55–59[CrossRef][Medline]
  36. Sugawara T, Kiriakidou M, McAllister JM, Holt JA, Arakane F, Strauss 3rd JF 1997 Regulation of expression of the steroidogenic acute regulatory protein (StAR) gene: a central role for steroidogenic factor 1. Steroids 62:5–9[CrossRef][Medline]
  37. Wooton-Kee CR, Clark BJ 2000 Steroidogenic factor-1 influences protein-deoxyribonucleic acid interactions within the cyclic adenosine 3,5-monophosphate-responsive regions of the murine steroidogenic acute regulatory protein gene. Endocrinology 141:1345–1355[Abstract/Free Full Text]
  38. Christenson LK, Johnson PF, McAllister JM, Strauss 3rd JF 1999 CCAAT/enhancer-binding proteins regulate expression of the human steroidogenic acute regulatory protein (StAR) gene. J Biol Chem 274:26591–26598[Abstract/Free Full Text]
  39. Sugawara T, Kiriakidou M, McAllister JM, Kallen CB, Strauss 3rd JF 1997 Multiple steroidogenic factor 1 binding elements in the human steroidogenic acute regulatory protein gene 5'-flanking region are required for maximal promoter activity and cyclic AMP responsiveness. Biochemistry 36:7249–7255[CrossRef][Medline]
  40. Fitzpatrick SL, Sindoni DM, Shughrue PJ, Lane MV, Merchenthaler IJ, Frail DE 1998 Expression of growth differentiation factor-9 messenger ribonucleic acid in ovarian and nonovarian rodent and human tissues. Endocrinology 139:2571–2578.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
R. B. Gilchrist, M. Lane, and J. G. Thompson
Oocyte-secreted factors: regulators of cumulus cell function and oocyte quality
Hum. Reprod. Update, March 1, 2008; 14(2): 159 - 177.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. J Spicer, P. Y Aad, D. T Allen, S. Mazerbourg, A. H Payne, and A. J Hsueh
Growth Differentiation Factor 9 (GDF9) Stimulates Proliferation and Inhibits Steroidogenesis by Bovine Theca Cells: Influence of Follicle Size on Responses to GDF9
Biol Reprod, February 1, 2008; 78(2): 243 - 253.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
L. Liu and W. Ge
Growth Differentiation Factor 9 and Its Spatiotemporal Expression and Regulation in the Zebrafish Ovary
Biol Reprod, February 1, 2007; 76(2): 294 - 302.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. R. Stewart, B. A. Dombroski, M. Urbanek, W. Ankener, K. G. Ewens, J. R. Wood, R. S. Legro, J. F. Strauss III, A. Dunaif, and R. S. Spielman
Fine Mapping of Genetic Susceptibility to Polycystic Ovary Syndrome on Chromosome 19p13.2 and Tests for Regulatory Activity
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4112 - 4117.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
P. G Knight and C. Glister
TGF-{beta} superfamily members and ovarian follicle development.
Reproduction, August 1, 2006; 132(2): 191 - 206.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
C. Yan, J. A. Elvin, Y.-N. Lin, L. A. Hadsell, J. Wang, F. J. DeMayo, and M. M. Matzuk
Regulation of Growth Differentiation Factor 9 Expression in Oocytes In Vivo: A Key Role of the E-Box
Biol Reprod, June 1, 2006; 74(6): 999 - 1006.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
L J Spicer, P Y Aad, D Allen, S Mazerbourg, and A J Hsueh
Growth differentiation factor-9 has divergent effects on proliferation and steroidogenesis of bovine granulosa cells.
J. Endocrinol., May 1, 2006; 189(2): 329 - 339.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
S. A. Pangas and M. M. Matzuk
The Art and Artifact of GDF9 Activity: Cumulus Expansion and the Cumulus Expansion-Enabling Factor
Biol Reprod, October 1, 2005; 73(4): 582 - 585.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T.E. Hickey, D.L. Marrocco, F. Amato, L.J. Ritter, R.J. Norman, R.B. Gilchrist, and D.T. Armstrong
Androgens Augment the Mitogenic Effects of Oocyte-Secreted Factors and Growth Differentiation Factor 9 on Porcine Granulosa Cells
Biol Reprod, October 1, 2005; 73(4): 825 - 832.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
P.A. Johnson, M.J. Dickens, T.R. Kent, and J.R. Giles
Expression and Function of Growth Differentiation Factor-9 in an Oviparous Species, Gallus domesticus
Biol Reprod, May 1, 2005; 72(5): 1095 - 1100.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
K. P McNatty, J. L Juengel, K. L Reader, S. Lun, S. Myllymaa, S. B Lawrence, A. Western, M. F Meerasahib, D. G Mottershead, N. P Groome, et al.
Bone morphogenetic protein 15 and growth differentiation factor 9 co-operate to regulate granulosa cell function
Reproduction, April 1, 2005; 129(4): 473 - 480.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
K. P McNatty, J. L Juengel, K. L Reader, S. Lun, S. Myllymaa, S. B Lawrence, A. Western, M. F Meerasahib, D. G Mottershead, N. P Groome, et al.
Bone morphogenetic protein 15 and growth differentiation factor 9 co-operate to regulate granulosa cell function in ruminants
Reproduction, April 1, 2005; 129(4): 481 - 487.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
J.L. Juengel and K.P. McNatty
The role of proteins of the transforming growth factor-{beta} superfamily in the intraovarian regulation of follicular development
Hum. Reprod. Update, March 1, 2005; 11(2): 144 - 161.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. A. R. Maciel, E. C. Baracat, J. A. Benda, S. M. Markham, K. Hensinger, R. J. Chang, and G. F. Erickson
Stockpiling of Transitional and Classic Primary Follicles in Ovaries of Women with Polycystic Ovary Syndrome
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5321 - 5327.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
R. Prochazka, L. Nemcova, E. Nagyova, and J. Kanka
Expression of Growth Differentiation Factor 9 Messenger RNA in Porcine Growing and Preovulatory Ovarian Follicles
Biol Reprod, October 1, 2004; 71(4): 1290 - 1295.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
S. Jonard and D. Dewailly
The follicular excess in polycystic ovaries, due to intra-ovarian hyperandrogenism, may be the main culprit for the follicular arrest
Hum. Reprod. Update, March 1, 2004; 10(2): 107 - 117.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. Shimasaki, R. K. Moore, F. Otsuka, and G. F. Erickson
The Bone Morphogenetic Protein System In Mammalian Reproduction
Endocr. Rev., February 1, 2004; 25(1): 72 - 101.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
D. M. Duffy
Growth Differentiation Factor-9 Is Expressed by the Primate Follicle Throughout the Periovulatory Interval
Biol Reprod, August 1, 2003; 69(2): 725 - 732.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Kaivo-Oja, J. Bondestam, M. Kamarainen, J. Koskimies, U. Vitt, M. Cranfield, K. Vuojolainen, J. P. Kallio, V. M. Olkkonen, M. Hayashi, et al.
Growth Differentiation Factor-9 Induces Smad2 Activation and Inhibin B Production in Cultured Human Granulosa-Luteal Cells
J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 755 - 762.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Jabara, L. K. Christenson, C. Y. Wang, J. M. McAllister, N. B. Javitt, A. Dunaif, and J. F. Strauss III
Stromal Cells of the Human Postmenopausal Ovary Display a Distinctive Biochemical and Molecular Phenotype
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 484 - 492.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow A correction has been published
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamamoto, N.
Right arrow Articles by Strauss, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamamoto, N.
Right arrow Articles by Strauss, J. F., III


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals