help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saunders, P. T. K.
Right arrow Articles by Scobie, G. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Saunders, P. T. K.
Right arrow Articles by Scobie, G. A.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 6 2706-2715
Copyright © 2002 by The Endocrine Society


The Impact of the Human Genome on Endocrinology: Original Articles

ERß1 and the ERß2 Splice Variant (ERßcx/ß2) Are Expressed in Distinct Cell Populations in the Adult Human Testis

Philippa T. K. Saunders, Michael R. Millar, Sheila Macpherson, D. Stewart Irvine, Nigel P. Groome, Lee R. Evans, Richard M. Sharpe and Graeme A. Scobie

Medical Research Council Human Reproductive Sciences Unit (P.T.K.S., M.R.M., S.M., D.S.I., R.M.S., G.A.S.), Centre for Reproductive Biology, Edinburgh EH3 9ET, United Kingdom; and School of Biological & Molecular Sciences (N.P.G., L.R.E.), Oxford Brookes University, Gypsy Lane Campus, Headington, Oxford OX3 0PB, United Kingdom

Address all correspondence and requests for reprints to: Dr. Philippa T. K. Saunders, Medical Research Council Human Reproductive Sciences Unit, Center for Reproductive Biology, 37 Chalmers Street, Edinburgh EH3 9ET, United Kingdom. E-mail: . p.saunders{at}ed.ac.uk

Abstract

Estrogens can regulate germ cell function. Estrogen action is mediated via high affinity ERs; two subtypes (ER{alpha} and ERß) have been identified. We have shown previously that ERß is expressed in nuclei of multiple human testicular cells. A variant isoform of human (h) ERß (hERßcx/2), formed by alternative splicing, has been identified in testicular cDNA libraries by two laboratories. The present study examined the expression of wild-type (ERß1) and variant (ERß2) ß receptors in human testes by 1) RT-PCR with isoform specific primers, and 2) single and double immunohistochemistry using monoclonal antibodies raised against peptides unique to the C termini of hERß1 and hERß2. PCR products specific for ERß1 and ERß2 were amplified from cDNA pools prepared from human testes and granulosa cells. On Western blots, the anti-ERß1 monoclonal antibody bound to recombinant ERß1 and the anti-ERß2 monoclonal to recombinant hERß2. Neither bound to the other ERß isoform nor to recombinant ER{alpha}. ERß1 and ERß2 proteins were both detected in human testis. Immunoexpression of ERß1 was most intense in pachytene spermatocytes and round spermatids, whereas low levels of expression were detected in Sertoli cells, spermatogonia, preleptotene, leptotene, zygotene, and diplotene spermatocytes. Highest levels of expression of ERß2 protein were detected in Sertoli cells and spermatogonia with low/variable expression in preleptotene, pachytene, and diplotene spermatocytes. No immunostaining was detected in elongating spermatids. Most interstitial cells expressed more ERß2 than ERß1. It is speculated that the cells most susceptible to modulation by estrogenic ligands are round spermatids in which levels of expression of ERß1 are high. In contrast, expression of ERß2, an isoform that may act as a dominant negative inhibitor of ER action, in Sertoli cells and spermatogonia, could protect these cells from adverse effects of estrogens.

IT HAS BEEN proposed that estrogens may play a role in regulating spermatogenesis (see review by Ref. 1). For example, Ebling et al. (2) found estrogen treatment of hpg mice stimulated spermatogenesis and Pentikainen et al. (3) reported that estrogen exposure reduced levels of germ cell apoptosis in isolated human seminiferous tubules consistent with estrogen acting as a germ cell survival factor. The biosynthesis of estrogens from androgens is catalyzed by the aromatase complex. Levels of estrogen within the male reproductive tract are higher than in the general circulation consistent with production of estrogens (reviewed in Ref. 4). In the adult testis, the major site of aromatase expression appears to be the Leydig cells (5, 6); however, aromatase activity has also been detected within mature germ cells and spermatozoa (6, 7, 8). Male mice in which estrogen biosynthesis is impaired due to targeted disruption of the aromatase gene (ARKO) become infertile (9). Analyses of the testes of these animals has shown that round spermatids undergo apoptosis, show disturbances in acrosome formation, and fail to differentiate into mature elongate spermatids (9, 10). Consistent with estrogens acting as a germ cell survival factor treatment of monkeys with an aromatase inhibitor also results in a reduction in the progression of round to elongate spermatids (11).

Estrogen action is mediated via high affinity receptors that are shifted to a transcriptionally active state after ligand binding. Two forms of ER commonly known as {alpha} (ER{alpha}, NR3A1) and ß (ERß, NR3A2) have been cloned from human (h) (12, 13, 14) and other species (15, 16). Both receptors are encoded by eight exons and are the products of two genes located on different chromosomes (17). Phylogenetic analysis suggests that they arose from a single duplication event at least 450 million years ago (18). Like other members of the steroid receptor superfamily, ER{alpha} and ERß share a common arrangement of five structure-function domains, denoted A to F (19). Key domains include the DNA binding domain (C), two transactivation domains [activation function (AF)-1 and AF-2, located in the N (A/B domain) and C-terminal (E/F domain) portions of the protein, and regions within the C and E domains involved in receptor dimerization (see reviews in Refs. 20 and 21). Studies in vitro have demonstrated that homodimers (ER{alpha}-ER{alpha} or ERß-ERß), or heterodimers (ER{alpha}-ERß), can be formed when both isoforms are expressed in the same cell (22, 23). In 1998, a novel human ERß variant, named hERßcx, was identified by screening a human testis cDNA library (Ref. 24 ; GenBank accession no. AB006589). The open reading frame of the protein was predicted to be identical to that of full-length hERß (59 kDa, Ref. 14 , GenBank accession AB006590) except for a truncation at the C-terminus leading to the loss of 61 amino acids. The C-terminus of hERßcx was found to encode a unique 26 amino acid peptide, resulting in a protein containing 495 amino acids (~55 kDa). In a separate series of experiments, Moore et al. (25) identified mRNAs encoding both this isoform of hERß, which they called hERß2 (GenBank accession no. AF051428), as well as three further isoforms, which they named ERß3, ERß4, and ERß5 in human tissues including testis. They showed that the ERß2 variant could bind DNA both as a homodimer and as a heterodimer with hERß1 using gel shift assays. For the rest of this paper, the hERß protein identified initially as the homolog to rat ERß (13, 14, 17) will be referred to as ERß1 and the ERßcx/ERß2 variant as ERß2 to distinguish them from each other. Note that the human ERß2 cloned by Lu et al. (GenBank accession no. AF124790) is not the same variant as the ERßcx/ß2 described above, but a form of ERß that lacks exon 5; this variant encodes a truncated ERß protein lacking the entire ligand binding domain (26). A splice variant isoform of ERß has also been identified in rodents and is sometimes referred to as ERß2, or more recently as ERßins (27, 28, 29). This variant is not identical to hERß2 but contains a 54-bp insertion within the ligand binding domain (domain E) leading to the addition of 18 amino acids, this isoform has not been detected in human cDNAs prepared from normal human ovary, endometrium, mammary gland (30, 31) or testis (our unpublished observations).

We have shown previously using both immunohistochemistry and Western blotting that ERß protein is widely expressed in the testis and reproductive system of the human, primate, and rodent (32, 33, 34). However, the antibody used for those studies was raised against a peptide (P4) (35) in the D domain of hERß that is identical in both hERß1 and hERß2. We have recently confirmed that this antibody is capable of recognizing both these isoforms of ERß on Western blots (Scobie, G. S., and P. T. K. Saunders, unpublished observations). As ERß2 was originally isolated from human testis cDNA libraries, and has been proposed to act as a negative regulator of ER activity (24), we have extended our investigations using monoclonal antibodies specific for ERß1 and ERß2. We show for the first time that both ERß1 and ERß2 proteins are expressed in multiple cell types within the human testis but that their patterns of expression are distinct.

Materials and Methods

Tissue samples

Testicular tissues were obtained from men (n = 10) undergoing surgical investigations for nonobstructive azoospermia or surgical correction of vasectomy. The Lothian Reproductive Medicine Ethics committee approved the protocols, and men gave informed consent. Additional human tissues (n = 6) were obtained from the Peterborough Hospitals NHS Trust tissue bank. Samples for immunohistochemistry were fixed in Bouins for 6–7 h and processed into paraffin wax using standard methods (36). A sample of RNA extracted from human granulosa cells was a gift from Dr. Chris Harlow (Edinburgh University) human endometrial tissue was a gift from Prof. Hilary Critchley (Edinburgh University). Tissues for RNA extraction were snap frozen on dry ice or in liquid nitrogen and stored at -70 C before use.

Analysis of ERß mRNAs by RT-PCR

Frozen tissue samples (testicular biopsy and endometrium) were ground up under liquid nitrogen using a pestle and mortar, divided into approximately 50 mg samples, and stored at -70 C. RNA was extracted using Tri Reagent (Sigma, Poole, Dorset, UK) according to manufacturer’s instructions, dissolved in ribonuclease-free water and 5 µg total RNA subjected to reverse transcriptase using Expand Reverse Transcriptase (Roche Lewes, Sussex, UK) and an oligo deoxythymidine primer according to the instructions supplied with the enzyme. First-strand cDNA was purified by heating to 100 C for 5 min, ribonuclease treatment at 37 C for 15 min, and finally by passing through a "High Pure PCR Purification" column (Roche). Purified cDNAs were quantified on Amersham Pharmacia Biotech Genequant (St. Albans, Hertfordshire, UK) and adjusted to a final concentration of 5 ng/µl in Tris/EDTA buffer (10 mM Tris/HCl, pH 7.5; 1 mM EDTA).

PCRs were performed using AGS Gold Taq (Hybaid, Ashford, Middlesex, UK) with the following primers: ERß common 5' primer (exon 7) 5'-GGCATCTCCTCCCAGCAGCA was used in combination with either a specific ERß1 3' primer 5' CACTGAGACTGTGGGTTCTGGGA (amplified product 261 bp) or a specific ERß2 3' primer 5'-CACTGCTCCATCGTTGCTTC (amplified product 156 bp). ER{alpha} cDNA was amplified with primers identical to ER{alpha} specific set 1 (exon 1–3) published previously by Lau et al. (37) (amplified product 650 bp). Internal GAPDH primers were 5'- GAACGGGAAGCTCACTGGCAT and 5'-GTCCACCACCCTGTTGCTGTAG (amplified product 301 bp). PCR conditions were as follows: 1 cycle of 94 C for 2 min followed by 30 cycles of 94 C for 30 sec, 58 C for 30 sec and 72 C for 30 sec, with a final cycle of 72 C for 10 min, in a 0.2-ml Hybaid Sprint thermal cycler. PCR products were separated on 2% agarose gels stained with ethidium bromide and then photographed.

Antibodies

Peptide P7 (CSPAEDSKSKEGSQNPQSQ) specific for hERß1 (wild-type, Refs. 14 and 17 , GenBank accession no. AB006590) and peptide P8 (CMKMETLLPEATMEQ) specific for hERß2 (Refs. 24 and 25 ; GenBank accession no. AB006589) were synthesized in the Center for Proteins and Peptides, Oxford Brookes University and conjugated to tuberculin. Conjugated peptides were used to immunize individual mice and monoclonal antibodies prepared according to standard methods (38). Positive clones directed against ERß1 and ERß2 were identified by ELISA using recombinant human ERß1 (P2466, PanVera, Madison, WI) or unconjugated peptide P8, respectively. Individual immunoglobulins (anti-ERß1 type IgG2a; anti ERß2 type IgG1) were purified from culture media that had been dialyzed against 10 mM phosphate buffer (pH 7.2) using Hi-trap protein G Sepharose columns according to the manufacturer’s instructions (Amersham Pharmacia Biotech). The isolated IgGs were desalted on P10 columns (Amersham Pharmacia Biotech) that had been preequilibrated in PBS (pH 7.4) then mixed with 20% vol/vol glycerol and 0.02% wt/vol sodium azide (Sigma) and stored as 100 µl aliquots at -20 C. The ability of the antibody directed against peptide P7 to detect expression of ERß in ovarian sections from human and marmoset monkey has been reported previously (35).

Preparation of recombinant ERß2

A full-length cDNA encoding hERß2 was amplified from human testis cDNA prepared as described for RT-PCR analysis, using extensor Hi-Fidelity PCR master Mix (ABgene, Epsom Surrey, UK) and 0.6 µM of each primer (5' ATG primer: 5'-GACATGGATATAAAAAACTCACC and 3' primer 5'-CACTGCTCCATCGTTGCTTC). PCR cycle conditions were: 1 cycle of 94 C for 2 min followed by 30 cycles of 94 C for 30 sec, 58 C for 30 sec and 72 C for 90 sec, with a final cycle of 72 C for 10 min. The resulting cDNA was cloned in frame into the pUni donor vector (pUni/V5-His-TOPO Echo Cloning System) according to the manufacturer’s instructions (Invitrogen, Breda, The Netherlands). The full-length pUNI/ß2 cDNA construct was recombined into the pRSET-E acceptor Echo bacterial expression vector (Invitrogen) by incubation of the donor/acceptor plasmids in the presence of CRE-recombinase according to the protocol supplied by Invitrogen, transformed into TOP10 cells, and selected on kanamycin agar plates. Recombinant hERß2 protein was made by transforming the pRSETB2 plasmid into BL21(DE3)plysS (Invitrogen) and growing the transformed bacteria in LB-medium containing 1 mM IPTG for 2–3 h. Bacterial cells were separated by centrifugation and the resulting pellets were boiled in 1x lysis buffer (contains 50 mM Tris/HCl, pH 6.8; 100 mM dithiothreitol; 2% SDS; 10% glycerol; and 0.1% bromophenol blue).

Western analysis

Recombinant human ERß1 corresponding to short (~53 kDa) and long (~59 kDa) forms of the wild-type form of the receptor (ERß1; 13, 14) as well as full-length ER{alpha} were obtained from PanVera (Madison WI). Recombinant ERß2 was prepared as above. Recombinant proteins (0.1 µg/lane ERß1L, ERßS, and ER{alpha} or 10 µl lystate ERß2) and prestained protein molecular weight markers (Bio-Rad Laboratories, Inc., Hercules, CA) were separated on denaturing minigels containing an acrylamide gradient from 4 to 20% (wt/vol) polyacrylamide (Invitrogen) using Tris/glycine/SDS running buffer (25 mM Tris; 250 mM glycine, pH 8.3; 0.1% SDS). Proteins were transferred to immobilon membrane using a Tris/glycine buffer (12 mM Tris; 96 mM glycine, pH 8.3). Membranes were incubated overnight with the mouse monoclonal antibodies at 1 in 500 diluted in Tris-buffered saline (TBS)-Tween buffer (10 mM Tris; 150 mM NaCl; 0.05% Tween-20) containing 5% dried milk. Bound antibodies were detected using a horseradish peroxidase (HRP)-conjugated rabbit antimouse IgG and the electrochemiluminescence visualization system (Amersham Pharmacia Biotech) according to the manufacturer’s instructions.

Immunohistochemistry

Immunolocalization of ERß1 and ERß2 used 5 µm paraffin tissue sections which were subjected to heat induced antigen retrieval (39) in a pressure cooker (Tefal, Nottingham, UK) containing 2 liters of near boiling 0.01 M glycine/EDTA, pH 3.5. Thereafter, the sections were washed and endogenous peroxidase blocked as described previously (33). Mouse anti-ERß1 (monoclonal 9) and anti-ERß2 (monoclonal 57/3) were each diluted 1 in 50 in normal rabbit serum (NRS, Diagnostics Scotland, Edinburgh, UK) diluted 1:4 in TBS (0.05 M Tris, pH 7.4; 0.85% saline) containing 5% BSA (NRS/TBS/BSA). Antibodies were incubated on sections overnight at 4 C. Sections were washed twice for 5 min each time in TBS and incubated with biotinylated rabbit-antimouse IgG (DAKO Corp., Cambridge, UK) diluted 1:500 in NRS/TBS/BSA. Incubations lasted for 1 h and were followed by two washes in TBS (5 min each). Thereafter, sections were incubated in avidin-biotin complex-HRP (DAKO Corp.) for 1 h, washed in TBS (2 x 5 min) and bound antibodies visualized by incubation with liquid 3,3'-diaminobenzidine tetra-hydrochloride (catalog no. K3468, DAKO Corp.). Sections were counterstained lightly with hematoxylin to enable identification of cell nuclei containing low levels of immunopositive staining. Staining of sections was repeated at least twice; sections were then examined independently by two individuals and the identity of immunopositive cells and the intensity of immunostaining noted on a stage diagram of human spermatogenesis (see Ref. 40). Images were captured using an Olympus Corp. Provis microscope (Olympus Corp. Optical Co., London, UK) equipped with a Kodak DCS330 camera (Eastman Kodak Co., Rochester, NY), stored on a Macintosh PowerPC computer and assembled using Photoshop 5.5 (Adobe, Mountain View, CA).

Double fluorescent immunohistochemistry

Sections were washed, subjected to antigen retrieval, and blocked as described above. Washes detailed below were for 5 min each, and incubations were at room temperature unless otherwise specified. Mouse anti-ERß1 specific was diluted 1 in 20 in NRS/TBS/BSA (see above) and incubated on sections overnight at 4 C. Sections were washed, incubated with biotinylated rabbit antimouse IgG (DAKO Corp.) diluted 1 in 500 in NRS/TBS/BSA for 30 min then washed in TBS followed by PBS. The fluorochrome streptavidin 546 Alexafluor (Molecular Probes, Inc., Eugene, OR) diluted 1 in 200 in PBS was incubated on slides for 2 h. Sections were washed in PBS then TBS, incubated with biotin (4 drops/1 ml TBS) for 10 min, re-washed twice in TBS, and incubated with normal mouse IgG diluted 1 in 1000 in NRS/TBS/BSA for 30 min. Sections were reblocked with NRS/TBS/BSA for 30 min then incubated with mouse anti-ERß2 diluted 1 in 50 in NRS/TBS/BSA overnight at 4 C. Sections were washed twice in TBS, incubated with HRP conjugated rabbit-antimouse IgG1 subtype specific antiserum (Zymed Laboratories, Inc., South San Francisco, CA) diluted 1 in 100 in NRS/TBS/BSA for 1 h. Sections were washed in TBS containing 0.1% Tween followed by TBS and incubation with Tyr-Cy5 (from kit NEL745, NEN Life Science Products) for 10 min, which produced and enhanced the second fluorescent signal. Sections were washed and mounted in Permafluor (Immunotech-Coulter, High Wycomb, Buckinghamshire, UK). Fluorescent images were captured on a Carl Zeiss (Jena, Germany) laser scanning microscope LSM 510. The alexafluor 546 was detected using the helium/neon 1 laser (excitation beam, 543 nm) and an emission band pass filter 560–615 nm. The Cy 5 was detected with the helium/neon 2 laser (excitation beam 633 nm) and emission long band pass filter 650.

Results

Detection of both ERß1 and ERß2 in testicular samples

cDNAs specific for both ERß1 and ERß2 isoforms were amplified from cDNA prepared by RT of total RNA from human testis obtained from BD Biosciences Clontech (Palo Alto, CA) (Fig. 1Go, lanes 1 and 2) or prepared from a human testicular biopsy (Fig. 1Go, lane 9), human granulosa cells (Fig. 1Go, lane 5) or human endometrium (Fig. 1Go, lane 8). Both isoforms were identified in a cDNA library obtained from Stratagene (La Jolla, CA) (lane 4) and a pool of marathon-ready cDNAs prepared from human testes by BD Biosciences Clontech (lane 3). In all samples, the amount of the ERß1 cDNA amplified appeared to be slightly higher than that of ERß2; this difference was most marked in the Stratagene cDNA library and in granulosa cells but was not quantified. When the same panel of samples was tested using ER{alpha}-specific primers (Fig. 1CGo), the highest levels of ER{alpha} cDNA was amplified from human endometrial tissue (lane 8, positive control; Ref. 41) and low levels of expression detected in pooled human granulosa cells (lane 6; Ref. 35). Amounts of ER{alpha} cDNA amplified from testicular samples after 30 cycles of PCR were highly variable with no detectable signal in a testicular biopsy (lane 9), low levels in cDNAs prepared from testis RNA obtained from BD Biosciences Clontech (lanes 1 and 2), moderate amounts in a cDNA library from Stratagene (lane 4) and significant signal in a sample of marathon-ready cDNA (BD Biosciences Clontech) (lane 3).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 1. ERß1 and ERß2 mRNAs are expressed in adult human testis. PCR amplification with primers specific for the ERß1 (panel A, 261bp) and ß2 (panel B, 156 bp) revealed that both were detected in cDNA pools prepared from human testis RNA (lanes 1 and 2), in marathon-ready cDNA from human testis (BD Biosciences Clontech, lane 3), a cDNA library (Stratagene, lane 4) and a testicular biopsy obtained in house (lane 9). Control tissues (human granulosa cell and endometrial cDNAs) contained both ERß1 and ERß2 (lanes 5 and 8). Negative controls prepared without reverse transcriptase (lane 6) or lacking input cDNA (lane 7) were included. ER{alpha} cDNA (panel C) was amplified from human endometrium (lane 8, positive control). The amounts of ER{alpha} detected in testicular samples was highly variable and ranged from negative (biopsy, lane 9), or low (BD Biosciences Clontech RNA, lanes 1 and 2) to moderate (cDNA library, lane 4; marathon-ready cDNA, lane 3). GAPDH was amplified from all samples containing cDNA (panel D, but not from the negative controls, lanes 6 and 7). One hundred-base pair markers were run on all gels.

 
Specificity of ERß monoclonal antibodies

On Western blots, the monoclonal antibodies directed against peptides at the C termini of ERß1 or ERß2 recognized the appropriate full-length recombinant proteins (Fig. 2Go, A and B) but did not cross-react either with the alternative isoform nor with recombinant ER{alpha} (lane {alpha}). Absorption with the immunizing peptide abolished the positive reaction (not shown).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. Specificity of monoclonal antibdodies. Monoclonal antibodies directed against peptides at the C-terminus of ERß1 and ERß2 were incubated with recombinant ERß1 [long(L) and short (s)]; ERß2 or ER{alpha}. No cross reactivity with ER{alpha} ({alpha}) was observed but anti-ERß1 (A) and anti-ERß2 (B) reacted specifically with the appropriate recombinant protein(s) to which they were directed.

 
Immunoexpression of ERß1 and ERß2 in adult human testis

Although proteins recognized by the monoclonal antibodies specific for ERß1 and ERß2 were expressed in multiple cell nuclei within the human seminiferous epithelium, their pattern of expression was strikingly different (Fig. 3Go, a and b). The most intense immunostaining for ERß1 was detected in round spermatids (R, Fig. 3Go, c and e, g), but this was lost as they started to undergo nuclear condensation (Fig. 3eGo, s4). Round spermatids were immunonegative or very slightly immunopositive for ERß2 (Fig. 3dGo, R). ERß1 and ERß2 proteins were not detected in elongate spermatids (E). Pachytene spermatocytes (P) contained intense immunopositive staining for ERß1 (Fig. 3eGo) but stained only slightly when incubated with ERß2 monoclonal (see Fig. 3Go, b and f, labeled P), whereas diplotene pachytene spermatocytes contained low levels of both proteins (Fig. 3Go, labeled D). All A type spermatogonia contained ERß1 and ERß2; immunoexpression of ERß2 was generally more intense and was particularly striking in B type spermatogonia (Fig. 3fGo, arrows). A clear differential was seen between the levels of expression of the isoforms within Sertoli cell nuclei (arrowheads); ERß1 was low/barely detectable (Fig. 3Go, c and e, g) but staining for ERß2 was intense (Fig. 3Go, d and f, h). Low and variable levels of expression of both isoforms were detected in peritubular myoid and Leydig cells.



View larger version (114K):
[in this window]
[in a new window]
 
Figure 3. Expression of ERß1 and ß2 in human testis is not identical. Immunoexpression of ERß1 (a, c, e, g) and ERß2 (b, d, f, h) was compared using fixed sections of human testes. Expression of ERß1 proteins in the human testis was most marked in the nuclei of germ cells including pachytene spermatocytes (P) and round spermatids (R), see panels c and e. A low level of immunopostive staining was present in Sertoli cells (c, e, g, arrowheads) and most spermatogonia (s). As spermatids started to elongate (s4 in e) expression of ERß1 was lost. The most intense immunostaining for ERß2 was detected in Sertoli cells (d, f, h, arrowheads) and in B type spermatogonia (f, arrows); A type spermatogonia were also clearly immunopostive (see s in h). Preleptotenes (pl) and cells undergoing meiosis (m) were immunohpnegative (f, h), but faint immunopositive staining was noted in the nuclei of pachytene spermatocytes (f, labeled P). Elongate spermatids (E) were immunonegative for both ERß1 and ERß2. Scale bars in a and c, 50 µm; scale bars in e and f, 20 µm; inset panel d negative control stained with normal mouse IgG.

 
Fluorescent immunohistochemistry

Colocalization of ERß1 and ERß2 on the same sections of human testes proved technically challenging because both antibodies were raised in mouse and the fluorescent detection systems were less sensitive than those using color endpoints. Results obtained (Fig. 4Go) confirmed and extended results of single immunohistochemistry. For example, Sertoli cell nuclei (arrowheads) were clearly stained blue (ERß2 positive), in contrast round spermatids (R) were red (ERß1 positive). Other cell types including pachytene spermatocytes (P, red with a few flecks of blue), spermatogonia (arrows, blue with a few flecks of red) and peritubular myoid cells (ptm, blue or * red/blue) expressed both receptors in variable proportions.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 4. Double immunostaining of ERß1 and ERß2. ERß1 positive staining appears red (Alexafluor) and ERß2 positive staining appears blue (Tyr-Cy5) when viewed on confocal microscope. Sertoli cell nuclei (arrowheads) were clearly stained blue, in contrast round spermatids (R) were red. Other cell types including pachytene spermatocytes (P, red with a few flecks of blue), spermatogonia (arrows, blue with a few flecks of red) and peritubular cells (ptm, blue only or * red/blue) expressed both receptors.

 
Summary of patterns of expression of ERß1 and ERß2

To provide a summary of the patterns of expression of the ER subtypes, the intensity of immunostaining observed (each antibody was used separately) on parallel sections of testes was scored on a scale of + to ++++. The results from multiple samples, all of which were stained two or more times were compared. A summary of the findings is presented in Fig. 5Go; the amount of shading correlates with the intensity of staining observed. For example, Sertoli cells (+++) and B type spermatogonia (++++) are strongly immunopositive for ERß2, whereas the highest levels of expression of ERß1 are observed in round spermatids (++++).



View larger version (45K):
[in this window]
[in a new window]
 
Figure 5. Summary diagrams of the pattern of expression of ERß1 and ERß2 in human testes determined by specific immunohistochemistry. The diagram was redrawn from that published by Clermont (40 ). The intensity of shading reflects the intensity of the immunpositive reaction within the nuclei of the different cell types (negative to ++++).

 
Discussion

In the present paper, we have investigated the pattern of expression of two isoforms of ERß (wild-type ERß1 and variant ERß2) in the human testis. These studies form part of continuing investigations into the impact of endogenous and exogenous estrogens on male reproductive health (see Refs. 42 and 43) for reviews.

Using RT-PCR with specific primers, both ERß1 and ERß2 cDNAs were detected in samples extracted from human testes, granulosa cells, endometrium (this paper), placenta, and human cell lines (44). These results are in agreement with previous studies that have detected expression of ERß1 and ERß2 mRNAs in human testis extracts using PCR-based approaches (25, 45). Specifically, Moore et al. (25) published results showing that the although the amounts of ERß1 and ERß2 cDNAs detected in a wide range of human tissues and cell lines varied considerably between samples, the amount of both appeared especially high in ovary and testis. Ogawa and co-workers (24) detected both an ERß1 mRNA of approximately 7.5 kb and an ERß2 mRNA of approximately 7 kb in testicular and ovarian samples on Northern blots purchased from BD Biosciences Clontech. Chu et al. (30) have used RT-PCR and Southern blotting to detect ERß2/cx in normal human ovarian tissue extracts as well as those from a range of different ovarian tumors.

The same panel of samples were also analyzed using ER{alpha}-specific primers and the amount of cDNA amplified found to be variable with no detectable signal in RNA from a testicular biopsy and low levels in cDNAs prepared from pooled testicular RNA purchased from BD Biosciences Clontech. We and others have failed to detect ER{alpha} protein within the adult human testis using immunohistochemistry or Western blotting (33, 45), although the protein can easily be detected in Leydig cells of rodent testes examined using identical approaches (46). High levels of expression of ER{alpha} protein have been detected in the efferent ductules and initial segment of the epididymis that lie adjacent to the testis (33, 46). Our inability to detect ER{alpha} mRNA in testicular biopsy material removed from the organ in such a way as to avoid contamination with efferent ductule tissue leads us to the conclusion that the presence of ER{alpha} cDNAs in some cDNAs samples obtained from commercial sources may reflect contamination with nontesticular tissue.

Previous studies that have reported expression of ERß protein in adult human testes have used antibodies that either cross-react with both isoforms (33, 45, 47, 48) or should only bind to ERß1 (3). In the present study, we found that the patterns of expression of ERß1 and ERß2 were distinct but overlapping. For example, although both receptors were detected in Sertoli cells and spermatogonia, immunoexpression of ERß2 appeared to be more intense than that of ERß1 in both of these cell types, although these results need to be treated with some caution as direct comparison of staining intensities can reflect differences in antibody affinity as well as antigen concentration. The opposite was true of the pachytene spermatocytes in which immunoexpression of ERß1 was intense and expression of ERß2 was low. Round spermatids expressed the highest levels of ERß1 protein, and we rarely detected any evidence of expression of ERß2 in these cells. Once the round spermatids started to condense (from stage IV onwards), expression of ERß1 was lost. Using antibodies raised to peptides within the A/B and D domains of ERß (Ref. 33 ; and unpublished observations), we have detected immunopositive staining in multiple testicular cell types. Careful examination of the intensity of staining in the different cells suggests that in our previous experiments (33) the pattern of staining observed is consistent with simultaneous detection of ERß1 and ERß2 by the antibodies employed. Similar patterns of staining have been reported from most (45, 47), but not all (48), of the studies that have used antibodies likely to cross-react with both isoforms of ERß. Pentikainen et al. (3) detected expression of ERß in zygotene and pachytene spermatocytes and in stage V spermatids in squash preparations from human testes using a polyclonal antibody raised against the C-terminal peptide of ERß1; immunoexpression of ER{alpha} was detected in the same cells. These results are clearly at odds with our own findings using an ERß1-specific monoclonal that we have shown does not cross-react with ERß2 or ER{alpha} recombinant proteins. The differences in staining seen in the two studies may relate to the method of preparation of samples (squash vs. fixed sections) or to the specificity of the primary antibody used by Pentikainen et al. (3). During the present study, we were unable to obtain sufficient fresh testicular biopsies to allow us to undertake Western blotting experiments. We have previously reported that proteins with molecular masses in the range 53–57 kDa were detectable in extracts from two human testicular biopsies using a polyclonal antibody that will cross-react with both ERß1 and ERß2 (33). It is therefore possible that the smaller protein could either be the short form of ERß1 (53 kDa) or ERß2 (55 kDa), which we have successfully identified in nuclear extracts from human endometrial tissue on Western blots using the specific ERß2 monoclonal antibody (Scobie, G., unpublished observations).

In considering how expression of ERß2 might influence estrogen activation of gene expression in the human testis, it is useful to review the information available on the functional role of the region of ERß1 that is not present in hERß2 due to the presence of an ERß2 specific exon 8 (24). Briefly, in hERß1 the wild-type exon 8 encodes part of domain E and all of domain F (amino acids 468 to 530, Ref. 14). Critical amino acids within this region include several involved in ligand binding that are conserved with ER{alpha}, for example, ERß G472 ({alpha} G521), ERß H475 ({alpha} 524) and ERß L476 ({alpha} 525) (49, 50, 51). The AF-2 domain that includes the twelfth helix of the protein, is also encoded by exon 8 (hERß1 amino acids 476–500). Furthermore, the conformation adopted by helix 12 following ligand binding is critical in determining recruitment of cofactors to the ligand-receptor complex (see review by Ref. 52). Consistent with the loss of these amino acids, Ogawa et al. (24) reported that when they transfected an ERß2 construct into COS cells they were unable to detect binding of E2 to whole cell extracts and that ERß2 was unable to induce expression of an ERE-CAT reporter construct in the presence or absence of E2. All but one of the amino acids identified as key to the dimerization of ERs (50, 53) are not encoded by exon 8 and are therefore identical in both ERß1 and ERß2. Consistent with the presence of both the DNA binding and dimerization domains, Moore et al. (25) used gel shift assays to demonstrate that ERß2 bound to DNA containing a consensus ERE both as a homo- and as a heterodimer with either ER{alpha} or ERß1. Ogawa et al. (24) found that ERß2 was incapable of interacting with TIF1a, a coregulator that has been shown to interact with ligand-activated hER{alpha} via the AF-2 domain. Studies on murine ERß have shown that the absence of an intact AF-2 domain in one partner within the steroid receptor dimer is sufficient to impair transcriptional activity in the full-length heterodimeric partner (54). When ERß2 was cotransfected with ER{alpha} (ratios 1:100 to 1:1), it acted as a dominant negative inhibitor of ER{alpha}-induced transactivation (24), although, surprisingly, in similar assays cotransfection of ERß2 with ERß1 did not appear to have any affect on reporter gene activation in the presence of E2. Alternative splicing of exons at the 3' ends of other steroid hormone receptor superfamily members such as the glucocorticoid receptor (55) has been reported previously. Loss of the 50 amino acids from the C terminus of hGR{alpha} and their replacement with a novel 15 amino acid results in formation of an hGRß isoform that, like ERß2, does not bind steroid (56). hGRß has been shown to heterodimerize with hGR{alpha} and to act as a dominant negative regulator of hGR{alpha} activity (57). Taken together with the limited data on ERß2 from transfection studies (24), these findings suggest that expression of ERß2 in cells containing ERß1 might impair gene activation by the wild-type receptor following ligand binding.

In the course of the present study, when we used primers specific for the 5' and 3' ends of ERß1 and ERß2 to amplify full-length cDNAs, as well as products of the expected size, we usually amplified shorter cDNA products. Sequencing of several of these confirmed that they lacked sequences corresponding to exon 5 but included those within exon 6 (our unpublished observations). ER{alpha} and ERß isoforms that contain exon 5 deletions have been identified previously in breast cancer cell lines and tumors (58, 59, 60). Inoue et al. (26) have identified ERß1 transcripts lacking exon 5 (ERß1{Delta}5) in human testis cDNA, and we have shown that ERß2{Delta}5 transcripts are also formed. The loss of exon 5 results in introduction of a premature stop codon in exon 6; the protein formed from the ERß1{Delta}5 and ERß2{Delta}5 cDNAs should be identical. The ERß1{Delta}5 and ERß2{Delta}5 proteins would not be detected by either of the antibodies used in the current study, as their sequence does not include the peptides used for immunization. Hall and McDonnell (61) have demonstrated that, unlike ER{alpha}, the A/B region of ERß does not contain a strong AF-1 domain, but instead they suggest this region might act as a repressor. The presence of intact AF-1 and DNA binding domains in both ERß2, and in the exon 5 deleted variants, would be consistent with the in vitro data showing they can act as dominant negative receptors when cotransfected with wild-type ER{alpha} and/or ERß (24, 26). We plan further studies to investigate whether ERß2 can also inhibit transactivation by ERß1 at AP-1 sites.

Based on the results from several studies including those in ßERKO mice (62), it has been proposed that one of the physiological roles of ERß is to act as a negative regulatory partner for ER{alpha} (29, 61, 62). It has been reported that the rodent ERß variant (ERßins), which has lower affinity for E2 than wtERß, also acts as a dominant negative receptor when heterodimerized with wild-type ERß (28, 63). Expression of ERßins in the rat mammary gland is up-regulated during lactation, and double immunohistochemistry has found the variant colocalized with ER{alpha} in up to 80% of the epithelial cells. Saji and colleagues (29) have proposed that expression of ERßins quenches ER{alpha} in these cells making them insensitive to estrogens. Expression of ERßins in the rodent testis has not been investigated to date, but we speculate that expression of ERß2 in the human testis may play a similar role to that of ERßins in the rodent mammary gland and serve to protect cells from estrogen action. If this is the case, then in adult human testes both Sertoli cells and spermatogonia may be insensitive to estrogens as they express an excess of ERß2 compared with ERß1.

In conclusion, we have demonstrated that ERß1, the functional wild-type receptor, and ERß2, a splice variant receptor that lacks the ability to bind E2 or to recruit cofactors via the AF-2 domain, are both expressed in the human testis. We speculate that the expression of ERß2 in some cells may affect their ability to respond to endogenous or exogenous estrogens. Expression of ERß1 in pachytene spermatocytes and round spermatids would be consistent with evidence from rodent studies that points to estrogens having a direct impact on the survival and maturation of germ cells.

Acknowledgments

We thank Prof. H. Critchley and Dr. C. Harlow for making samples available.

Footnotes

Abbreviations: AF, Activation function; ARKO, aromatase gene; h, human; HRP, horseradish peroxidase; NRS, normal rabbit serum; TBS, Tris-buffered saline.

Received October 11, 2001.

Accepted March 7, 2002.

References

  1. O’Donnell L, Robertson KM, Jones ME, Simpson ER 2001 Estrogen and spermatogenesis. Endocr Rev 22:289–318[Abstract/Free Full Text]
  2. Ebling FJP, Brooks AN, Cronin AS, Ford H, Kerr JB 2000 Estrogenic induction of spermatogenesis in the hypogonadal mouse. Endocrinology 141:2861–2869[Abstract/Free Full Text]
  3. Pentikainen V, Erkkila K, Suomalainen L, Parvinen M, Dunkel L 2000 Estradiol acts as a germ cell survival factor in the human testis in vitro. J Clin Endocrinol Metab 85:2057–2067[Abstract/Free Full Text]
  4. Hess RA 2000 Oestrogen in fluid transport in efferent ducts of the male reproductive tract. Rev Reprod 5:84–92[Abstract]
  5. Payne A, Kelch R, Musich S, Halpern M 1976 Intratesticular site of aromatization in the human. J Clin Endocrinol Metab 42:1081–1087[Abstract]
  6. Turner KJ, Macpherson S, Millar MR, McNeilly AS, Williams K, Cranfield M, Groome NP, Sharpe RM, Fraser HM, Saunders PT 2002 Development and validation of a new monoclonal antibody to mammalian aromatase. J Endocrinol 172:21–30[Abstract]
  7. Nitta H, Bunick D, Hess RA, Janulis L, Newton SC, Millette CF, Osawa Y, Shizuta Y, Toda K, Bahr JM 1993 Germ cells of the mouse testis express P450 aromatase. Endocrinology 132:1396–1401[Abstract]
  8. Hess RA, Bunick D, Bahr JM 1995 Sperm, a source of estrogen. Environ Health Perspect 103:59–62
  9. Robertson K, O’Donnell L, Jones ME, Meachem SJ, Boon WC, Fisher CR, Graves KH, McLachlan RI, Simpson ER 1999 Impairment of spermatogenesis in mice lacking a functional aromatase (CYP19) gene. Proc Natl Acad Sci USA 96:7986–7991[Abstract/Free Full Text]
  10. Robertson KM, Simpson ER, Lacham-Kaplan O, Jones MEE 2001 Characterization of the fertility of male aromatase knockout mice. J Androl 22:825–830[Abstract]
  11. Shetty G, Krishamurthy H, Krishnamurthy HN, Bhatnagar AS, Moudgal NR 1998 Effect of long-term treatment with aromatase inhibitor on testicular function of adult bonnet monkeys (M. radiata). Steroids 63:414–420[CrossRef][Medline]
  12. Green S, Walter P, Kumar V, Krust A, Bornert J-M, Argos P, Chambon P 1986 Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320:134–139[CrossRef][Medline]
  13. Mosselman S, Polman J, Dijkema R 1996 ERß: identification and characterization of a novel human estrogen receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  14. Ogawa S, Inoue S, Watanabe T, Hiroi H, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 The complete primary structure of human estrogen receptor beta (hERß) and its heterodimerization with ER {alpha} in vivo and in vitro. Biochem Biophys Res Commun 243:122–126[CrossRef][Medline]
  15. Kuiper GGJM, Enmark E, Pelto-Hukko M, Nilsson S, Gustafsson J-A 1996 Cloning of a novel estrogen receptor expressed in rat prostate. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  16. White R, Lees J, Needham M, Ham J, Parker M 1987 Structural organization and expression of the mouse estrogen receptor. Mol Endocrinol 1:735–744[Abstract]
  17. Enmark E, Pelto-Huikko M, Grandien K, Lagercrantz S, Lagercrantz J, Fried G, Nordenskjold M, Gustafsson JA 1997 Human estrogen receptor ß-gene structure, chromosomal localization, and expression pattern. J Clin Endocrinol Metab 82:4258–4265[Abstract/Free Full Text]
  18. Kelley ST, Thackray VG 1999 Phylogenetic analyses reveal ancient duplication of estrogen receptor isoforms. J Mol Evolution 49:609–614[CrossRef][Medline]
  19. Beato M, Klug J 2000 Steroid hormone receptors: an update. Hum Reprod Update 6:225–236[Abstract/Free Full Text]
  20. Saunders PTK 1998 Oestrogen receptor ß (ERß). Rev Reprod 3:164–171[Abstract]
  21. Pettersson K, Gustafsson J-A 2001 Role of estrogen receptor beta in estrogen action. Annu Rev Physiol 63:165–192[CrossRef][Medline]
  22. Cowley SM, Hoare S, Mosselman S, Parker SG 1997 Estrogen receptors {alpha} and ß form heterodimers on DNA. J Biol Chem 272:19858–19862[Abstract/Free Full Text]
  23. Pettersson K, Grandien K, Kuiper GGJM, Gustafsson J-A 1997 Mouse estrogen receptor ß forms estrogen receptor response element-binding heterodimers with estrogen receptor {alpha}. Mol Endocrinol 11:1486–1496[Abstract/Free Full Text]
  24. Ogawa S, Inoue S, Watanabe T, Orimo A, Hosoi T, Ouchi Y, Muramatsu M 1998 Molecular cloning and characterization of human estrogen receptor bcx: a potential inhibitor of estrogen action in human. Nucleic Acids Res 26:3505–3512[Abstract/Free Full Text]
  25. Moore JT, McKee DD, Slentz-Kesler K, Moore LB, Jones SA, Horne EL, Su JL, Kliewer SA, Lehmann JM, Willson TM 1998 Cloning and characterisation of human estrogen receptor ß isoforms. Biochem Biophys Res Commun 247:75–78[CrossRef][Medline]
  26. Inoue S, Ogawa S, Horie K, Hoshino S, Goto W, Hosoi T, Tsutsumi O, Muramatsu M, Ouchi Y 2000 An estrogen receptor ß isoform that lacks exon 5 has dominant negative activity on both ER{alpha} and ERß. Biochem Biophys Res Commun 279:814–819[CrossRef][Medline]
  27. Chu S, Fuller PJ 1997 Identification of a splice variant of the rat estrogen receptor ß gene. Mol Cell Endocrinol 132:195–199[CrossRef][Medline]
  28. Petersen DN, Tkalcevic GT, Koza-Taylor PH, Turi TG, Brown TA 1998 Identification of estrogen receptor ß2, a functional variant of estrogen receptor ß expressed in normal rat tissues. Endocrinology 139:1082–1092[Abstract/Free Full Text]
  29. Saji S, Sakaguchi H, Andersson S, Warner M, Gustafsson J-A 2001 Quantitative analysis of estrogen receptor proteins in rat mammary gland. Endocrinology 142:3177–3186[Abstract/Free Full Text]
  30. Chu S, Mamers M, Burger HG, Fuller PJ 2000 Estrogen receptor isoform gene expression in ovarian stromal and epithelial tumors. J Clin Endocrinol Metab 85:1200–1205[Abstract/Free Full Text]
  31. Lu B, Leygue E, Dotzlaw H, Murphy LC, Watson PH 1998 Estrogen receptor-ß mRNA variants in human and murine tissues. Mol Cell Endocrinol 138:199–203[CrossRef][Medline]
  32. Saunders PT, Fisher JS, Sharpe RM, Millar MR 1998 Expression of oestrogen receptor ß (ER ß) occurs in multiple cell types, including some germ cells, in the rat testis. J Endocrinol 156:R13–R17
  33. Saunders PTK, Sharpe RM, Williams K, Macpherson S, Urquart H, Irvine DS, Millar MR 2001 Differential expression of oestrogen receptor alpha and beta proteins in the testes and male reproductive system of human and non-human primates. Mol Hum Reprod 7:227–236[Abstract/Free Full Text]
  34. Atanassova N, McKinnell C, Williams K, Turner KJ, Fisher JS, Saunders PTK, Millar MR, Sharpe RM 2000 Age-, cell- and region-specific immunoexpression of ER{alpha} (but not ERß) during postnatal development of the epididymis and vas deferens of the rat and disruption of this pattern by neonatal treatment with diethylstilbestrol. Endocrinology 142:874–876
  35. Saunders PTK, Millar MR, Williams K, Macpherson S, Harkiss D, Anderson RA, Orr B, Groome NP, Scobie G, Fraser HM 2000 Differential expression of estrogen receptor-{alpha} and -ß and androgen receptor in the ovaries of marmoset and human. Biol Reprod 63:1098–1105[Abstract/Free Full Text]
  36. Millar MR, Sharpe RM, Maguire SM, Saunders PTK 1993 Cellular localisation of messenger RNAs in rat testis: application of digoxigenin labelled probes to embedded tissue. Cell Tissue Res 273:269–277[CrossRef][Medline]
  37. Lau K-M, Mok SC, Ho S-M 1999 Expression of human estrogen receptor a and -ß, progesterone receptor, and androgen receptor mRNA in normal and malignant ovarian epithelial cells. Proc Natl Acad Sci USA 96:5722–5727[Abstract/Free Full Text]
  38. Groome NP, Lawrence M 1991 Preparation of monoclonal antibodies to the ßA subunit of ovarian inhibin using a synthetic peptide immunogen. Hybridoma 10:309–312[Medline]
  39. Norton AJ, Jordan S, Yeomans P 1994 Brief, high-temperature heat denaturation (pressure cooking): a simple and effective method of antigen retrieval for routinely processed tissues. J Pathol 173:371–379[CrossRef][Medline]
  40. Clermont Y 1963 The cycle of the seminiferous epithelium in man. AmJ Anat 112:35–51
  41. Critchley HOD, Brenner RM, Drudy TA, Williams KA, Nayak NR, Millar MR, Saunders PTK 2001 Estrogen receptor ß, but not estrogen receptor {alpha}, is present in the vascular endothelium of the human and nonhuman primate endometrium. J Clin Endocrinol Metab 86:1370–1378[Abstract/Free Full Text]
  42. Miller WR, Sharpe RM 1998 Environmental oestrogens and human reproductive cancers. Endocr-Rel Cancer 5:69–96
  43. Williams K, McKinnell C, Saunders PTK, Walker M, Fisher JS, Turner KJ, Atanassova N, Sharpe M 2001 Neonatal exposure to potent and environmental oestrogens and abnormalities of the male reproductive system in the rat: evidence for the importance of the androgen-oestrogen balance and assessment of relevance to man. Hum Reprod Update 7:236–247[Abstract/Free Full Text]
  44. Scobie GS, Macpherson S, Millar MR, Groome NP, Romana PG, Saunders PTK, Human estrogen receptors: differential expression of ER{alpha} and ß and the identification of ERß variants. Steroids, in press
  45. Makinen S, Makela S, Weihua Z, Warner M, Rosenlund B, Salmi S, Hovatta O, Gustafsson JA 2001 Localization of oestrogen receptors {alpha} and ß in human testis. Mol Hum Reprod 7:497–503[Abstract/Free Full Text]
  46. Fisher J, Millar MR, Majdic G, Saunders PTK, Fraser HM, Sharpe RM 1997 Immunolocalisation of oestrogen receptor-{alpha} (ER{alpha}) within the testis and excurrent ducts of the rat and marmoset monkey from perinatal life to adulthood. J Endocrinol 153:485–495[Abstract]
  47. Taylor AH, Al-Azzawi F 2000 Immunolocalisation of oestrogen receptor ß in human tissues. J Mol Endocrinol 24:145–155[Abstract]
  48. Pelletier G, El-Alfy M2 2000 Immunocytochemical localization of estrogen receptor {alpha} and ß in human reproductive organs. J Clin Endocrinol Metab 85:4835–4840[Abstract/Free Full Text]
  49. Ekena K, Weis KE, Katzenellenbogen JA, Katzenellenbogen BS 1997 Different residues of the human estrogen receptor are involved in the recognition of structurally diverse estrogens and anti-estrogens. J Biol Chem 272:5069–5075[Abstract/Free Full Text]
  50. Tanenbaum DM, Wang Y, Williams SP, Sigler PB 1998 Crystallographic comparison of the estrogen and progesterone receptor’s ligand binding domains. Proc Natl Acad Sci USA 95:5998–6003[Abstract/Free Full Text]
  51. Pike ACW, Brzozowski AM, Hubbard RE, Bonn T, Thorsell AG, Engstrom O, Ljunggren J, Gustafsson JA, Carlquist M 1999 Structure of the ligand-binding domain of oestrogen receptor ß in the presence of a partial agonist and a full antagonist. EMBO J 18:4608–4618[CrossRef][Medline]
  52. Klinge CM 2000 Estrogen receptor interaction with co-activators and co-repressors. Steroids 65:227–251[CrossRef][Medline]
  53. Lees JA, Fawell SE, White R, Parker MG 1990 A 22-aminoacid peptide restores DNA-binding activity to dimerization-defective mutants of the estrogen receptor. Mol Cell Biol 10:5529–5531[Abstract/Free Full Text]
  54. Tremblay GB, Tremblay A, Labrie F, Giguere V 1999 Dominant activity of activation function (AF-1) and differential stoichiometric requirements for AF-1 and -2 in the estrogen receptor {alpha}-ß heterodimeric complex. Mol Cell Biol 19:1919–1927[Abstract/Free Full Text]
  55. Hollenberg SM, Wienberger C, Ong ES, Cerelli G, Oro A, Lebo R, Thompson EB, Rosenfeld MG, Evans RM 1985 Primary stucture and expression of a functional human glucocorticoid receptor cDNA. Nature 318:635–641[CrossRef][Medline]
  56. Oakley RH, Sar M, Cidlowski JA 1996 The human glucocorticoid receptor ß isoform. Expression, biochemical properties and putative function. J Biol Chem 271:9550–9559[Abstract/Free Full Text]
  57. Oakley RH, Jewell CM, Yudt MR, Bofetiado DM, Cidlowski JA 1999 The dominant negative activity of the human glucocorticoid receptor ß isoform. J Biol Chem 274:27857–27866[Abstract/Free Full Text]
  58. Fuqua SA, Schiff R, Parra I, Friedrichs WE, Su JL, McKee DD, Slentz-Kesler K, Moore LB, Willson TM, Moore JT 1999 Expression of wild-type estrogen receptor ß and variant isoforms in human breast cancer. Cancer Res 59:5425–5428[Abstract/Free Full Text]
  59. Fuqua SA, Fitzgerald SD, Chamness GC, Tandon AK, McDonnell DP, Nawaz Z, O’Malley BW, McGuire WL 1991 Variant human breast tumor estrogen receptor with constitutive transcriptional activity. Cancer Res 51:105–109[Abstract/Free Full Text]
  60. Vladusic EA, Hornby AE, Guerra-Vladusic FK, Lupu R 1998 Expression of estrogen receptor ß messenger RNA variant in breast cancer. Cancer Res 58:210–214[Abstract/Free Full Text]
  61. Hall JM, McDonnell DP 1999 The estrogen receptor ß-isoform (ERß) of the human estrogen receptor modulates ER{alpha} transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140:5566–5578[Abstract/Free Full Text]
  62. Weihua Z, Saji S, Makinen S, Cheng G, Jensen EV, Warner M, Gustafsson JA 2000 Estrogen receptor (ER) ß, a modulator of ER{alpha} in the uterus. Proc Natl Acad Sci USA 97:5936–5941[Abstract/Free Full Text]
  63. Maruyama K, Endoh H, Sasaki-Iwaoka H, Kanou H, Shimaya E, Hashimoto S, Kato S, Kawashima H 1998 A novel isoform of rat estrogen receptor ß with 18 amino acid insertion in the ligand binding domain as a putative dominant negative regulator of estrogen action. Biochem Biophys Res Commun 246:142–147[CrossRef][Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
A. M. Shaaban, A. R. Green, S. Karthik, Y. Alizadeh, T. A. Hughes, L. Harkins, I. O. Ellis, J. F. Robertson, E. C. Paish, P. T.K. Saunders, et al.
Nuclear and Cytoplasmic Expression of ER{beta}1, ER{beta}2, and ER{beta}5 Identifies Distinct Prognostic Outcome for Breast Cancer Patients
Clin. Cancer Res., August 15, 2008; 14(16): 5228 - 5235.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
T. F.G Lucas, E. R Siu, C. A Esteves, H. P Monteiro, C. A Oliveira, C. S Porto, and M. F. M Lazari
17Beta-Estradiol Induces the Translocation of the Estrogen Receptors ESR1 and ESR2 to the Cell Membrane, MAPK3/1 Phosphorylation and Proliferation of Cultured Immature Rat Sertoli Cells
Biol Reprod, January 1, 2008; 78(1): 101 - 114.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
A. Carpino, V. Rago, V. Pezzi, C. Carani, and S. Ando
Detection of aromatase and estrogen receptors (ER{alpha}, ER{beta}1, ER{beta}2) in human Leydig cell tumor
Eur. J. Endocrinol., August 1, 2007; 157(2): 239 - 244.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
J. E. SIERENS, S. F. SNEDDON, F. COLLINS, M. R. MILLAR, and P. T. K. SAUNDERS
Estrogens in Testis Biology
Ann. N.Y. Acad. Sci., December 1, 2005; 1061(1): 65 - 76.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. F. Sneddon, N. Walther, and P. T. K. Saunders
Expression of Androgen and Estrogen Receptors in Sertoli Cells: Studies Using the Mouse SK11 Cell Line
Endocrinology, December 1, 2005; 146(12): 5304 - 5312.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
D Modi, C Shah, G Sachdeva, S Gadkar, D Bhartiya, and C Puri
Ontogeny and cellular localization of SRY transcripts in the human testes and its detection in spermatozoa
Reproduction, November 1, 2005; 130(5): 603 - 613.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
C Roger, S Lambard, A Bouskine, B Mograbi, D Chevallier, M Nebout, G Pointis, S Carreau, and P Fenichel
Estrogen-induced growth inhibition of human seminoma cells expressing estrogen receptor {beta} and aromatase
J. Mol. Endocrinol., August 1, 2005; 35(1): 191 - 199.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Shah, D. Modi, G. Sachdeva, S. Gadkar, and C. Puri
Coexistence of Intracellular and Membrane-Bound Progesterone Receptors in Human Testis
J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 474 - 483.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
M P A Davies, P A O'Neill, H Innes, D R Sibson, W Prime, C Holcombe, and C S Foster
Correlation of mRNA for oestrogen receptor beta splice variants ER{beta}1, ER{beta}2/ER{beta}cx and ER{beta}5 with outcome in endocrine-treated breast cancer
J. Mol. Endocrinol., December 1, 2004; 33(3): 773 - 782.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. Pais, I. Leav, K.-M. Lau, Z. Jiang, and S.-M. Ho
Estrogen Receptor-{beta} Expression in Human Testicular Germ Cell Tumors
Clin. Cancer Res., October 1, 2003; 9(12): 4475 - 4482.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Brown, G. A. Scobie, J. Townsend, R. A. L. Bayne, J. R. Seckl, P. T. K. Saunders, and R. A. Anderson
Identification of a Novel Missense Mutation That Is as Damaging to DAX-1 Repressor Function as a Nonsense Mutation
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1341 - 1349.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Nair and C. Shaha
Diethylstilbestrol Induces Rat Spermatogenic Cell Apoptosis in Vivo through Increased Expression of Spermatogenic Cell Fas/FasL System
J. Biol. Chem., February 14, 2003; 278(8): 6470 - 6481.
[Abstract] [Full Text] [PDF]