| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
The Impact of the Human Genome on Endocrinology: Original Articles |
Department of Endocrinology (M.K., H.S.C., G.K., S.J., Y.U., Z.K., A.B.G.), St. Bartholomews Hospital, London EC1A 7BE, United Kingdom; Kings College Hospital (P.E.H.), London SE15 5QN, United Kingdom; Center for Cell and Molecular Medicine (W.E.F.), University of Keele School of Postgraduate Medicine, Stoke-on Trent ST4 7QB, United Kingdom; and Department of Molecular Therapeutics (F.-X.C.), The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030
Address all correspondence and requests for reprints to: Prof. A. B. Grossman, Department of Endocrinology, St. Bartholomews Hospital, West Smithfield, London EC1A 7BE, United Kingdom. E-mail: . A.B.Grossman{at}qmul.ac.uk
Abstract
The cyclin-dependent kinase inhibitor p27Kip1 (p27) plays a pivotal role in controlling cell proliferation during development and tumorigenesis. p27 has been implicated in pituitary tumorigenesis in studies of knockout mice and in analyses of human pituitary tumor samples. In this study, we further explored the role of p27 in human pituitary tumors by measuring levels of phosphorylated p27 (P-p27), and also Jun activation domain-binding protein 1 (Jab1), which is thought to facilitate the phosphorylation and degradation of p27, in normal pituitary tissue (n = 21), pituitary adenomas (n = 75), and pituitary carcinomas (n = 10). The amount of p27 protein in corticotroph adenomas and pituitary carcinomas was much lower than that in normal pituitary tissue or other types of pituitary adenoma. Nuclear P-p27 protein levels were significantly decreased in the adenomas, compared with the normals, and were much lower in the carcinomas, compared with either normal pituitary tissue or pituitary adenomas. However, P-p27 levels in corticotroph adenomas were similar to normal pituitary tissue, thus demonstrating a greatly increased ratio of P-p27 to p27 specifically in corticotroph tumors. No difference was found in Jab1 protein levels in either corticotroph tumors or other pituitary adenomas, compared with normal tissue, but there was a small but significant increase in Jab1 levels in carcinomas. Corticotroph and metastatic tumors both showed a significantly higher Ki-67 labeling index than normal pituitary or other types of pituitary adenomas, and in general the Ki-67 labeling index was negatively correlated with p27 nuclear staining. The amount of p27 and Jab1 mRNA was positively correlated in all pituitary samples studied but did not correlate with the changes in immunostaining. Our findings suggest that in corticotroph tumors there is an accentuated phosphorylation of p27 into P-p27, possibly related to increased cyclin E expression, whereas both p27 and P-p27 are subject to increased degradation in pituitary carcinomas. Such variations in phosphorylation may play a role in pituitary tumorigenesis, but modulation of Jab1 is unlikely to be important in the pathogenesis of pituitary adenomas.
THE CYCLIN-DEPENDENT KINASE inhibitor p27Kip1 (p27) is an essential participant in the regulation of cell cycle progression (1). Reduced expression of p27 protein has been frequently observed in a variety of human malignancies, and a significant correlation between low p27 protein expression and high tumor grade has been described (for review, see Ref. 2). In humans, pituitary adenomas are common neoplasms occurring in 1027% of unselected autopsy series. The pathogenesis of these primarily slow-growing, benign tumors is unknown, but it has been suggested that p27 could play an important role in pituitary tumorigenesis, because p27-deficient or haploinsufficient mice show a specific propensity for the development of pituitary tumors arising from the intermediate lobe and secreting ACTH (3, 4, 5, 6). p27 is rarely mutated in human tumors (7), including pituitary tumors (8, 9, 10), but its gene was shown to be silenced by methylation in a pituitary cell line (11). In addition, trisomy of chromosome 12, the location of the gene of p27, has been described in a subset of pituitary adenomas (12). Although regulation of p27 mRNA expression has been shown to play an important role in certain situations (2, 11, 13, 14), most of the studies suggest that p27 is primarily regulated at the protein level, and factors influencing p27 degradation may be important regulators of cell cycle progression. p27 undergoes phosphorylation before transportation to the cytoplasm for ubiquitin-mediated degradation (15, 16). Recently, a new protein has been implicated in the transport of p27 into the cytoplasm: Jun activation domain-binding protein 1 (Jab1) (17, 18). We and others have previously shown that p27 protein expression was significantly less in human pituitary adenomas compared with the normal pituitary, and virtually absent in corticotroph or malignant pituitary tumors (19, 20). Our goals in this study were to measure the expression of p27, phosphorylated p27 (P-p27), and Jab1 protein and mRNA in a variety of pituitary tumors, and to compare these to the Ki-67 labeling index, a marker of cell proliferation.
Materials and Methods
Samples
Human pituitary samples (n = 106) removed at transsphenoidal surgery were classified histologically using hematoxylin and eosin, reticulin and immunohistochemical staining, into 21 normal pituitaries and 85 pituitary tumors. Abnormal pituitary tissue was classified as benign adenoma, aggressive adenoma, or metastatic tumor. Adenomas were defined as samples removed at pituitary surgery with a disrupted reticulin pattern. The 65 benign adenomas were categorized as GH-secreting tumors (n = 19), ACTH-secreting tumors (n = 13), prolactinomas (n = 11), nonfunctioning pituitary adenomas (NFPAs) (n = 16), TSH-omas (n = 2), and FSH-omas (n = 4). For the NFPAs, immunostaining showed no staining with antisera for any of the pituitary hormones (ACTH, GH, PRL, FSH, LH, TSH,
-subunit, or the ß-subunit of human chorionic gonadotropin) in 7 of the 16 NFPA samples, whereas the rest showed variable PRL, LH,
-subunit, and the ß-subunit of human chorionic gonadotropin staining. The aggressive tumors included NFPAs (n = 5), prolactinomas (n = 3), and somatotroph adenomas (n = 2). The definition of aggressiveness was taken to include those showing cavernous sinus invasion at operation or recurrence after surgery and radiotherapy. Metastatic carcinomas were defined as pituitary tumors with histologically verified distinct extrapituitary metastases. The metastatic group (n = 10) included ACTH-secreting (n = 4; metastatic sites, liver, cervical vertebra, lung, and thoracic spine), PRL-secreting (n = 4; metastatic sites, internal jugular vein, base of skull, vault of skull, and brain stem), and nonfunctioning tumors (n = 2; metastatic sites, ribs, lumbar spine, and intradural cord). In each case, the primary tumor was analyzed, except one of the ACTH-secreting carcinomas when the cervical vertebra sample was studied. All patients had a 100-mg hydrocortisone im injection before surgery, whereas patients with the clinical diagnosis of Cushings disease routinely received 68 wk of medical therapy with metyrapone, ketoconazole, or both to normalize cortisol levels before surgery. To avoid inconsistency in the treatment of tissue samples that is unavoidable with autopsy controls, the control normal pituitaries used in the immunohistochemical studies were part of resection specimens removed at transsphenoidal surgery for presumptive tumors that proved on staining to consist of normal pituitary tissue and architecture. The normal pituitaries included tissue from patients with the clinical diagnosis of Cushings disease (n = 14), prolactinoma (n = 3), acromegaly (n = 2), NFPA (n = 1), and an arachnoid cyst (n = 1).
Patient samples studied by RT-PCR (n = 47) included 11 somatotroph, 5 corticotroph, 4 gonadotroph, 5 lactotroph adenomas, and 22 NFPAs, and their data were compared with 4 normal pituitaries removed at autopsy from patients with nonendocrine disease. The institutional Ethics Committee approved all studies.
Immunostaining for p27, phospho-p27, Jab1, and Ki-67
Tissue samples were collected at transsphenoidal surgery and prepared for pathological examination by formalin fixation and paraffin embedding. Sections underwent heat-mediated antigen retrieval treatment (21) before immunohistochemical analysis with the standard avidin-biotin complex immunoperoxidase system (Vectastain Elite, Vector Laboratories, Inc., Peterborough, UK) (21). Human anti-p27 antibody raised against the full-length p27 protein was used at 1:50 as described previously (22), and part of the data on p27 staining was used from our own previously published study (19). For P-p27 staining, we used an epitope affinity-purified rabbit antihuman polyclonal antibody (1:250) (Zymed Laboratories, Inc., San Francisco, CA), raised against the 22 amino acid p27 peptide fragment containing the phosphorylated threonine residue 187 (Thr187) in the C terminus. For Jab1 staining, an affinity-purified antihuman monoclonal Jab1 antibody (GeneTex, Wiltshire, UK), raised against a peptide mapping at the amino terminus of Jab1 (17), was used at a dilution of 1:500. For Ki-67 staining, a rabbit antihuman polyclonal Ki-67 antibody was used at a dilution of 1:200 (DAKO Corp., Cambridgeshire, UK). The Ki-67 proliferative index was determined as the percentage of positive cells of all counted cells and expressed as the labeling index.
Human tonsil tissue was used as a positive control because this contains lymphoid tissue with variable proliferative activity. In the mantle (peripheral) zone of the follicle, the cells are mainly quiescent, whereas cells in the germinal centers are highly proliferative. For assessment of p27, P-p27, and Jab1 immunostaining in pituitary samples, approximately 500 cells were counted and assessed for the intensity of staining. Cells with strong or moderate staining were counted as positive, cells with no staining were counted as negative, while cells with weak staining were scored separately. This type of quantitative analysis of immunostaining has been used previously in a number of publications (23, 24, 25, 26). Sections were chosen on each slide from a randomized grid array and were counted blind to the diagnosis. Cytoplasmic staining was assessed as focal or diffuse, and as negative, weak, moderate, or strong. Every case had a negative control in which the primary antibody was omitted and replaced by 1% BSA. Staining specificity was assessed by pretreating the slides with the appropriate antigen used in the antibody production (blocking peptide): full-length p27, the 22 amino acid fragment of P-p27, and the N-terminal fragment of the Jab1 protein. Cross-reactivity of p27 and P-p27 antibodies was assessed using p27 blocking peptide and P-p27 antibody, and P-p27 blocking peptide and p27 antibody, in tonsil tissue. Data showed no cross-reaction between the two antibodies. Figure 1
illustrates staining with p27 antibody with a) no pretreatment (positive staining), b) in the presence of added p27 peptide (no positive staining), and c) in the presence of P-p27 peptide (positive staining); it also shows staining with P-p27 antibody and d) no pretreatment (positive staining), e) in the presence of added p27 peptide (positive staining), and f) P-p27 protein (no staining). Jab1 staining with or without pretreatment with Jab1 blocking peptide is shown in Fig. 1
, g and h.
|
Semiquantitative RT-PCR
Relative amounts of mRNA for p27 and Jab1 were compared by RT-PCR. Total RNA was obtained and reverse-transcribed into cDNA by a standardized technique, as previously described (27). RT-PCRs with omission of reverse transcriptase, and with water replacing the template, were used as negative controls. The PCR was performed using primers spanning one or more introns of the genes being studied to allow genomic DNA contamination to be excluded. Primers used for p27 (358-bp product) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (198-bp product) were described elsewhere (8, 28); a new primer was used for Jab1 (539-bp product; GenBank accession no. U65928; sense, 5' GTGATGGGTCTGATGCTAGGAA 3'; antisense, 5' AGCAAGCTAGAAGAACTCAACG 3'). The sequence of the Jab1 PCR product was confirmed by direct sequencing. Gene expression was determined by multiplex PCR with the p27, Jab1, and GAPDH primers. The PCRs were performed during the linear phase of the synthesis curve for each PCR product (data not shown). cDNA (2.5 µl; 250 ng RNA equivalent) template was incubated with 0.5 µl of 20 µM deoxynucleotides (Promega Corp., Southampton, UK), 0.4 µmol Jab1 and p27 primers, and 0.15 µmol GAPDH primers, 0.125 U HotStart Taq DNA polymerase enzyme (QIAGEN, Crawley, UK), 5 µl Q solution, and 2.5 µl QiaBuffer containing 1.5 mmol/liter MgCl2, according to the manufacturers instructions in a 25 µl PCR. Twenty-six cycles were performed at 94 C for 1 min, 58 C for 1 min, and 72 C for 1 min after a denaturing cycle of 95 C for 15 min. A final extension cycle of 10 min at 72 C was used. The PCR products were visualized on ethidium bromide-stained 2% agarose gels. The absorbance values were measured for each band by densitometry (Model DS670 image densitometer, Bio-Rad Laboratories, Inc. Hemel-Hempstead, Hertfordshire, UK), using the Molecular Analyst PC software for Bio-Rad Laboratories Image Analysis systems, and expressed as OD units. A ratio between p27 or Jab1 and GAPDH was obtained for each individual sample.
Immunoblot analysis
Tissue from a nonfunctioning adenoma was ground with a few strokes of a Teflon pestle and lysed in lysis buffer [25 mM HEPES (pH 7.7), 400 mM NaCl, 0.5% Triton X-100, 1.5 mM MgCl2, 2 mM EDTA, 2 mM dithiothreithol, 0.1 mM phenylmethylsulfonyl fluoride; the protease inhibitors leupeptin 10 µg/ml, peptstatin 2 µg/ml, antipain 50 µg/ml, aprotinin 2 µg/ml, chymostatin 20 µg/ml, and benzamidine 2 µg/ml; and the phosphatase inhibitors 2 mM NaF, 1 mM Na3VO4, and 20 mM ß-glycerophosphate] for 20 min at 4 C. The cell pellet was spun at 13,000 rpm for 15 min at 4 C. Proteins of crude tissue extract (40 µg protein/lane) were resolved on 10% SDS-PAGE and were transferred to polyvinylidene difluoride membrane. Membranes were blocked with PBS-Tween 20 containing 5% milk and probed with primary antibodies as specified. Reactions were visualized with suitable secondary antibody conjugated with horseradish peroxidase (Bio-Rad Laboratories, Inc., Hercules, CA) using enhanced chemiluminescence reagents (Amersham Pharmacia Biotech, Piscataway, NJ).
Statistical analysis
The statistical analysis was performed with Arcus Quickstat version 1.2 (I. Buchan; Addison Wesley Longman Ltd., Cambridge, UK). After the Shapiro-Wilk test showed the data to be nonnormally distributed, the data were analyzed with nonparametric tests as follows. For each antibody, the percentages of the combined strongly and moderately staining cells were compared between normal pituitary tissue and abnormal pituitary tissue (i.e. all tumors) with the Mann-Whitney U test. Comparisons between normal tissue and each type of tumor were carried out with the Kruskal-Wallis test. Spearmans rank order correlation tests were performed to see whether there was any correlation between p27, P-p27, Jab1, and Ki-67 staining. Data on figures and in text are shown as mean ± SE (unless otherwise stated). Significance was taken at P less than 0.05.
Results
p27 and P-p27 protein levels
p27 staining in human tonsil was shown primarily in the resting cells of the mantle zone, with little or no staining in the center of the follicle (Fig. 1A
). This is an opposite pattern to the one observed with P-p27, in which the positive staining is seen in the rapidly dividing cells in the center of the follicle, whereas cells in the mantle zone showed very little P-p27 staining (Fig. 1D
). There was no cross-reaction between P-p27 protein and p27 antibody, and p27 protein and phospho-p27 antibody (Fig. 1
, AF). The specific immunodetection of p27, phospho-p27, and Jab1 antibodies was tested against whole tissue extract from pituitary adenomas by immunoblotting. As shown in Fig. 2
, when total protein extract from pituitary adenomas were separated, blotted, and then probed with Jab1, P-p27, and p27 antibodies, only a single band was recognized for each of the antibodies (38.5 kDa, Jab1; 27 kDa, p27).
|
|
|
|
In human tonsil, Jab1 staining was observed in the central, proliferating zone of the follicle (Fig. 1G
), and this was blocked by pretreatment with Jab1 peptide (Fig. 1H
). The distribution was similar to P-p27 and opposite to p27 (Fig. 1
, D and A, respectively). The antibody was tested on pituitary tissue by Western blotting and confirmed the antigen to be the predicted size (see above and Fig. 2
).
In the pituitary, both nuclear and cytoplasmic staining with the Jab1 antibody varied widely in intensity. No significant differences were seen between normal and abnormal tissues as a whole. Jab1 staining was fairly homogeneous among the adenomas, but seemed to be less in prolactinomas (Fig. 3C
). Pituitary carcinoma samples demonstrated slightly but significantly stronger nuclear Jab1 staining (P = 0.05). Representative images of Jab1 staining in a corticotroph adenoma and a metastatic carcinoma are shown in Fig. 4
. There is more apparent cytoplasmic staining in this corticotroph tumor than in the metastatic tumor, but the differences in cytoplasmic staining among the different groups of samples (normal vs. abnormal or individual comparisons) were not statistically significant.
Ki-67 labeling index
In the control human tonsils, Ki-67 staining was observed primarily in the central zone of the follicle, with occasional positive cells in the mantle zone (Fig. 1I
). In pituitary tissue, the Ki-67 labeling index was significantly higher in tumor samples compared with the normal tissue (P = 0.0089). Individual comparisons showed that the metastatic (2.6 ± 0.6), aggressive (2.0 ± 0.6), and corticotropinoma samples (2.4 ± 1.0) had significantly higher labeling indices compared with normal pituitary tissue (0.64 ± 0.1) (P = 0.0003, 0.03, and 0.009, respectively; Fig. 3D
). The high levels of Ki-67 staining in a corticotroph adenoma and in a metastatic tumor are illustrated in Fig. 4
. p27 staining of tumors showed a negative correlation with the Ki-67 labeling index (Spearmans correlation coefficient, -0.3; P = 0.004). No other correlation was observed between the different types of staining, grouping the samples either as normals and tumors or according to the individual hormone-secreting types.
Within the normal samples, no differences were found in p27, P-p27, Jab1, or Ki-67 staining between tissue removed from patients with the clinical diagnosis of Cushings disease or other pituitary abnormalities (adenomas or arachnoid cysts). Similarly, no differences were observed in p27, P-p27, Jab1, and Ki-67 staining within the metastatic group according to the hormone-secreting status of the tumors (ACTH- vs. PRL-secreting or nonfunctioning tumors). Because clinically aggressive adenomas showed similar staining to nonaggressive adenomas, we repeated the calculations with the clinically aggressive adenomas (but not the carcinomas) regrouped into their relevant hormone-secreting group. The results were similar to the calculations shown above.
p27 and Jab1 mRNA expression
p27 and Jab1 mRNA were detectable in every sample studied (Fig. 5
, A and B). p27 and Jab1 mRNA expression was positively correlated in the overall pituitary tumor group (Fig. 5A
; Spearmans correlation coefficient, +0.7; P < 0.0001). Within individual tumor subgroups, a significant positive correlation was found analyzing NFPAs (Spearmans correlation coefficient, +0.7; P < 0.0001) and PRL-secreting adenomas alone (Spearmans correlation coefficient, +0.9; P = 0.017). Similar trends were apparent in the other tumor types, but none attained statistical significance.
|
We found that both p27 and P-p27 were expressed in normal and abnormal tissue, generally at lower levels in adenomatous samples than in normal tissue. Moreover, the ratio of p27 to P-p27 was preserved in most cases, including the pituitary carcinomas, in which extremely low expression of both p27 and P-p27 was observed. However, a notable exception to this finding was seen in corticotroph tumors, in which P-p27 levels similar to normal tissue accompanied the low expression of p27. P-p27 was observed both in the cytoplasm and in the nucleus, but only nuclear staining showed differences between the different tumor types. Jab1 staining was also seen in both the nucleus and the cytoplasm. Although generally normal and abnormal pituitary samples showed similar Jab1 levels, metastatic pituitary carcinomas showed higher Jab1 staining compared with normal samples. Ki-67 staining was higher in pituitary carcinomas, aggressive tumors, and corticotroph adenomas, and correlated inversely with nuclear p27 immunostaining. p27 and Jab1 mRNA levels showed a positive correlation in both normal and abnormal samples.
Oncogenic processes are likely to involve regulators of cell cycle progression through the G1 phase (1). One of the important functions of cyclin E/cyclin-dependent kinase (CDK) 2 is that it inactivates p27 via phosphorylation (15, 16). Phosphorylation at the Thr187 residue renders p27 available for degradation via the ubiquitin/proteasome pathway (16, 29). p27 thus can act as a substrate as well as an inhibitor for the cyclin E/CDK2 complex, depending on the relative concentrations of p27 and cyclin E/CDK2 (16, 30). The activation of cyclin E/CDK2 therefore initiates a positive feedback loop; once this checkpoint is passed, the cell cycle can progress without external stimulants. Although the transcriptional regulation of p27 is important in some situations (2, 11, 13, 14), the expression of p27 mRNA remains stable throughout the cell cycle; by contrast, its protein expression varies widely during the cell cycle, with high levels in G0 phase, declining levels in G1, and lowest levels in S, G2, and M, suggesting that p27 is primarily regulated post-transcriptionally. Several studies suggest that after phosphorylation, p27, like other cell cycle proteins, is conjugated to multiple ubiquitin molecules and degraded by the proteasome pathway (15, 23, 31). Recently, it has been suggested that early in the G1 phase a Thr187-independent pathway also exists that directs p27 to ubiquitination and degradation by the proteasome (32). Because ubiquitination and degradation probably occur in the cytoplasm, the P-p27 must be transported there to be degraded. One potential transporter is Jab1, an activator protein (AP)-1 complex coactivator protein that may accelerate p27 degradation by facilitating its phosphorylation and by bringing it to the degradation machinery in the cytoplasm (18, 33). However, other data suggest that cyclin E/CDK2 forms a trimeric complex with p27; in a concentration-dependent manner, this facilitates its ubiquitination and degradation by the proteasome within the nucleus without the need to be transported into the cytoplasm (29, 34).
Jab1 is a 38 kDa protein and was first described as a coactivator of c-Jun and Jun D (17). The mechanism proposed for Jab-induced coactivation is the stabilization of c-Jun complexes with AP-1 sites. In addition, Jab1 was found to be present in a novel protein complex, the Jab1 signalosome, that was identified through its association with the 26S proteasome (35). The Jab1 signalosome possesses kinase activity in vitro and can phosphorylate c-Jun and other proteins as well (IKß
and p105) (35). Jab1 is present in both the cytoplasm and the nucleus and interacts with a number of factors. Activation of cell membrane receptor LFA-1, an integrin adhesion molecule, is followed by an increase in the nuclear pool of Jab1 paralleled by enhanced transactivation of an AP-1-dependent promoter (36). Using two-hybrid screens, a nuclear pore-associated protein, mNPAP60, has been identified that interacts with Arg90 on the P-p27 molecule and supports transport across the nuclear membrane (37). Mutant p27 at the mNPAP60 binding site is resistant to ubiquitin-mediated degradation (37). Thus, Jab1 and mNPAP60 might act in combination or in parallel to transport p27 out of the nucleus. Although the amount of Jab1 is tightly controlled in the cell (38), recent data suggest that the Jab1 level increases during tumor progression both in childhood neuroblastomas (39) and in breast cancer (Claret, F.-X., unpublished data), and also shows a tight correlation with cell cycle stages (Claret, F.-X., personal communication). These suggest that the higher Jab1 levels in our limited number of pituitary carcinoma cases are similar to other more malignant tumor types.
Exactly how Jab1 interacts with p27 is unclear. Also, the precise mechanism by which Jab1 enhances p27 degradation (e.g. by facilitating phosphorylation of Thr187 or by bringing it to the degradation machinery in the cytoplasm) is uncertain; perhaps Jab1 simply shuttles p27 from the nucleus to the cytoplasm. Alternatively, because Jab1 is present in mammalian COP9 complexes (which seem to contain enzymes that add phosphate groups), it may also be involved in the phosphorylation of p27; Jab1 may itself also physically interact with components of the ubiquitin/proteasome system. Interestingly, ectopic expression of p27 inhibited the entry of BALB/c-3T3 cells into S phase. Among regulators of cell cycle progression, those specific for G1 phase are often found to be altered in human tumors (1), indicating that G1 regulation is closely connected with tumor suppression. The precise interplay between this Jab1 regulatory pathway and the relative role of Jab1 in tumors will require identification of the cellular proteins that associate with Jab1.
p27-deficient mice develop pituitary adenomas arising from the intermediate lobe that stain positive for ACTH (3, 4, 5, 40), whereas a double knockout of p27 and p18 develops this abnormality earlier. Our own earlier study found no p27 sequence abnormalities apart from known polymorphisms in pituitary tumors; no loss of heterozygosity was observed, and no difference in p27 mRNA expression was seen in corticotropin-secreting pituitary tumors (8). However, we also showed that at the protein level significantly decreased p27 expression was observed generally in pituitary tumors compared with normals, and especially low levels in corticotroph adenomas and in metastatic pituitary tumors (19). This is clearly post-translational, because it is not mirrored by changes in p27 mRNA. These data correspond with those of others (9, 10, 20, 41, 42, 43). We also showed that normal pituitary corticotrophs have a relatively lower p27 expression compared with other normal pituitary cell types (19). The p27 gene can also be silenced via methylation in pituitary cell lines, but this does not appear to be a characteristic of human pituitary tumors (11). The present studies also confirm that any changes in p27 regulation in pituitary tumors are not secondary to alterations in mRNA.
In the present study, we studied the expression of P-p27 and correlated it with p27 expression and Ki-67 labeling index. Our data suggest that pituitary tumors as a group show lower p27 and P-p27 and higher Ki-67 staining compared with the normal pituitary. Analyzing individual tumor types, metastatic tumors, as expected, showed low levels of p27 and higher levels of Ki-67. The P-p27 staining was similarly low compared with that of p27, lower than in other tumor types or in normal tissue. Aggressive adenomas showed higher Ki-67 labeling but did not show any differences in terms of p27 and P-p27 compared with their more benign counterparts. By contrast, corticotroph adenomas behaved considerably different from other benign pituitary adenomas. Corticotroph tumors have relatively high levels of P-p27, compared with other pituitary tumors, and indeed were comparable to normal pituitary. This is in contrast with the fact that Cushings disease samples showed significantly less p27 staining; the relatively high P-p27 staining suggests that increased phosphorylation is characteristic of corticotroph tumors. The high P-p27/p27 ratio observed in corticotropinomas might suggest that the balance between P-p27 and p27 is altered in corticotroph tumors, leading to increased inactivation of p27. Thus, the high labeling index indicative of increased proliferative activity is associated with low p27 expression in both corticotroph and malignant tumors, but the mechanism of p27 inactivation appears to differ in the two tumor types. In malignant tumors, little or no p27 (phosphorylated or not) appears to remain in the nucleus, being either degraded in situ or exported out of the nucleus before ubiquitination. By contrast, in corticotroph tumors there is extensive phosphorylation of p27, to a much greater extent than that seen in normal pituitary or in other pituitary adenomas.
Ki-67 labeling index values are somewhat different between different laboratories. Our values in normal pituitary are higher than in some other publications, whereas the metastatic samples show lower indices (44, 45, 46). These differences could be caused by different sample fixation procedures, different specific antibodies, and/or differences in the method of counting.
Cyclin E is known to phosphorylate p27, and we have shown slight but significant overexpression of cyclin E in corticotroph tumors (47). Our present data and that of others (45) on Ki-67 suggest that corticotroph adenomas have a higher proliferative index than other pituitary adenomas; this could be explained by the relative overexpression of cyclin E and consequent high levels of P-p27 and low p27 expression compared with their levels in other pituitary tumors. This may be a characteristic of corticotroph adenomas per se, although we cannot rule out the possibility that local hormonal factors may play a role in the decline of p27 because normal corticotrophs contain less p27 than other types of hormone-secreting normal pituitary cells (19). Such factors could include glucocorticoids; corticotroph cells contain an especially high concentration of glucocorticoid receptors (48), but their number is, if anything, increased in corticotroph tumors (49). However, we have recently demonstrated overexpression of the enzyme 11ß-hydroxy-dehydrogenase type 2 in pituitary adenomas, which will decrease effective feedback and may thus increase proliferative activity (50). Thus, we have shown a number of different markers suggesting that corticotroph tumors are more proliferative than other pituitary tumors; they have a higher Ki-67 labeling index, lower p27 expression, and increased cyclin E expression (47), and this is supported by earlier studies in which increased proliferative behavior has been observed in corticotroph tumors (51, 52).
On the basis of the p27, cyclin E, and Ki-67 data, together with earlier in vitro studies, we suggest that corticotroph adenomas are more proliferative than other types of benign pituitary tumors. This might seem in sharp contrast with the clinical finding of the majority of corticotroph adenomas being microadenomas. However, because high levels of ACTH result in high cortisol levels, the clinical symptoms are more rapidly recognized than other types of pituitary tumors, including GH- or PRL-secreting adenomas, and especially nonfunctioning adenomas. It seems likely that the exuberant clinical signs lead to earlier diagnosis and smaller tumors at imaging and at operation.
In summary, our data suggest that low p27 protein expression characteristic of corticotroph and malignant pituitary tumors is associated with a marker of high proliferative activity (Ki-67), but the mechanism of p27 inactivation is different in the two tumor types. Corticotroph tumors show a high ratio of phosphorylated to unphosphorylated p27, possibly related to increased cyclin E expression. By contrast, malignant tumors show only very low levels of both p27 and P-p27 expression. In the corticotroph adenomas, the low p27 expression is unlikely to be related to excessive expression of the putative oncogene Jab1, whereas in malignant tumors this might be the case, and further studies are necessary to dissect the role of Jab1 in decreasing p27 levels.
Acknowledgments
We thank Lin Tiang (University of Texas M.D Anderson Cancer Center, Houston, TX) for technical assistance. We are grateful to Xin Lu (Ludwig Institute for Cancer Research, St. Marys Hospital, London, UK) for the p27 antibody and p27 blocking peptide and to Barbara Christy (Department of Cellular and Structural Biology, University of Texas Health Science Center, San Antonio, TX) for the Jab1 peptide for the blocking studies.
Footnotes
1 These authors contributed equally to this work. ![]()
2 Present address: Institute of Endocrinology, Tashkent, Uzbekistan. ![]()
This study was supported by the Medical Research Council (to M.K.), the Cancer Research Committee (to M.K. and A.B.G.), and the Joint Research Board of St. Bartholomews Hospital (to H.S.C.); NIH Grants 5P50CA83639 and CA90853-01A1; institutional research grants (IRG, IRS-BRS and PRS) (to F.-X.C.); and the Royal Society (to Y.U. and Z.K.).
Abbreviations: AP, Activator protein; CDK, cyclin-dependent kinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Jab1, Jun activation domain-binding protein 1; NFPA, nonfunctioning pituitary adenomas; p27, cyclin-dependent kinase inhibitor p27Kip1; P-p27, phosphorylated p27; Thr187, threonine residue 187.
Received October 9, 2001.
Accepted January 22, 2002.
References
This article has been cited by other articles:
![]() |
J. Li, Y. Wang, C. Yang, P. Wang, D. K. Oelschlager, Y. Zheng, D.-A. Tian, W. E. Grizzle, D. J. Buchsbaum, and M. Wan Polyethylene Glycosylated Curcumin Conjugate Inhibits Pancreatic Cancer Cell Growth through Inactivation of Jab1 Mol. Pharmacol., July 1, 2009; 76(1): 81 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Horiguchi, M. Yamada, T. Satoh, K. Hashimoto, J. Hirato, M. Tosaka, S. Yamada, and M. Mori Transcriptional Activation of the Mixed Lineage Leukemia-p27Kip1 Pathway by a Somatostatin Analogue Clin. Cancer Res., April 15, 2009; 15(8): 2620 - 2629. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. YABUUCHI, Y. KATAYOSE, A. ODA, M. MIZUMA, S. SHIRASOU, T. SASAKI, K. YAMAMOTO, M. OIKAWA, T. RIKIYAMA, T. ONOGAWA, et al. ZD1839 (IRESSA(R)) Stabilizes p27Kip1 and Enhances Radiosensitivity in Cholangiocarcinoma Cell Lines Anticancer Res, April 1, 2009; 29(4): 1169 - 1180. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Quereda and M. Malumbres Cell cycle control of pituitary development and disease J. Mol. Endocrinol., February 1, 2009; 42(2): 75 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Grant, H. Alturaihi, P. Jaquet, B. Collier, and U. Kumar Cell Growth Inhibition and Functioning of Human Somatostatin Receptor Type 2 Are Modulated by Receptor Heterodimerization Mol. Endocrinol., October 1, 2008; 22(10): 2278 - 2292. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Kouvaraki, A. L. Korapati, G. Z. Rassidakis, L. Tian, Q. Zhang, P. Chiao, L. Ho, D. B. Evans, and F. X. Claret Potential Role of Jun Activation Domain-Binding Protein 1 as a Negative Regulator of p27kip1 in Pancreatic Adenocarcinoma. Cancer Res., September 1, 2006; 66(17): 8581 - 8589. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hubina, A. M Nanzer, M. R Hanson, E. Ciccarelli, M. Losa, D. Gaia, M. Papotti, M. R. Terreni, S. Khalaf, S. Jordan, et al. Somatostatin analogues stimulate p27 expression and inhibit the MAP kinase pathway in pituitary tumours. Eur. J. Endocrinol., August 1, 2006; 155(2): 371 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Oh, E.-W. Lee, Y. H. Sung, M.-R. Yang, J. Ghim, H.-W. Lee, and J. Song Jab1 Induces the Cytoplasmic Localization and Degradation of p53 in Coordination with Hdm2 J. Biol. Chem., June 23, 2006; 281(25): 17457 - 17465. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Richardson and W. Zundel The Emerging Role of the COP9 Signalosome in Cancer Mol. Cancer Res., December 1, 2005; 3(12): 645 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Musat, M Korbonits, B Kola, N Borboli, M R Hanson, A M Nanzer, J Grigson, S Jordan, D G Morris, M Gueorguiev, et al. Enhanced protein kinase B/Akt signalling in pituitary tumours Endocr. Relat. Cancer, June 1, 2005; 12(2): 423 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Kaltsas, P. Nomikos, G. Kontogeorgos, M. Buchfelder, and A. B. Grossman Diagnosis and Management of Pituitary Carcinomas J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3089 - 3099. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Dong, L. Sui, Y. Watanabe, F. Yamaguchi, N. Hatano, and M. Tokuda Prognostic Significance of Jab1 Expression in Laryngeal Squamous Cell Carcinomas Clin. Cancer Res., January 1, 2005; 11(1): 259 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. N. Farrow, A. P. Bradford, J. J. Tentler, and A. Gutierrez-Hartmann Structural and Functional Analysis of the Differential Effects of c-Jun and v-Jun on Prolactin Gene Expression Mol. Endocrinol., October 1, 2004; 18(10): 2479 - 2490. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Kouvaraki, G. Z. Rassidakis, L. Tian, R. Kumar, C. Kittas, and F.-X. Claret Jun Activation Domain-binding Protein 1 Expression in Breast Cancer Inversely Correlates with the Cell Cycle Inhibitor p27Kip1 Cancer Res., June 1, 2003; 63(11): 2977 - 2981. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Z. Rassidakis, F.-X. Claret, R. Lai, Q. Zhang, A. H. Sarris, T. J. McDonnell, and L. J. Medeiros Expression of p27Kip1 and c-Jun Activation Binding Protein 1 Are Inversely Correlated in Systemic Anaplastic Large Cell Lymphoma Clin. Cancer Res., March 1, 2003; 9(3): 1121 - 1128. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |