| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
The Impact of the Human Genome on Endocrinology: Original Articles |
Departments of Urology (Y.L.G.) and Pediatrics (K.O.N., S.-A.I.), Malmö University Hospital, S-202 05 Malmö, Sweden; and Departments of Molecular Medicine (A.N., U.G., A.W.) and Woman and Child Health (A.N., E.M.R.), Karolinska Hospital, SE-171 76 Stockholm, Sweden
Address all correspondence and requests for reprints to: Anna Wedell, Department of Molecular Medicine, CMM:02, Karolinska Institutet, Karolinska Hospital, SE-171 76 Stockholm, Sweden. E-mail: . Anna.Wedell{at}cmm.ki.se
Abstract
An androgen receptor (AR) variant (E653K) was found in two unrelated Swedish families. One family had two girls affected with congenital adrenal hyperplasia (CAH) due to steroid 21-hydroxylase deficiency. The girls, who showed mild virilization in relation to their CYP21 genotype, had inherited the AR gene mutation from their father, who showed no symptoms of androgen insensitivity. The other family had a boy with partial androgen insensitivity and ambiguous genitalia, and he had inherited the AR gene mutation from his mother. The mutant receptor showed a transactivating capacity in the same range as the normal receptor at high concentrations of ligand (1 and 10 nM dihydrotestosterone), but absent or reduced transactivation at low levels (0.01 and 0.1 nM). The receptor variant was not found among 250 additional unselected Swedish men. Sequencing of the AR gene in five unrelated CAH girls with the I172N mutation in CYP21 and minimal virilization did not reveal any additional deviations from the normal reference sequence. In addition, there was no difference in lengths of the polymorphic CAG repeat in the AR gene between CAH girls with the I172N mutation who showed minimal and severe virilization, and we found no evidence of skewed X-inactivation. We conclude that AR gene mutations or polymorphisms are not a common factor influencing the degree of hyperandrogenic symptoms displayed by CAH girls, and that the AR E653K mutation is compatible with normal genital development, although it can cause genital malformations in susceptible individuals.
CONGENITAL ADRENAL HYPERPLASIA (CAH) due to 21-hydroxylase deficiency (21-OHD) is an autosomal recessive disorder with impaired synthesis of cortisol and aldosterone and oversecretion of androgens from the adrenal cortex. The syndrome exists in a wide spectrum of severity (1). The most severe form leads to circulatory collapse due to salt-wasting during the first weeks of life, together with virilizing malformations of external genitalia in girls. Moderate forms result in prenatal virilization in girls without life-threatening salt loss, and milder forms are associated with slightly elevated androgen levels, which are not sufficient to cause genital malformations but may result in precocious pseudopuberty or growth acceleration in childhood, or cause menstrual disturbances, hirsutism, and infertility in adult women. The degree of disease severity is generally determined by the underlying combination of mutations in the 21-hydroxylase gene (CYP21) (2, 3, 4, 5). However, exceptions from these genotype-phenotype relationships are sometimes seen. One particular mutation, I172N, is associated with a more variable phenotype than the other recurring mutations in this gene (2, 3, 4, 5). In most cases, this mutation is associated with genital malformations in girls without salt-wasting. However, around 10% of cases with I172N develop salt-wasting symptoms, and the degree of virilization can vary substantially. It is not known which factors influence the phenotypic expression of partially inactive CYP21 alleles.
Androgens exert their effects through the androgen receptor (AR), which belongs to the superfamily of ligand-activated transcription factors. The AR consists of three functional domains: the amino-terminal domain, the DNA-binding domain, and the steroid-binding domain (6). Mutations in the gene encoding the AR give rise to the androgen insensitivity syndrome (AIS), an X-linked condition that ranges in severity from complete AIS to varying degrees of undermasculinization in 46,XY individuals, partial AIS (PAIS) (7). The AR gene contains a polymorphic stretch of CAGs in exon 1, encoding a polyglutamine tract in the transactivating domain. This repeat is involved in the rare, adult-onset neurodegenerative disorder known as spinal and bulbar muscular atrophy or Kennedys disease (8). Affected males often develop signs of mild androgen insensitivity like impaired spermatogenesis and gynecomastia. In spinal and bulbar muscular atrophy, there is an expansion of the number of CAGs (4062 repeats) compared with normal (1131 repeats), which results in longer polyglutamine tracts in the AR (9). These longer polyglutamine tracts cause neuronal cell loss through a gain-of-function mechanism involving aggregation and sequestration of proteins (10, 11).
There are indications that different repeat lengths within the normal interval confer subtle differences in androgen sensitivity. Longer tracts have been associated with reduced spermatogenesis and infertility in otherwise normal males (12), and shorter repeats are suggested to be associated with an increased risk of prostate cancer (13). Longer repeats have also been associated with genital malformations due to undermasculinization (14). In addition, the expansion of the CAG repeat results in a linear decrease in the transactivation function of the AR in vitro (15). One study found that the shorter of the two AR alleles was preferentially less methylated in hirsute women, and this was interpreted to cause hypersensitivity to androgens (16). However, skewed X-inactivation in relation to CAG repeat length could not be confirmed as a cause of hyperandrogenic symptoms in a study comprising a larger number of women (17).
We found an AR gene mutation (E653K) in two unrelated Swedish families. One family had two girls affected with CAH due to 21-OHD. Their CYP21 genotype was I172N/Q318X, but the girls showed minimal signs of prenatal virilization. The CAH girls had inherited the E653K mutation from their father. The other family had a boy with PAIS, who had inherited the AR mutation from his mother. To study whether the AR variant could have a modifying effect on CAH disease expression, a functional assay of the mutant receptor was carried out, the frequency of the mutation was investigated in the general population, and X-inactivation status was assessed in the CAH girls.
Subjects and Methods
Subjects
The pedigree of the CAH family segregating the AR variant E653K is shown in Fig. 1A
. The father was initially selected as a normal control in AR gene studies using denaturing gradient gel electrophoresis (DGGE) in infertile men, because he is known to have fathered two children and mutations in the AR gene generally are not considered to be compatible with fertility. He did not show any signs of androgen insensitivity and denied problems with fertility. Levels of T, LH, and FSH were all within the normal range (T, 14.9 nmol/liter, ref. 630; LH, 2.3 IU/liter, ref. 1.012.0; FSH, 2.5 IU/liter, ref. 1.010.0). The two sisters were diagnosed with CAH because of premature pubarche and slight clitoromegaly (Prader stage 1) at 5 yr 3 months and 3 yr 4 months of age, respectively. The younger sister was born 1 yr after the Swedish neonatal screening program for CAH had been initiated. Her screening level of 17-hydroxyprogesterone (17-OHP) (126 nmol/liter) was slightly below the cut-off limit for positive samples (150 nmol/liter). The cut-off limit has since been adjusted to 75 nmol/liter, and she would thus have been diagnosed neonatally had she been born today. Serum 17-OHP at diagnosis was 404 mol/liter; T, 10.4 nmol/liter; androstenedione, 31.6 nmol/liter; and 11-desoxycortisol, 172 nmol/liter. Skeletal age at 4 yr was advanced to 8 yr 10 months, according to Greulich and Pyle (18). The elder sister was born before the screening had begun, but when the phenylketonuria filter paper blood spot was retrospectively analyzed, 17-OHP was 161 nmol/liter. Serum 17-OHP was 464 nmol/liter; T, 10.2 nmol/liter; androstenedione, 31.6 nmol/liter; and 11-desoxycortisol, 290 nmol/liter. Skeletal age at 8 yr 4 months was advanced to 12 yr, according to Greulich and Pyle (18).
|
Two-hundred military conscripts of Swedish origin and 50 randomly selected healthy Swedish men were used to study the frequency of the E653K variant in the population by allele-specific PCR. Exons 28 were sequenced, the length of the polymorphic CAG repeat in exon 1 of the AR gene was determined, and X-inactivation status was analyzed in five additional minimally virilized girls with 21-OHD, who all had the I172N mutation in one of their CYP21 alleles and a more severe mutation in the other. The length of the CAG-repeat was determined in five additional CAH girls with comparable genotypes who were severely virilized. For CYP21 genotypes and Prader scores, see Table 1
. The study was approved by the Ethics Committee at the Karolinska Institutet.
|
Genomic DNA was prepared from peripheral leukocytes. Genetic diagnosis of the CYP21 gene was performed by allele-specific PCR as described (20). DGGE of exon 28 of the AR gene was performed essentially as described before (21), except for primer annealing, which was carried out for 30 sec. For sequencing of the AR gene, PCR amplifications were performed using sets of flanking intronic primers. In the CAH family, exons 18 were analyzed (except for a segment of exon 1 spanning nucleotides 14451516, a region encoding a glycine homopolymeric segment, which was difficult to amplify). Nested amplifications were performed using one normal and one biotinylated primer, the biotinylated PCR fragments were immobilized by binding to streptavidin-covered magnetic beads (Dynabeads; DynAl AS, Oslo, Norway), and the nonbiotinylated strands were removed by incubating in 50 µl of 0.15 M NaOH for 5 min at room temperature. The remaining DNA was sequenced with the AutoRead DNA Sequencing kit, using fluorescence-labeled primers and the Pharmacia A.L.F. DNA Sequencer (Pharmacia, Uppsala, Sweden). In the PAIS family and in the five unrelated minimally virilized CAH girls, exons 28 of the AR gene were analyzed by cyclic sequencing using the Big Dye Primer Cycle Sequencing Ready Reaction Kit and the ABI Prism310 DNA sequencer (PE Corporation, Foster City, CA). Allele-specific PCR to detect the E653K variant was performed using two reactions for each subject, each containing one mutant (AR70 mut) or wild-type (AR70 WT) specific primer, together with an upstream and a downstream primer (AR21 and AR23). PCR conditions were established to generate a short, allele-specific band in the presence of the variant, and only a long control fragment in its absence. The sequences of the primers were: AR 21 5' TGACCAGGGAGAATGGTGATT; AR 23 5'ATCCCCCTTATCTCATGCT; AR 70 WT 5'GCTTCTGGGTTGTCTCCTC; AR 70 mut 5'GCTTCTGGGTTGTCTCCTT.
The length of the CAG repeat in the AR gene was determined by PCR using primers flanking the repeat and separation of the products on the ABI Prism310 DNA sequencer (PE Corporation). X-inactivation status was assayed using methylation-sensitive restriction enzymes as described by Pegoraro et al. (22). One microgram of DNA was digested with 10 U HpaII and 10 U CfoI (Roche Molecular Biochemicals, Burlington, NC) in a 25 µl volume for 2 h. After digestion, a 5-µl aliquot of the reaction was PCR amplified with primers flanking the CAG repeat, and separation of the products was performed using an ABI Prism310 DNA sequencer (PE Corporation), as above. Digested and undigested PCR-amplified DNA samples were compared for each subject.
Construction of plasmids and site-directed mutagenesis
The human full-length androgen receptor cDNA (6) was cloned into the expression vector pCMV4. For mutagenesis, a HindIII fragment containing the 3' end of exon 2 and exons 38 of the AR cDNA was moved to the mutagenesis vector pALTER-1 (Promega Corp., Madison, WI) and the mutation was reconstructed by oligonucleotide-mediated site-directed mutagenesis. The resulting DNA was electroporated into a mismatch-repair defective Escherichia coli strain (BMH 71-18 mutS), plasmid DNA was purified, and the HindIII fragment containing part of the AR cDNA was reintroduced into pCMV4-AR. To verify the correct incorporation of the mutation and to exclude additional sequence aberrations, the complete pCMV4-AR(E653K) construct was sequenced.
Transient expression of recombinant human AR and assay of AR function
Approximately 1 x 106 COS-1 cells were transiently transfected by electroporation (Gene Pulser, 1250 V, 25 µF; Bio-Rad Laboratories, Inc., Hercules, CA) with 5 µg of the pCMV4-AR constructs, together with 1 µg of the ß-galactosidase vector pCH110 (Pharmacia) and 2 µg of the reporter construct pGM-CAT. pGM-CAT contains the chloramphenicol acetyl transferase (CAT) gene under the control of the mouse mammary tumor virus promoter, which contains two androgen response elements. After transfection, the cells were incubated for 24 h in DMEM containing 10% FBS and 0.02% gentamicine. Twenty-four hours after transfection, the medium was changed to contain 10% charcoal-stripped serum, and increasing concentrations of the native ligand DHT (0.01 - 10 nM) were added. As controls, cells were transfected in parallel with pCMV4 without the AR, pCH110, and pGM-CAT. Twenty-four hours after adding the ligand, the cells were washed twice in PBS, harvested, and lysed. Measurements of CAT as well as ß-galactosidase protein levels were performed using ELISA (Roche Molecular Biochemicals, Mannheim, Germany). Three independent experiments, in duplicates, were carried out. Protein concentrations were determined using the Bradford assay.
Results
Genetic analyses
When analyzed by DGGE, the father in the CAH family (Fig. 1A
) displayed an aberrant band corresponding to exon 4 of the AR gene (Fig. 2
). Sequencing revealed a GAG to AAG transition, resulting in glutamic acid at position 653 being replaced by lysine (E653K). This allele contained 20 CAGs in the position of the polymorphic repeat. Sequencing confirmed that his two daughters were heterozygous for this AR gene variant. No additional deviations from the normal reference sequence were found in any other exon. Assay of X-inactivation status showed that the maternal and paternal X chromosomes were methylated to comparable extents. The boy with PAIS had the same AR gene mutation, which was also found in heterozygous form in his mother and maternal grandmother. This allele also carried 20 CAGs in exon 1. The E653K variant was not present in any of the 250 control subjects analyzed by allele-specific PCR (Fig. 3
). Sequencing of the AR gene from five additional unrelated CAH girls who had an I172N/(null or I2 splice) genotype but minimal signs of virilization did not reveal any deviations from the normal reference sequence. AR gene CAG repeat lengths were not different in the CAH girls who showed minimal signs of virilization compared with those who were born with severe genital malformations (t test; P = 0.9) (Table 1
). There was no evidence for skewed X-inactivation that would leave the allele with the longer repeat preferentially active in the minimally virilized girls.
|
|
The ability of the wild-type AR and the E653K mutant to stimulate an androgen-responsive reporter gene in response to increasing doses of DHT was measured (Fig. 4
). The E653K variant showed a transactivating capacity comparable to wild-type at high concentrations (1 and 10 nM) of DHT. At 0.01 nM DHT, no transactivation by the E653K variant was detected, and at 0.1 nM DHT, its degree of activation was 11% of that of the wild-type receptor. Serum reference values of DHT for newborn infants (48 d of age) are 0.39 ± 0.2 nmol/liter (boys) and 0.32 ± 0.1 nmol/liter (girls) (19). However, circulating levels of DHT do not necessarily reflect the local concentration of DHT that results from peripheral conversion from T, and comparisons of in vivo and in vitro concentrations are difficult.
|
Although good relationships between CYP21 genotype and clinical phenotype are generally seen in CAH due to 21-OHD, a certain degree of clinical variability can be seen among patients with comparable genotypes (2, 3, 4, 5). The I172N mutation is associated with a particularly high degree of phenotypic variability, and it is likely that many factors contribute to modify the phenotypic expression of partially inactivating mutations in the CYP21 gene, including interindividual differences in various aspects of steroid metabolism. Regarding androgen insensitivity, genotype-phenotype relationships are not obvious, and it is well established that the same AR gene mutation may give rise to varying degrees of undermasculinization in different patients (23, 24, 25, 26). Recently, mutations in the AR gene that cause subtle degrees of androgen resistance have been identified, such as reduced spermatogenesis and/or gynecomastia without the genital malformations that are seen in classical AIS (27, 28). The father in the CAH family lacked all symptoms and signs considered to be markers of AIS (hypospadias, gynecomastia, elevated T and LH, and/or fertility problems). The E653K mutation is thus associated with a clinical phenotype ranging from fertile male to severe genital malformations as in PAIS. It is unknown which factors influence the phenotypic expression of this and other AR gene mutations. In both families, the AR allele carrying the E653K mutation had 20 CAGs, and the length of the repeat was thus not a modifying factor. Our in vitro data are in accordance with receptor dysfunction at low steroid concentrations but indicate that the mutant AR functions normally at higher levels of ligand. It is possible that the level or timing of androgen production during fetal life determines whether this mutant will result in impaired formation of male genitalia. This would indicate that the prognosis regarding response to exogenous androgen treatment, masculinization in puberty, and fertility in the boy with PAIS and the E653K mutation is favorable. Another possibility is that the mutation causes a reduction in stable mRNA, although Western blotting indicated that AR expression was not affected. The in vivo observation that our patient with PAIS showed a clear response in penile growth during 3 months of local application of very high concentrations of DHT points in the same direction as the in vitro results on cells transfected with the E653K mutation. During this treatment, DHT blood levels reached 50 nmol/liter, which is more than 10 times higher than in normal adult males.
The E653K mutation is located in the hinge region of the AR, an area of low conservation between members of the steroid hormone receptor subfamily, between the DNA- and steroid-binding domains (amino acids 628670). Only two missense mutations, A645D and I664N, have previously been detected in this region of the receptor. Both were found in patients with PAIS (29, 30). Mutation A645D was also identified in a phenotypically normal 15-yr-old boy (31). However, because of the young age of the latter subject, it remains to be seen whether he will be normal with respect to fertility. The fact that two AR gene mutations, A645D and E653K, both were found in subjects with normal phenotypes, indicates that this is a region of the AR with minor influence on the function of the receptor, in which missense mutations have effect in susceptible individuals only. We did not find the E653K mutation when studying an additional 250 men, and it does thus not represent a normal polymorphism in the Swedish population.
Female carriers of AR mutations generally do not have symptoms or signs of androgen insensitivity, due to the presence of two X chromosomes. However, some carriers show patches of scarce pubic hair and they may have slightly delayed pubertal development, which is assumed to be related to skewed X-inactivation (7). Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen receptor gene correlates with X-chromosome inactivation (32). Using this, one study found that the shorter of the two AR alleles was preferentially less methylated in hirsute women, and this was interpreted to cause hypersensitivity to androgens (16). However, skewed X-inactivation as a cause of hyperandrogenic symptoms could not be confirmed in a study comprising a larger number of women (17). We found no significant difference in CAG repeat lengths between CAH girls with minimal or severe virilization, and we could not demonstrate skewed X-inactivation in our CAH girls with the AR gene mutation or in the other five girls who were minimally virilized.
To our knowledge, ours is the first family described who has a combination of mutations in two genes that each is involved in a monogenic disorder of steroid metabolism and sexual development. However, we have not been able to prove that the AR gene mutation modifies the CAH phenotype in the two sisters. We did not find any additional aberrations when sequencing the AR gene from another five unrelated CAH girls with mild androgenic symptoms. Thus, AR gene mutations or polymorphisms do not seem to be a common factor influencing the degree of androgen-dependent symptoms and signs displayed by girls affected with CAH.
Acknowledgments
We gratefully acknowledge Prof. M. G. Forest for the analysis of DHT in serum.
Footnotes
This study was supported by grants from the Swedish Medical Research Council (project no. 12198), the Fredrik and Ingrid Thuring Foundation, the Harald and Greta Jeansson Foundation, the Novo Nordisk Foundation, the Magnus Bergvall Foundation, the Emil and Vera Cornell Foundation, the Sven and Ebba-Christina Hagberg Foundation, and the Ronald McDonald Pediatric Fund.
Abbreviations: 17-OHP, 17-hydroxyprogesterone; 21-OHD, 21-hydroxylase deficiency; AIS, androgen insensitivity syndrome; AR, androgen receptor; CAH, congenital adrenal hyperplasia; CAT, chloramphenicol acetyl transferase; DGGE, denaturing gradient gel electrophoresis; DHT, dihydrotestosterone; PAIS, partial AIS.
Received September 10, 2001.
Accepted January 16, 2002.
References
This article has been cited by other articles:
![]() |
A. Deeb, J. Jaaskelainen, M. Dattani, H. C. Whitaker, C. Costigan, and I. A. Hughes A Novel Mutation in the Human Androgen Receptor Suggests a Regulatory Role for the Hinge Region in Amino-Terminal and Carboxy-Terminal Interactions J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3691 - 3696. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Forest Recent advances in the diagnosis and management of congenital adrenal hyperplasia due to 21-hydroxylase deficiency Hum. Reprod. Update, November 1, 2004; 10(6): 469 - 485. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |