help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giwercman, Y. L.
Right arrow Articles by Wedell, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giwercman, Y. L.
Right arrow Articles by Wedell, A.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 6 2623-2628
Copyright © 2002 by The Endocrine Society


The Impact of the Human Genome on Endocrinology: Original Articles

An Androgen Receptor Gene Mutation (E653K) in a Family with Congenital Adrenal Hyperplasia due to Steroid 21-Hydroxylase Deficiency as well as in Partial Androgen Insensitivity

Yvonne Lundberg Giwercman, Agneta Nordenskjöld, E. Martin Ritzén, Karl Olof Nilsson, Sten-A. Ivarsson, Ulla Grandell and Anna Wedell

Departments of Urology (Y.L.G.) and Pediatrics (K.O.N., S.-A.I.), Malmö University Hospital, S-202 05 Malmö, Sweden; and Departments of Molecular Medicine (A.N., U.G., A.W.) and Woman and Child Health (A.N., E.M.R.), Karolinska Hospital, SE-171 76 Stockholm, Sweden

Address all correspondence and requests for reprints to: Anna Wedell, Department of Molecular Medicine, CMM:02, Karolinska Institutet, Karolinska Hospital, SE-171 76 Stockholm, Sweden. E-mail: . Anna.Wedell{at}cmm.ki.se

Abstract

An androgen receptor (AR) variant (E653K) was found in two unrelated Swedish families. One family had two girls affected with congenital adrenal hyperplasia (CAH) due to steroid 21-hydroxylase deficiency. The girls, who showed mild virilization in relation to their CYP21 genotype, had inherited the AR gene mutation from their father, who showed no symptoms of androgen insensitivity. The other family had a boy with partial androgen insensitivity and ambiguous genitalia, and he had inherited the AR gene mutation from his mother. The mutant receptor showed a transactivating capacity in the same range as the normal receptor at high concentrations of ligand (1 and 10 nM dihydrotestosterone), but absent or reduced transactivation at low levels (0.01 and 0.1 nM). The receptor variant was not found among 250 additional unselected Swedish men. Sequencing of the AR gene in five unrelated CAH girls with the I172N mutation in CYP21 and minimal virilization did not reveal any additional deviations from the normal reference sequence. In addition, there was no difference in lengths of the polymorphic CAG repeat in the AR gene between CAH girls with the I172N mutation who showed minimal and severe virilization, and we found no evidence of skewed X-inactivation. We conclude that AR gene mutations or polymorphisms are not a common factor influencing the degree of hyperandrogenic symptoms displayed by CAH girls, and that the AR E653K mutation is compatible with normal genital development, although it can cause genital malformations in susceptible individuals.

CONGENITAL ADRENAL HYPERPLASIA (CAH) due to 21-hydroxylase deficiency (21-OHD) is an autosomal recessive disorder with impaired synthesis of cortisol and aldosterone and oversecretion of androgens from the adrenal cortex. The syndrome exists in a wide spectrum of severity (1). The most severe form leads to circulatory collapse due to salt-wasting during the first weeks of life, together with virilizing malformations of external genitalia in girls. Moderate forms result in prenatal virilization in girls without life-threatening salt loss, and milder forms are associated with slightly elevated androgen levels, which are not sufficient to cause genital malformations but may result in precocious pseudopuberty or growth acceleration in childhood, or cause menstrual disturbances, hirsutism, and infertility in adult women. The degree of disease severity is generally determined by the underlying combination of mutations in the 21-hydroxylase gene (CYP21) (2, 3, 4, 5). However, exceptions from these genotype-phenotype relationships are sometimes seen. One particular mutation, I172N, is associated with a more variable phenotype than the other recurring mutations in this gene (2, 3, 4, 5). In most cases, this mutation is associated with genital malformations in girls without salt-wasting. However, around 10% of cases with I172N develop salt-wasting symptoms, and the degree of virilization can vary substantially. It is not known which factors influence the phenotypic expression of partially inactive CYP21 alleles.

Androgens exert their effects through the androgen receptor (AR), which belongs to the superfamily of ligand-activated transcription factors. The AR consists of three functional domains: the amino-terminal domain, the DNA-binding domain, and the steroid-binding domain (6). Mutations in the gene encoding the AR give rise to the androgen insensitivity syndrome (AIS), an X-linked condition that ranges in severity from complete AIS to varying degrees of undermasculinization in 46,XY individuals, partial AIS (PAIS) (7). The AR gene contains a polymorphic stretch of CAGs in exon 1, encoding a polyglutamine tract in the transactivating domain. This repeat is involved in the rare, adult-onset neurodegenerative disorder known as spinal and bulbar muscular atrophy or Kennedy’s disease (8). Affected males often develop signs of mild androgen insensitivity like impaired spermatogenesis and gynecomastia. In spinal and bulbar muscular atrophy, there is an expansion of the number of CAGs (40–62 repeats) compared with normal (11–31 repeats), which results in longer polyglutamine tracts in the AR (9). These longer polyglutamine tracts cause neuronal cell loss through a gain-of-function mechanism involving aggregation and sequestration of proteins (10, 11).

There are indications that different repeat lengths within the normal interval confer subtle differences in androgen sensitivity. Longer tracts have been associated with reduced spermatogenesis and infertility in otherwise normal males (12), and shorter repeats are suggested to be associated with an increased risk of prostate cancer (13). Longer repeats have also been associated with genital malformations due to undermasculinization (14). In addition, the expansion of the CAG repeat results in a linear decrease in the transactivation function of the AR in vitro (15). One study found that the shorter of the two AR alleles was preferentially less methylated in hirsute women, and this was interpreted to cause hypersensitivity to androgens (16). However, skewed X-inactivation in relation to CAG repeat length could not be confirmed as a cause of hyperandrogenic symptoms in a study comprising a larger number of women (17).

We found an AR gene mutation (E653K) in two unrelated Swedish families. One family had two girls affected with CAH due to 21-OHD. Their CYP21 genotype was I172N/Q318X, but the girls showed minimal signs of prenatal virilization. The CAH girls had inherited the E653K mutation from their father. The other family had a boy with PAIS, who had inherited the AR mutation from his mother. To study whether the AR variant could have a modifying effect on CAH disease expression, a functional assay of the mutant receptor was carried out, the frequency of the mutation was investigated in the general population, and X-inactivation status was assessed in the CAH girls.

Subjects and Methods

Subjects

The pedigree of the CAH family segregating the AR variant E653K is shown in Fig. 1AGo. The father was initially selected as a normal control in AR gene studies using denaturing gradient gel electrophoresis (DGGE) in infertile men, because he is known to have fathered two children and mutations in the AR gene generally are not considered to be compatible with fertility. He did not show any signs of androgen insensitivity and denied problems with fertility. Levels of T, LH, and FSH were all within the normal range (T, 14.9 nmol/liter, ref. 6–30; LH, 2.3 IU/liter, ref. 1.0–12.0; FSH, 2.5 IU/liter, ref. 1.0–10.0). The two sisters were diagnosed with CAH because of premature pubarche and slight clitoromegaly (Prader stage 1) at 5 yr 3 months and 3 yr 4 months of age, respectively. The younger sister was born 1 yr after the Swedish neonatal screening program for CAH had been initiated. Her screening level of 17-hydroxyprogesterone (17-OHP) (126 nmol/liter) was slightly below the cut-off limit for positive samples (150 nmol/liter). The cut-off limit has since been adjusted to 75 nmol/liter, and she would thus have been diagnosed neonatally had she been born today. Serum 17-OHP at diagnosis was 404 mol/liter; T, 10.4 nmol/liter; androstenedione, 31.6 nmol/liter; and 11-desoxycortisol, 172 nmol/liter. Skeletal age at 4 yr was advanced to 8 yr 10 months, according to Greulich and Pyle (18). The elder sister was born before the screening had begun, but when the phenylketonuria filter paper blood spot was retrospectively analyzed, 17-OHP was 161 nmol/liter. Serum 17-OHP was 464 nmol/liter; T, 10.2 nmol/liter; androstenedione, 31.6 nmol/liter; and 11-desoxycortisol, 290 nmol/liter. Skeletal age at 8 yr 4 months was advanced to 12 yr, according to Greulich and Pyle (18).



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. A, Pedigree of the CAH family, showing the AR gene mutation E653K and the CYP21 mutation I172N inherited from the father and the CYP21 mutation Q318X from the mother. B, Pedigree of the PAIS family, showing the AR gene mutation E653K in the boy and his mother. N, Normal allele.

 
The pedigree of the PAIS family is shown in Fig. 1BGo. The affected boy was born with perineoscrotal hypospadias and a bifid scrotum, Quigley stage 3 (7). Testes were palpable in the scrotal folds. T was 1.1 nmol/liter at 2.5 d of age and increased to 8.0 nmol/liter 4 d after a single injection of 500 IU human CG. There was no visible effect on genitalia by the human CG injection. Stimulated DHT was 1.45 nmol/liter (regrettably, the basal value was lost). These hormonal values were all within the normal range (19). The mother and the maternal grandmother had undergone a completely normal pubertal development. After the diagnostic work-up, approximately 10 mg DHT (as a 3% creme) was applied three times daily for 2 months, then once daily for another 3 months. This resulted in an increase in penile length from 16–38 mm. The first response (reddening of prepuce and scrotum) was noted 2–3 wk after the start of therapy, which is 1–2 wk later than what is generally seen during a similar treatment of micropenis in boys with normal androgen sensitivity.

Two-hundred military conscripts of Swedish origin and 50 randomly selected healthy Swedish men were used to study the frequency of the E653K variant in the population by allele-specific PCR. Exons 2–8 were sequenced, the length of the polymorphic CAG repeat in exon 1 of the AR gene was determined, and X-inactivation status was analyzed in five additional minimally virilized girls with 21-OHD, who all had the I172N mutation in one of their CYP21 alleles and a more severe mutation in the other. The length of the CAG-repeat was determined in five additional CAH girls with comparable genotypes who were severely virilized. For CYP21 genotypes and Prader scores, see Table 1Go. The study was approved by the Ethics Committee at the Karolinska Institutet.


View this table:
[in this window]
[in a new window]
 
Table 1. AR gene CAG repeat lengths in CAH girls with minimal and severe virilization

 
Genetic analyses

Genomic DNA was prepared from peripheral leukocytes. Genetic diagnosis of the CYP21 gene was performed by allele-specific PCR as described (20). DGGE of exon 2–8 of the AR gene was performed essentially as described before (21), except for primer annealing, which was carried out for 30 sec. For sequencing of the AR gene, PCR amplifications were performed using sets of flanking intronic primers. In the CAH family, exons 1–8 were analyzed (except for a segment of exon 1 spanning nucleotides 1445–1516, a region encoding a glycine homopolymeric segment, which was difficult to amplify). Nested amplifications were performed using one normal and one biotinylated primer, the biotinylated PCR fragments were immobilized by binding to streptavidin-covered magnetic beads (Dynabeads; DynAl AS, Oslo, Norway), and the nonbiotinylated strands were removed by incubating in 50 µl of 0.15 M NaOH for 5 min at room temperature. The remaining DNA was sequenced with the AutoRead DNA Sequencing kit, using fluorescence-labeled primers and the Pharmacia A.L.F. DNA Sequencer (Pharmacia, Uppsala, Sweden). In the PAIS family and in the five unrelated minimally virilized CAH girls, exons 2–8 of the AR gene were analyzed by cyclic sequencing using the Big Dye Primer Cycle Sequencing Ready Reaction Kit and the ABI Prism310 DNA sequencer (PE Corporation, Foster City, CA). Allele-specific PCR to detect the E653K variant was performed using two reactions for each subject, each containing one mutant (AR70 mut) or wild-type (AR70 WT) specific primer, together with an upstream and a downstream primer (AR21 and AR23). PCR conditions were established to generate a short, allele-specific band in the presence of the variant, and only a long control fragment in its absence. The sequences of the primers were: AR 21 5' TGACCAGGGAGAATGGTGATT; AR 23 5'ATCCCCCTTATCTCATGCT; AR 70 WT 5'GCTTCTGGGTTGTCTCCTC; AR 70 mut 5'GCTTCTGGGTTGTCTCCTT.

The length of the CAG repeat in the AR gene was determined by PCR using primers flanking the repeat and separation of the products on the ABI Prism310 DNA sequencer (PE Corporation). X-inactivation status was assayed using methylation-sensitive restriction enzymes as described by Pegoraro et al. (22). One microgram of DNA was digested with 10 U HpaII and 10 U CfoI (Roche Molecular Biochemicals, Burlington, NC) in a 25 µl volume for 2 h. After digestion, a 5-µl aliquot of the reaction was PCR amplified with primers flanking the CAG repeat, and separation of the products was performed using an ABI Prism310 DNA sequencer (PE Corporation), as above. Digested and undigested PCR-amplified DNA samples were compared for each subject.

Construction of plasmids and site-directed mutagenesis

The human full-length androgen receptor cDNA (6) was cloned into the expression vector pCMV4. For mutagenesis, a HindIII fragment containing the 3' end of exon 2 and exons 3–8 of the AR cDNA was moved to the mutagenesis vector pALTER-1 (Promega Corp., Madison, WI) and the mutation was reconstructed by oligonucleotide-mediated site-directed mutagenesis. The resulting DNA was electroporated into a mismatch-repair defective Escherichia coli strain (BMH 71-18 mutS), plasmid DNA was purified, and the HindIII fragment containing part of the AR cDNA was reintroduced into pCMV4-AR. To verify the correct incorporation of the mutation and to exclude additional sequence aberrations, the complete pCMV4-AR(E653K) construct was sequenced.

Transient expression of recombinant human AR and assay of AR function

Approximately 1 x 106 COS-1 cells were transiently transfected by electroporation (Gene Pulser, 1250 V, 25 µF; Bio-Rad Laboratories, Inc., Hercules, CA) with 5 µg of the pCMV4-AR constructs, together with 1 µg of the ß-galactosidase vector pCH110 (Pharmacia) and 2 µg of the reporter construct pGM-CAT. pGM-CAT contains the chloramphenicol acetyl transferase (CAT) gene under the control of the mouse mammary tumor virus promoter, which contains two androgen response elements. After transfection, the cells were incubated for 24 h in DMEM containing 10% FBS and 0.02% gentamicine. Twenty-four hours after transfection, the medium was changed to contain 10% charcoal-stripped serum, and increasing concentrations of the native ligand DHT (0.01 - 10 nM) were added. As controls, cells were transfected in parallel with pCMV4 without the AR, pCH110, and pGM-CAT. Twenty-four hours after adding the ligand, the cells were washed twice in PBS, harvested, and lysed. Measurements of CAT as well as ß-galactosidase protein levels were performed using ELISA (Roche Molecular Biochemicals, Mannheim, Germany). Three independent experiments, in duplicates, were carried out. Protein concentrations were determined using the Bradford assay.

Results

Genetic analyses

When analyzed by DGGE, the father in the CAH family (Fig. 1AGo) displayed an aberrant band corresponding to exon 4 of the AR gene (Fig. 2Go). Sequencing revealed a GAG to AAG transition, resulting in glutamic acid at position 653 being replaced by lysine (E653K). This allele contained 20 CAGs in the position of the polymorphic repeat. Sequencing confirmed that his two daughters were heterozygous for this AR gene variant. No additional deviations from the normal reference sequence were found in any other exon. Assay of X-inactivation status showed that the maternal and paternal X chromosomes were methylated to comparable extents. The boy with PAIS had the same AR gene mutation, which was also found in heterozygous form in his mother and maternal grandmother. This allele also carried 20 CAGs in exon 1. The E653K variant was not present in any of the 250 control subjects analyzed by allele-specific PCR (Fig. 3Go). Sequencing of the AR gene from five additional unrelated CAH girls who had an I172N/(null or I2 splice) genotype but minimal signs of virilization did not reveal any deviations from the normal reference sequence. AR gene CAG repeat lengths were not different in the CAH girls who showed minimal signs of virilization compared with those who were born with severe genital malformations (t test; P = 0.9) (Table 1Go). There was no evidence for skewed X-inactivation that would leave the allele with the longer repeat preferentially active in the minimally virilized girls.



View larger version (93K):
[in this window]
[in a new window]
 
Figure 2. DGGE showing an abnormally migrating fragment (lane 9) in the AR gene (exon 4) of the control subject, the father in Fig. 1AGo. Lane 1, Marker; lane 2, empty lane; lanes 3–8, normal bands.

 


View larger version (33K):
[in this window]
[in a new window]
 
Figure 3. Genotyping of the E653K mutation in the AR gene by allele-specific PCR. Results from analysis of four individuals are shown. These are: 1, a normal female; 2, a normal male; 3, one of the daughters in the CAH family; and 4, the father in the CAH family. Two separate reactions were run for each individual, including a primer specific for the wild-type (WT) or the mutated (M) allele, together with an upstream and a downstream control primer. The arrow indicates the allele-specific fragment. Contr, Control fragment.

 
Assay of AR function

The ability of the wild-type AR and the E653K mutant to stimulate an androgen-responsive reporter gene in response to increasing doses of DHT was measured (Fig. 4Go). The E653K variant showed a transactivating capacity comparable to wild-type at high concentrations (1 and 10 nM) of DHT. At 0.01 nM DHT, no transactivation by the E653K variant was detected, and at 0.1 nM DHT, its degree of activation was 11% of that of the wild-type receptor. Serum reference values of DHT for newborn infants (4–8 d of age) are 0.39 ± 0.2 nmol/liter (boys) and 0.32 ± 0.1 nmol/liter (girls) (19). However, circulating levels of DHT do not necessarily reflect the local concentration of DHT that results from peripheral conversion from T, and comparisons of in vivo and in vitro concentrations are difficult.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 4. CAT transactivation assay in COS-1 cells transfected with wild-type (WT, black bars) and mutated (E653K, white bars) androgen receptor. The percentages are expressed in relation to the activity of the WT receptor at 10 nM DHT. The results are means ± SEM of three separate experiments, performed in duplicates as described in Subjects and Methods. Conc, Concentration.

 
Discussion

Although good relationships between CYP21 genotype and clinical phenotype are generally seen in CAH due to 21-OHD, a certain degree of clinical variability can be seen among patients with comparable genotypes (2, 3, 4, 5). The I172N mutation is associated with a particularly high degree of phenotypic variability, and it is likely that many factors contribute to modify the phenotypic expression of partially inactivating mutations in the CYP21 gene, including interindividual differences in various aspects of steroid metabolism. Regarding androgen insensitivity, genotype-phenotype relationships are not obvious, and it is well established that the same AR gene mutation may give rise to varying degrees of undermasculinization in different patients (23, 24, 25, 26). Recently, mutations in the AR gene that cause subtle degrees of androgen resistance have been identified, such as reduced spermatogenesis and/or gynecomastia without the genital malformations that are seen in classical AIS (27, 28). The father in the CAH family lacked all symptoms and signs considered to be markers of AIS (hypospadias, gynecomastia, elevated T and LH, and/or fertility problems). The E653K mutation is thus associated with a clinical phenotype ranging from fertile male to severe genital malformations as in PAIS. It is unknown which factors influence the phenotypic expression of this and other AR gene mutations. In both families, the AR allele carrying the E653K mutation had 20 CAGs, and the length of the repeat was thus not a modifying factor. Our in vitro data are in accordance with receptor dysfunction at low steroid concentrations but indicate that the mutant AR functions normally at higher levels of ligand. It is possible that the level or timing of androgen production during fetal life determines whether this mutant will result in impaired formation of male genitalia. This would indicate that the prognosis regarding response to exogenous androgen treatment, masculinization in puberty, and fertility in the boy with PAIS and the E653K mutation is favorable. Another possibility is that the mutation causes a reduction in stable mRNA, although Western blotting indicated that AR expression was not affected. The in vivo observation that our patient with PAIS showed a clear response in penile growth during 3 months of local application of very high concentrations of DHT points in the same direction as the in vitro results on cells transfected with the E653K mutation. During this treatment, DHT blood levels reached 50 nmol/liter, which is more than 10 times higher than in normal adult males.

The E653K mutation is located in the hinge region of the AR, an area of low conservation between members of the steroid hormone receptor subfamily, between the DNA- and steroid-binding domains (amino acids 628–670). Only two missense mutations, A645D and I664N, have previously been detected in this region of the receptor. Both were found in patients with PAIS (29, 30). Mutation A645D was also identified in a phenotypically normal 15-yr-old boy (31). However, because of the young age of the latter subject, it remains to be seen whether he will be normal with respect to fertility. The fact that two AR gene mutations, A645D and E653K, both were found in subjects with normal phenotypes, indicates that this is a region of the AR with minor influence on the function of the receptor, in which missense mutations have effect in susceptible individuals only. We did not find the E653K mutation when studying an additional 250 men, and it does thus not represent a normal polymorphism in the Swedish population.

Female carriers of AR mutations generally do not have symptoms or signs of androgen insensitivity, due to the presence of two X chromosomes. However, some carriers show patches of scarce pubic hair and they may have slightly delayed pubertal development, which is assumed to be related to skewed X-inactivation (7). Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen receptor gene correlates with X-chromosome inactivation (32). Using this, one study found that the shorter of the two AR alleles was preferentially less methylated in hirsute women, and this was interpreted to cause hypersensitivity to androgens (16). However, skewed X-inactivation as a cause of hyperandrogenic symptoms could not be confirmed in a study comprising a larger number of women (17). We found no significant difference in CAG repeat lengths between CAH girls with minimal or severe virilization, and we could not demonstrate skewed X-inactivation in our CAH girls with the AR gene mutation or in the other five girls who were minimally virilized.

To our knowledge, ours is the first family described who has a combination of mutations in two genes that each is involved in a monogenic disorder of steroid metabolism and sexual development. However, we have not been able to prove that the AR gene mutation modifies the CAH phenotype in the two sisters. We did not find any additional aberrations when sequencing the AR gene from another five unrelated CAH girls with mild androgenic symptoms. Thus, AR gene mutations or polymorphisms do not seem to be a common factor influencing the degree of androgen-dependent symptoms and signs displayed by girls affected with CAH.

Acknowledgments

We gratefully acknowledge Prof. M. G. Forest for the analysis of DHT in serum.

Footnotes

This study was supported by grants from the Swedish Medical Research Council (project no. 12198), the Fredrik and Ingrid Thuring Foundation, the Harald and Greta Jeansson Foundation, the Novo Nordisk Foundation, the Magnus Bergvall Foundation, the Emil and Vera Cornell Foundation, the Sven and Ebba-Christina Hagberg Foundation, and the Ronald McDonald Pediatric Fund.

Abbreviations: 17-OHP, 17-hydroxyprogesterone; 21-OHD, 21-hydroxylase deficiency; AIS, androgen insensitivity syndrome; AR, androgen receptor; CAH, congenital adrenal hyperplasia; CAT, chloramphenicol acetyl transferase; DGGE, denaturing gradient gel electrophoresis; DHT, dihydrotestosterone; PAIS, partial AIS.

Received September 10, 2001.

Accepted January 16, 2002.

References

  1. New MI 1987 Basic and clinical aspects of congenital adrenal hyperplasia. J Steroid Biochem 27:1–7
  2. Wedell A, Thilén A, Ritzén EM, Stengler B, Luthman H 1994 Mutational spectrum of the steroid 21-hydroxylase gene in Sweden: implications for genetic diagnosis and association with disease manifestation. J Clin Endocrinol Metab 78:1145–1152[Abstract]
  3. Wilson RC, Mercado AB, Cheng KC, New MI 1995 Steroid 21-hydroxylase deficiency: genotype may not predict phenotype. J Clin Endocrinol Metab 80:2322–2329[Abstract]
  4. Jääskeläinen J, Levo A, Voutilainen R, Partanen J 1997 Population-wide evaluation of disease manifestation in relation to molecular genotype in steroid 21-hydroxylase (CYP21) deficiency: good correlation in a well defined population. J Clin Endocrinol Metab 82:3293–3297[Abstract/Free Full Text]
  5. Krone N, Braun A, Roscher AA, Knorr D, Schwarz HP 2000 Predicting phenotype in steroid 21-hydroxylase deficiency? Comprehensive genotyping in 155 unrelated, well defined patients from southern Germany. J Clin Endocrinol Metab 85:1059–1065[Abstract/Free Full Text]
  6. Chang C, Kokontis J, Liao S 1988 Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc Natl Acad Sci USA 85:7211–7215[Abstract/Free Full Text]
  7. Quigley CA, De Bellis A, Marschke KB, El-Awady MK, Wilson EM, French FS 1995 Androgen receptor defects: historical, clinical, and molecular perspectives. Endocr Rev 16:271–321[CrossRef][Medline]
  8. La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH 1991 Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 352:77–79[CrossRef][Medline]
  9. Edwards A, Hammond HA, Jin L, Caskey CT, Chakraborty R 1992 Genetic variation at five trimeric and tetrameric tandem repeat loci in four human population groups. Genomics 12:241–253[CrossRef][Medline]
  10. Merry DE, Kobayashi Y, Bailey CK, Taye AA, Fischbeck KH 1998 Cleavage, aggregation and toxicity of the expanded androgen receptor in spinal and bulbar muscular atrophy. Hum Mol Genet 7:693–701[Abstract/Free Full Text]
  11. Stenoien DL, Cummings CJ, Adams HP, Mancini MG, Patel K, DeMartino GN, Marcelli M, Weigel NL, Mancini MA 1999 Polyglutamine-expanded androgen receptors form aggregates that sequester heat shock proteins, proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone. Hum Mol Genet 8:731–741[Abstract/Free Full Text]
  12. Tut TG, Ghadessy FJ, Trifiro MA, Pinsky L, Yong EL 1997 Long polyglutamine tracts in the androgen receptor are associated with reduced trans-activation, impaired sperm production and male infertility. J Clin Endocrinol Metab 82:3777–3782[Abstract/Free Full Text]
  13. Stanford JL, Just JJ, Gibbs M, Wicklund KG, Neal CL, Blumenstein BA, Ostrander EA 1997 Polymorphic repeats in the androgen receptor gene: molecular markers of prostate cancer risk. Cancer Res 57:1194–1198[Abstract/Free Full Text]
  14. Lim HN, Chen H, McBride S, Dunning AM, Nixon RM, Hughes IA, Hawkins JR 2000 Longer polyglutamine tracts in the androgen receptor are associated with moderate to severe undermasculinized genitalia in XY males. Hum Mol Genet 9:829–834[Abstract/Free Full Text]
  15. Chamberlain NL, Driver ED, Miesfield RL 1994 The length and location of CAG trinucleotide repeats in the androgen receptor N terminal domain affect transactivation function. Nucleic Acids Res 22:3181–3186[Abstract/Free Full Text]
  16. Vottero A, Stratakis CA, Ghizzoni L, Longui CA, Karl M, Chrousos GP 1999 Androgen receptor-mediated hypersensitivity to androgens in women with nonhyperandrogenic hirsutism: skewing of X-chromosome inactivation. J Clin Endocrinol Metab 84:1091–1095[Abstract/Free Full Text]
  17. Calvo RM, Asunción M, Sancho J, San Millán JL, Escobar-Morreale HF 2000 The role of the CAG repeat polymorphism in the androgen receptor gene and of skewed X-chromosome inactivation, in the pathogenesis of hirsutism. J Clin Endocrinol Metab 85:1735–1740[Abstract/Free Full Text]
  18. Greulich WW, Pyle SI 1966 Radiographic atlas of skeletal development of the hand and wrist. Stanford, CA: Stanford University Press
  19. Forest MG, Ducharme JR 1993 Gonadotropic and gonadal hormones. In: Bertrand J, Rappaport R, Sizonenko PC, eds. Pediatric endocrinology, 2nd ed. Baltimore: Williams & Wilkins; 100–134
  20. Wedell A, Luthman H 1993 Steroid 21-hydroxylase deficiency: two additional mutations in salt-wasting disease and rapid screening of disease-causing mutations. Hum Mol Genet 2:499–504[Abstract/Free Full Text]
  21. Nordenskjöld A, Friedman E, Tapper-Persson M, Soderhall C, Leviav A, Svensson J, Anvret M 1999 Screening for mutations in candidate genes for hypospadias. Urol Res 27:49–55[CrossRef][Medline]
  22. Pegoraro E, Schimke RN, Arahata K, Hayashi Y, Stern H, Marks H, Glasberg MR, Carroll JE, Taber JW, Wessel HB, Bauserman SC, Marks WA, Toriello HV, Higgins JV, Appleton S, Schwartz L, Garcia CA, Hoffman EP 1994 Detection of new paternal dystrophin gene mutations in isolated cases of dystrophinopathy in females. Am J Hum Genet 54:989–1003[Medline]
  23. Batch JA, Davies HR, Evans BAJ, Hughes IA, Patterson MN 1993 Phenotypic variation and detection of carrier status in the partial androgen insensitivity syndrome. Arch Dis Child 68:453–457[Abstract]
  24. Rodien P, Mebarki F, Mowszowicz I, Chaussain JL, Young J, Morel Y, Schaison G 1996 Different phenotypes in a family with androgen insensitivity caused by the same M780I point mutation in the androgen receptor gene. J Clin Endocrinol Metab 81:2994–2998[Abstract]
  25. Evans BAJ, Hughes IA, Bevan CL, Patterson MN, Gregory JW 1997 Phenotypic diversity in siblings with partial androgen insensitivity syndrome. Arch Dis Child 76:529–531[Abstract/Free Full Text]
  26. Holterhus PM, Sinnecker GH, Hiort O 2000 Phenotypic diversity and testosterone-induced normalization of mutant L712F androgen receptor function in a kindred with androgen insensitivity. J Clin Endocrinol Metab 85:3245–3250[Abstract/Free Full Text]
  27. Ghadessy FJ, Lim J, Abdullah AA, Panet-Raymond V, Choo CK, Lumbroso R, Tut TG, Gottlieb B, Pinsky L, Trifiro MA, Yong EL 1999 Oligospermic infertility associated with an androgen receptor mutation that disrupts interdomain and coactivator (TIF2) interactions. J Clin Invest 103:1517–1525[Medline]
  28. Giwercman A, Kledal T, Schwartz M, Lundberg Giwercman Y, Leffers H, Zazzi H, Wedell A, Skakkebaek NE 2000 Preserved male fertility despite decreased androgen sensitivity due to a mutation in the ligand binding domain of androgen receptor. J Clin Endocrinol Metab 85:2253–2259[Abstract/Free Full Text]
  29. Hiort O, Sinnecker GHG, Holterhus P-M, Nitsche EM, Kruse K 1996 The clinical and molecular spectrum of androgen insensitivity syndrome. Am J Med Genet 63:218–222[CrossRef][Medline]
  30. Pinsky L, Trifiro M, Kaufman M, Beitel LK, Mhatre A, Kazemi-Esfarjani P, Sabbaghian N, Lumbroso R, Alvarado C, Vasiliou M 1992 Androgen resistance due to mutation of the androgen receptor. Clin Invest Med 15:456–472[Medline]
  31. Nordenskjöld A, Söderhäll S 1998 An androgen receptor gene mutation (A645D) in a boy with a normal phenotype. Hum Mutat 11:339[Medline]
  32. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW 1992 Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X-chromosome inactivation. Am J Hum Genet 51:1229–1239[Medline]



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
M. G. Forest
Recent advances in the diagnosis and management of congenital adrenal hyperplasia due to 21-hydroxylase deficiency
Hum. Reprod. Update, November 1, 2004; 10(6): 469 - 485.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giwercman, Y. L.
Right arrow Articles by Wedell, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giwercman, Y. L.
Right arrow Articles by Wedell, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals