| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
The Impact of the Human Genome on Endocrinology: Original Articles |
Institute of Endocrine Sciences, University of Milan, Istituto Auxologico Italiano Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS) (L.A., L.P.) and Ospedale Maggiore IRCCS (R.R., P.B.-P.), 20145 Milan, Italy; Department of Pediatrics (M.C.P., B.B., M.C.V., G.W., G.C.), Scientific Institute H.S. Raffaele, 20132 Milan, Italy; and Institut de Recherche Interdisciplinaire (S.C.), University of Brussels, B-1070 Brussels, Belgium
Address all correspondence and requests for reprints to: Luca Persani, M.D., Ph.D., Institute of Endocrine Sciences, University of Milan, Istituto di Ricovero e Cura a Carattere Scientifico Istituto Auxologico Italiano, Via Ariosto 13, 20145 Milan, Italy. E-mail: . luca.persani{at}unimi.it
Abstract
Germline loss-of-function mutations of TSH receptor (TSHR) gene have been described in families with partial or complete TSH resistance. Large TSH elevations were generally found in the patients with homozygous or compound heterozygous mutations. In this study, we sequenced the entire TSHR gene in a series of 10 unrelated patients with slight (6.614.9 mU/liter) to moderate (2446 mU/liter) elevations of serum TSH, associated with definitely normal free thyroid hormone concentrations. Thyroid volume was normal in all patients, except two with a modest hypoplasia. Autoimmune thyroid disease was excluded in all patients on the basis of clinical and biochemical parameters. Eight patients had at least one first-degree relative bearing the same biochemical picture. TSHR mutations were detected in 4 of 10 cases by analyzing DNA from peripheral leukocytes. A compound heterozygosity (P162A on maternal allele, and the novel mutation C600R on the paternal one) was found in the patient with the highest TSH levels. Only one TSHR allele was mutated in the remaining three cases, and no alterations in TSHR gene promoter were detected in all of these probands. A novel mutation (L467P) was detected on the maternal allele in one patient and in her monozygotic twin. Previously described inactive mutants, T655
and C41S, were detected in the other two cases. When tested on several occasions, circulating TSH values fluctuating above the upper limit of the normal range could be shown in heterozygous subjects of these families. A dominant mode of inheritance of the biochemical alterations was detected in these cases. Mutant TSHRs were studied during transient expression in COS7 and HEK293T cells. Their TSH-independent cAMP accumulation activities were very low or similar to mock-transfected cells, and no increases were seen after maximal hormone stimulation. Flow cytometry experiments showed a poor level of expression of all mutant TSHRs at the cell membrane. In conclusion, we found several loss-of-function mutations of TSHR, including two novel ones, in a series of unrelated patients with slightly elevated TSH levels. Therefore, partial resistance to TSH action is a frequent finding among patients with slight hyperthyrotropinemia of nonautoimmune origin. Germline mutations of TSHR may be associated with serum TSH values fluctuating above the upper limit of the normal range, also in the heterozygous state.
GERMLINE LOSS-OF-FUNCTION MUTATIONS of TSH receptor (TSHR) gene have been described in the case of partial or complete TSH resistance (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). This condition encompasses a wide spectrum of biochemical, as well as clinical and morphological alterations depending on the degree of impairment of TSHR function. Accordingly, patients with complete or severe refractoriness to TSH action have profound thyroid gland hypoplasia and low thyroid hormone levels, despite large elevations of circulating TSH levels (6, 7, 8, 9, 10). On the other hand, in partial resistance the elevated concentrations of serum TSH allow an almost normal thyroid gland development (small/normal thyroid size) and the production of normal free thyroid hormone circulating levels (3, 4, 5, 11, 12).
TSH resistance due to loss-of-function mutations of TSHR has been described so far in a dozen families (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). All of the probands had moderate to large elevations of circulating TSH in the absence of antithyroid autoantibodies, and they were found to harbor compound heterozygous or homozygous TSHR mutations. Interestingly, the relatives with heterozygous TSHR mutations have seldom been reported with slight elevations of serum TSH concentrations (3, 11, 12), suggesting the possibility to investigate TSHR gene among patients with borderline biochemical alteration such as that typically found in subclinical hypothyroidism.
Subclinical hypothyroidism identifies a condition biochemically characterized by the association of normal free thyroid hormone levels and slight hyperthyrotropinemia (13). It represents the most frequent alteration of thyroid function and is often due to autoimmune disease (14). In these cases, subclinical hypothyroidism is considered a transitory condition in the evolution of autoimmune disease toward clinically overt hypothyroidism (13). Nevertheless, the origin of slight TSH elevations remains obscure in a subset of these patients, in particular among those not evolving in overt disease.
In the present study, we examined TSHR gene in a series of unrelated patients with slight to moderate elevations of circulating TSH and normal free thyroid hormone levels, in whom the diagnosis of autoimmune thyroid disease had been excluded, to evaluate the involvement of germline loss-of-function mutations of TSHR in the pathogenesis of slight hyperthyrotropinemia.
Patients and Methods
Patients
We studied 10 subjects with neonatal to juvenile evidence of hyperthyrotropinemia (Table 1
). Results of neonatal TSH screening on dry blood spot were above the normal range in three of five cases. All subjects were originating from distinct families. Patient HF has a monozygotic twin sister with an identical biochemical picture (Table 2
). Free thyroid hormones (FT4 and FT3) were clearly within the normal range in all cases. The presence of autoimmune thyroid disease was excluded on the basis of the absence of antithyroperoxidase, anti-Tg, and anti-TSHR autoantibodies and confirmed by the absence of hypoechoic lesions at thyroid ultrasound (15). In all cases, parathyroid function was normal, and TSH response to TRH iv injection (200 µg in adults or 7.0 µg/kg body weight in infants) was exaggerated. Serial dilutions of TSH immunoreactivity (1:2.5, 1:5, and 1:10) were performed in most cases (PG, LC, FD, FV, BL, and HF, including several relatives of the last two cases) and were always parallel to the standard curve (data not shown). Circulating TSH was also immunoextracted from sera of patients BL and HF, and the biological activity of immunopurified material was tested in a homologous bioassay, as previously described (16). The biological/immunological activities ratio of immunopurified TSH was normal (0.87 ± 0.05 and 1.34 ± 0.07 in cases BL and HF, respectively; normal values, 0.62.2). Thyroid ultrasound revealed the presence of normal thyroid volume and structure in eight cases; only modest hypoplasia was seen in the cases with the highest TSH concentrations. Scintiscan did not reveal any thyroid ectopy. Slight impairment of 99mTc uptake was reported in only one case (HF). Eight patients had at least one first-degree relative with slightly elevated TSH (Tables 1
and 2
). Informed consent to the study was obtained from all subjects.
|
|
Serum TSH concentrations were measured by commercial immunometric assay using Delfia technology (Wallac, Inc., Turku, Finland), with a sensitivity of 0.01 mU/liter, and inter- or intra-assay coefficient of variation less than 5%. Serum concentrations of free thyroid hormones were measured by commercial back-titration fluoroimmunoassay (Delfia, Wallac, Inc.). Antithyroperoxidase, anti-Tg, and anti-TSHR autoantibodies were evaluated by commercial kits (Brahms Diagnostica, Berlin, Germany).
DNA analyses
DNA was extracted from peripheral blood using a commercial kit (Nucleon BACC2, Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK) according to the manufacturers instructions. The whole length of exon 10 was sequenced using 5 overlapping fragments amplified by PCR as previously described (17), and the fragments containing exons 1 to 9 and the promoter region were obtained using specific primers (18, 19). All purified PCR fragments were directly sequenced with either forward or reverse primers using the Big Dye Terminator kit and resolved by capillary electrophoresis on ABI 310 Automated Sequencer (PE Biosystems, Foster City, CA). The sequences of the mutated fragment were repeated at least twice from two different PCR products.
Cloning and mutagenesis of TSHR
cDNA encoding the human TSHR was obtained by RT-PCR from a normal thyroid tissue using the following primers: 1F, 5'-GAGGATGGAGAAATAGCCCCGAG-3'; and 10R, 5'-GTGTCATGGGATTGGAAT-3' (18); and it was cloned into the polylinker of the eukariotic expression vector pTARGET (Promega Corp., Madison, WI). The wild-type (WT) insert was entirely sequenced.
The substitutions observed in this study were introduced by site-directed mutagenesis using the GeneEditor in vitro site-directed mutagenesis system (Promega Corp.) and the following primers, where bold indicates the introduced mutation: TTCAGAGTCACCTCCAAGGATATTCAA (C41S), GGGATGTACCCGCTCCTCATCGC (L467P), GTCTGCTGCCGTTATGTGAAG (C600R), AAGCCTCTCATCTGTTAGCAACTCC (T655
). Full-length TSHR clones carrying the appropriate mutations were entirely sequenced.
Cell culture and transient transfection
COS7 cells and HEK293T cells were grown in DMEM (Life Technologies, Inc., Italia, San Giuliano Milanese, Italy) containing 10% FCS and an ampicillin-streptomycin mixture. For transient transfection, cells were seeded at the density of 300,000 cells per 3-cm dish in complete medium. After 24 h, cells were transfected; diethylaminoethyl-dextran method followed by a dimethylsulfoxide shock was used for COS7 cells (20), and calcium phosphate method was used for HEK293T cells (21). Cells were then grown in DMEM 10% FCS for 48 h before cAMP determinations or flow cytometry analysis.
Flow cytometry analysis
Flow cytometry experiments were performed using intact or permeabilized COS7 cells as previously described (22). For permeabilization, cells were kept on ice for 10 min in PBS-paraformaldehyde 2%, washed once with PBS-BSA 0.1%, and treated with 2% saponine at room temperature for 30 min. Both permeabilized and unpermeabilized cells were labeled with 3G4 monoclonal antibody recognizing a linear epitope and BA8 antibody against a conformational epitope. Both epitopes are located within TSHR ectodomain (22, 23).
Determination of cAMP production
COS7 or HEK293T transfected cells were washed with isotonic Krebs-Ringer-HEPES buffer (pH 7.4); 0.5 mM 3-isobutyl-1-methylxanthine, 0.5% BSA, and were incubated at 37 C, 5%CO2 in this same buffer supplemented or not with increasing concentrations of bovine TSH (bTSH; Sigma-Aldrich Corp. srl, Milan, Italy). The medium was removed after 1 h, and 0.1 N HCl was added. The samples were dried, and the cAMP concentration was measured by RIA (RIANEN, NEN Life Science Products Inc., Boston, MA). The results are expressed in picomoles per dish.
Results
Identification of mutations in the THSR gene
The automated sequencing revealed the presence of the following substitutions. The case BL showed two missense mutations: one at the codon 162 in exon 6, P162A, previously described as inactivating mutation (3, 24), and a never-described T to C substitution at the codon 600 in exon 10 (Fig. 1
). This mutation causes the substitution cysteine to arginine in the fifth transmembrane (TM5) segment. Further studies of maternal and paternal TSHR genes identified the mother and the brother as heterozygous carriers of the P162A mutation and the father as carrier of the C600R mutation (Table 2
).
|
The propositus LC showed a simple heterozygous two-base deletion (AC) at codon 655 (T655
). This already described mutation (8) causes the formation of a premature stop codon at 656 and the production of a truncated protein lacking the last TM7 domain and the C-terminal tail (Fig. 1
).
The last well characterized (25) inactivating mutation was found in the TSHR extracellular domain of the propositus FD. It consists in a G to C change at codon 41 in exon 1 leading to a cysteine to serine substitution on the paternal allele (Fig. 1
).
In all of these cases, we could not detect other mutation in the coding sequence or in the intron-exon boundaries of the TSHR gene. The already known silent polymorphism at codon 52 (26) was detected in the heterozygous state in 2 of 10 cases (BL and IA). The TSHR promoter region was also sequenced without finding any alteration, except the polymorphic nucleotide at position -445 (G to T) (19) that was found in the heterozygous state in cases HF, BL, and FD.
Biochemical evaluations in families with TSHR mutations
Results of TSHR gene analysis, as well as basal TSH concentrations and peak TSH values after TRH injection in available members of the families with TSHR mutations are shown in Table 2
. Several members of these families could be tested on several occasions. Circulating TSH values fluctuating above the upper limit of the normal range, as well as exaggerated TSH responses to TRH, are associated with the presence of TSHR mutations in these families.
Serum concentrations of FT4 and FT3 increased normally in three patients after the stimulation of endogenous TSH during TRH test (Table 2
). Patient BL, all affected members of case HF, as well as patient LC had been receiving L-T4 treatment and normalized their TSH secretion (0.92.8 mU/liter) during standard replacement doses (1.21.5 µg/kg·d in adults, 3.4 in twins HF, and 7.7 in infant LC).
Flow cytometry analysis
The results of these analyses are illustrated in the two panels of Fig. 2
. As demonstrated by the results obtained in permeabilized cells and shown in the lower part of each panel, all mutant and WT receptor proteins are translated to a similar level. Nevertheless, all mutants display a poor presence on the surface of intact cells: 20, 18, and 5% vs. WT for L467P-, C600R-, and T655
-TSHR, respectively, using BA8 antibody (Fig. 2A
). These values were similar using 3G4 antibody: 27 and 14% vs. WT for L467P- and C600R-TSHR, respectively (Fig. 2B
). The C41S-TSHR mutant is not present on the cell membrane (Fig. 2B
).
|
When overexpressed in COS-7 or in HEK293T cells, the construct carrying the WT-TSHR displays an increased cAMP production in the absence of agonist compared with that of vector alone. In contrast, TSHR-characteristic constitutive activity is dramatically reduced or completely lost in the presence of mutant receptor constructs (Fig. 3
).
|
|
|
We screened a series of 10 unrelated patients with slight to moderate serum TSH elevations of nonautoimmune origin for the possible involvement of germline mutations in TSHR gene. Direct sequencing of the entire coding sequence and all intron-exon boundaries led to the identification of five different mutations of TSHR gene in the constitutive DNA of 4 of 10 subjects. Three of these mutations had been previously reported as inactivating mutations in familial settings of TSH resistance (3, 4, 8, 12). Two novel substitutions (C600R and L467P) leading to the synthesis of TSHR inactive mutants are described in the present article. The patient (BL) with the highest TSH concentrations (31.546.0 mU/liter) had the classic phenotype of partial TSH resistance in the presence of a compound heterozygosity of TSHR gene (P162A/C600R). Variable TSH levels with occasional elevations above the upper limit of the normal range were documented in his heterozygous relatives. Heterozygous mutations of TSHR gene were detected in the other three probands with slight hyperthyrotropinemia. Therefore, the most striking findings of this work are: 1) the frequent involvement of TSHR gene mutations in subjects with neonatal to juvenile evidence of nonautoimmune hyperthyrotropinemia, and 2) the slight and variable biochemical alteration in subjects heterozygous for inactivating mutations of TSHR gene.
All of the mutations reported in this study are impairing TSHR functional activity. The mutation P162A was functionally tested in the original article of Sunthornthepvarakul et al. (3) and further characterized more recently (24). This mutant receptor retains 10% of the activity of WT TSHR. The mutation C41S was originally produced by experimental mutagenesis (25) and was later found to be harbored by one patient with partial TSH resistance (4). The AC deletion at codon 655, followed by the creation of a stop codon at position 656 (T655
-TSHR) was originally described in one case of complete TSH resistance (8). Due to the large C-terminal deletion, the functional activity of this mutant receptor had not been tested in vitro. We further studied the biological characteristics of these two latter mutant receptors and functionally characterized the two novel mutants, L467P and C600R. The basal constitutive activity of WT-TSHR is largely lost in the case of all mutants, because their ligand-independent activity is similar to (for C41S- and T655
-TSHR) or slightly above (for L467P- or C600R-TSHR) that observed in mock-transfected cells. In both in vitro systems, no cAMP increase was seen after stimulation with bTSH 10 mU/ml. Molecular explanation for the complete refractoriness of cells transfected with all four TSHR mutants is given by the experiments of flow cytometry showing that C41S-TSHR and T655
-TSHR are very poorly, if not at all, expressed at the surface of intact cells, and the membrane targeting of C600R-TSHR and L467P-TSHR is severely impaired. If this result could be expected in the case of T655
(8), this same result in the case of C41S is more surprising, but consistent with the complete absence of ligand binding (25) and very recent studies demonstrating that C41 is a key residue for receptor expression (27). Substitution at C41 causes a severe alteration of TSHR folding, leading to the complete entrapment of mutant receptor in the intracellular compartments. C600 and L467 are located in TM5 and TM2, respectively. Previous studies have demonstrated the relevance of TM5 for signal transduction (28), and present results indicate that C600 is a relevant residue for correct folding of this domain and membrane targeting of the receptor. Substitution of T477 at the extracellular end of TM2 was reported to severely impair cell surface expression of the mutant receptor (10). A poor routing to the cell membrane was also seen in the case of L467P mutant, the introduction of this proline causing the breaking of TM2
-helix.
Several factors may have contributed to the high prevalence of TSHR mutations in this series. Subjects were indeed selected on the basis of young age and after careful exclusion of thyroid autoimmune disease. Moreover, familiarity for hyperthyrotropinemia was documented in 8 of 10 cases. Slight hyperthyrotropinemia was inherited in a dominant manner, and cosegregation with a single mutated TSHR allele was evident at least in families HF and FD. Furthermore, heterozygous relatives of case BL had borderline high TSH concentrations, as previously reported in other familial settings of TSH resistance (3, 11, 12). The lack of major deletions at TSHR gene locus involving one of the two alleles can be ruled out by the heterozygosity state of all reported substitutions. Moreover, expression of both maternal and paternal TSHR alleles was documented in family HF by taking advantage of illegitimate gene transcription in peripheral leukocytes. TSHR gene promoter was sequenced in the probands without finding any alteration except the previously described polymorphism at nucleotide -445 (19) in the heterozygous state in 3 of 4 cases. Involvement of parental imprinting can be excluded because the biochemical alteration in our probands was inherited from either the father (case FD) or the mother (case HF). Possible interference in TSH immunoassay, as well as alterations of TSH post-translational processing and bioactivity had been excluded. Therefore, molecular mechanisms underlying these surprising findings are presently unknown and could involve haploinsufficiency or dominant negative influence of mutant receptors on WT receptor functions. Interestingly, entrapment in intracellular compartments and poor routing to the cell membrane were documented by flow cytometry for all reported mutants. Further studies are needed to clarify whether intracellular routing of translated WT-TSHRs might also be affected in these conditions leading to an impaired cell surface expression. Whatever the mechanism involved, TSH fluctuations above the upper limit of the normal range do not appear to be age-dependent in these families, because normal TSH values were found in patient FD when he was 8 months old (TSH, 3.9 mU/liter) and in his father (2.2 mU/liter) at the age of 38 yr. It is conceivable that changes in endogenous or environmental factors, of an entity that may lead to only minimal modifications of TSH secretion in normal conditions, may instead cause larger TSH variations in subjects with TSHR defects.
Several other mechanisms may be considered in the families with normal TSHR gene sequence. Because all the cases had similar phenotypes, these may include defects at different gene levels possibly leading to an impaired TSHR gene transcription or, more generally, to an impaired positive signaling in thyroid cells (19).
TSHR gene has been defined as highly mutable (29), and gain-of-function mutations of TSHR represent the major cause of toxic nodular goiters (1, 17, 20, 22). Our data are consistent with the idea that inactivating mutations of TSHR can account for several cases of nonautoimmune subclinical hypothyroidism, in particular those arising in familial settings. Some of these cases can be detected at neonatal TSH screening and are therefore treated lifelong because hyperthyrotropinemia is not transitory. Nevertheless, serum TSH elevations were revealed beyond infancy in several subjects that were clinically euthyroid and in whom TSH testing was performed because they were first-degree relatives of an index case or for nonspecific reasons, such as abnormal weight gain. Although treatment is prudentially advocated at present, it is tempting to question whether L-T4 may be required in these cases, because the elevation of circulating TSH would represent the compensatory mechanism allowing gland development and the maintenance of a normal thyroid hormone secretion in the presence of partial refractoriness to TSH action. Of note, hypothalamus and pituitary are responding adequately during L-T4 replacement in these patients. Further studies and longer follow-up of such patients are needed to give an evidence-based answer to this question.
Acknowledgments
We are indebted to Dr. G. Garofalo (V. Cervello Hospital, Palermo, Italy) for referring the case FV and to Mrs. E. Giammona for her skillful technical assistance.
Footnotes
This work was partially supported by Progetto di Ricerca Corrente Grants 05C632 and 05C901 of Istituto di Ricovero e Cura a Carattere Scientifico Istituto Auxologico Italiano, Milan, Italy; and Progetto Grant MM06263471 of Ministero dellUniversità e della Ricerca Scientifica e Tecnologica, Rome, Italy.
Abbreviations: bTSH, Bovine TSH; FT3, free T3; FT4, free T4; TM5, fifth transmembrane; TSHR, TSH receptor; WT, wild-type.
Received September 26, 2001.
Accepted January 29, 2002.
References
genes as a cause of toxic thyroid adenomas. J Clin Endocrinol Metab 82:26952701This article has been cited by other articles:
![]() |
A. Rapa, A. Monzani, S. Moia, D. Vivenza, S. Bellone, A. Petri, F. Teofoli, A. Cassio, G. Cesaretti, A. Corrias, et al. Subclinical Hypothyroidism in Children and Adolescents: A Wide Range of Clinical, Biochemical, and Genetic Factors Involved J. Clin. Endocrinol. Metab., July 1, 2009; 94(7): 2414 - 2420. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tenenbaum-Rakover, H. Grasberger, S. Mamanasiri, U. Ringkananont, L. Montanelli, M. S. Barkoff, A. M.-H. Dahood, and S. Refetoff Loss-of-Function Mutations in the Thyrotropin Receptor Gene as a Major Determinant of Hyperthyrotropinemia in a Consanguineous Community J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1706 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Narumi, K. Muroya, Y. Abe, M. Yasui, Y. Asakura, M. Adachi, and T. Hasegawa TSHR Mutations as a Cause of Congenital Hypothyroidism in Japan: A Population-Based Genetic Epidemiology Study J. Clin. Endocrinol. Metab., April 1, 2009; 94(4): 1317 - 1323. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wasniewska, M. Salerno, A. Cassio, A. Corrias, T. Aversa, G. Zirilli, D. Capalbo, M. Bal, A. Mussa, and F. De Luca Prospective evaluation of the natural course of idiopathic subclinical hypothyroidism in childhood and adolescence Eur. J. Endocrinol., March 1, 2009; 160(3): 417 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sura-Trueba, C. Aumas, A. Carre, S. Durif, J. Leger, M. Polak, and N. de Roux An Inactivating Mutation within the First Extracellular Loop of the Thyrotropin Receptor Impedes Normal Posttranslational Maturation of the Extracellular Domain Endocrinology, February 1, 2009; 150(2): 1043 - 1050. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Biondi and D. S. Cooper The Clinical Significance of Subclinical Thyroid Dysfunction Endocr. Rev., February 1, 2008; 29(1): 76 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Domene, P. A. Scaglia, A. Lteif, F. H. Mahmud, S. Kirmani, J. Frystyk, P. Bedecarras, M. Gutierrez, and H. G. Jasper Phenotypic Effects of Null and Haploinsufficiency of Acid-Labile Subunit in a Family with Two Novel IGFALS Gene Mutations J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4444 - 4450. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. V. Bogatcheva, A. Ferlin, S. Feng, A. Truong, L. Gianesello, C. Foresta, and A. I. Agoulnik T222P mutation of the insulin-like 3 hormone receptor LGR8 is associated with testicular maldescent and hinders receptor expression on the cell surface membrane Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E138 - E144. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Calebiro, T. de Filippis, S. Lucchi, F. Martinez, P. Porazzi, R. Trivellato, M. Locati, P. Beck-Peccoz, and L. Persani Selective Modulation of Protein Kinase A I and II Reveals Distinct Roles in Thyroid Cell Gene Expression and Growth Mol. Endocrinol., December 1, 2006; 20(12): 3196 - 3211. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Amendola, P. De Luca, P. E. Macchia, D. Terracciano, A. Rosica, G. Chiappetta, S. Kimura, A. Mansouri, A. Affuso, C. Arra, et al. A Mouse Model Demonstrates a Multigenic Origin of Congenital Hypothyroidism Endocrinology, December 1, 2005; 146(12): 5038 - 5047. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Calebiro, T. de Filippis, S. Lucchi, C. Covino, S. Panigone, P. Beck-Peccoz, D. Dunlap, and L. Persani Intracellular entrapment of wild-type TSH receptor by oligomerization with mutants linked to dominant TSH resistance Hum. Mol. Genet., October 15, 2005; 14(20): 2991 - 3002. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wartofsky and R. A Dickey The Evidence for a Narrower Thyrotropin Reference Range Is Compelling J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5483 - 5488. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Surks, G. Goswami, and G. H. Daniels The Thyrotropin Reference Range Should Remain Unchanged J. Clin. Endocrinol. Metab., September 1, 2005; 90(9): 5489 - 5496. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Grasberger, A. Mimouni-Bloch, M.-C. Vantyghem, G. van Vliet, M. Abramowicz, D. L. Metzger, H. Abdullatif, C. Rydlewski, P. E. Macchia, N. H. Scherberg, et al. Autosomal Dominant Resistance to Thyrotropin as a Distinct Entity in Five Multigenerational Kindreds: Clinical Characterization and Exclusion of Candidate Loci J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4025 - 4034. [Abstract] [Full Text] [PDF] |
||||
![]() |
S M Park and V K K Chatterjee Genetics of congenital hypothyroidism J. Med. Genet., May 1, 2005; 42(5): 379 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tonacchera, A. Perri, G. De Marco, P. Agretti, M. E. Banco, C. Di Cosmo, L. Grasso, P. Vitti, L. Chiovato, and A. Pinchera Low Prevalence of Thyrotropin Receptor Mutations in a Large Series of Subjects with Sporadic and Familial Nonautoimmune Subclinical Hypothyroidism J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5787 - 5793. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. De Felice and R. Di Lauro Thyroid Development and Its Disorders: Genetics and Molecular Mechanisms Endocr. Rev., October 1, 2004; 25(5): 722 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Moeller, S. Kimura, T. Kusakabe, X.-H. Liao, J. Van Sande, and S. Refetoff Hypothyroidism in Thyroid Transcription Factor 1 Haploinsufficiency Is Caused by Reduced Expression of the Thyroid-Stimulating Hormone Receptor Mol. Endocrinol., November 1, 2003; 17(11): 2295 - 2302. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Jordan, N. Williams, J. W. Gregory, C. Evans, M. Owen, and M. Ludgate The W546X Mutation of the Thyrotropin Receptor Gene: Potential Major Contributor to Thyroid Dysfunction in a Caucasian Population J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1002 - 1005. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |