| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Division of Endocrinology and Metabolism (J.A.K., L.S.W., Y.E.N., M.N., E.P., J.A.F.), University of Cincinnati College of Medicine, Cincinnati, Ohio 45267; Department of Environmental Health (M.M.), University of Cincinnati, Cincinnati, Ohio 45267; and Department of Molecular Pharmacology (T.L., D.M.-R.), Stanford University School of Medicine, Stanford, California 94305
Address all correspondence and requests for reprints to: Jeffrey A. Knauf, Ph.D., Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, P.O. Box 670547, Cincinnati, Ohio 45267-0547. E-mail: . jeffrey.knauf{at}uc.edu
Abstract
PKC isozymes are the major binding proteins for tumor-promoting phorbol esters, and PKC activity is abnormal in a number of different human cancers. Less is known about putative structural and functional changes of specific PKC isozymes in human neoplasms. A single-point mutation of PKC
at position 881 of the coding sequence has been observed in human pituitary adenomas and up to 50% of thyroid follicular neoplasms, and a rearrangement of PKC
was reported in a thyroid follicular carcinoma cell line, suggesting that these signaling proteins may play a role in thyroid tumorigenesis. To explore this possibility, we examined thyroid neoplasms for mutations and changes in expression levels of PKC or . None of the 57 follicular adenomas, 26 papillary carcinomas (PCs), 7 follicular carcinomas, or the anaplastic carcinoma harbored the PKC 881A>G mutation. Moreover, none of 15 PCs, 10 follicular adenomas, or 6 follicular carcinomas showed evidence of mutations of PKC. However, 8 of 11 PCs had major isozyme-specific reductions of the PKC protein, which occurred through either translational or posttranslational mechanisms. These data indicate that post-transcriptional changes in PKC are highly prevalent in thyroid tumors and may play a significant role in their development.
PKC IS A SERINE-THREONINE kinase initially discovered on the basis of its activation in vitro by Ca2+, phospholipids, and diacylglycerol (1). PKC consists of a family of 12 isozymes that differ in their structure, cofactor requirements for activation, subcellular localization, and substrate specificity. PKC isozymes play a proven role in signal transduction pathways regulating cell growth (2, 3, 4, 5), differentiation (6, 7), and apoptosis (8). The distribution of expression of PKC isozymes differs between cell types, as do their biological properties, allowing for considerable functional diversity (9). There has been considerable interest in the potential role of PKC isozymes in the multistage process of carcinogenesis (10, 11). This relates in part to the discovery that phorbol esters such as phorbol 12-myristate 13-acetate (PMA), which act by substituting for diacylglycerol as activators of PKC isozymes, also serve as powerful tumor promoters for mouse keratinocytes (12, 13). The skin cancer model illustrates some of the unresolved issues regarding PKC signaling in tumor development. Although PMA alone is not carcinogenic in skin, it increases the sensitivity for papilloma formation in response to other tumor initiators. PMA results in activation of most PKC isozymes; however, it is not clear which of these is primarily responsible for tumor promotion. For example, other PKC activators such as bryostatin and 12-deoxyphorbol-13-phenylacetate are either inactive or even inhibitory as tumor promoters in skin, which is thought to be due to a distinct profile of activation and down-regulation of the individual PKC isozymes (14, 15, 16, 17). Indeed, selective modulation of individual PKC isozymes in keratinocytes of transgenic mice resulted in quite distinct phenotypes. Whereas overexpression of PKC
decreased both incidence and promotion of skin tumors (18), overexpression of PKC under the control of the same promoter decreased papilloma burden and accelerated progression to carcinomas (19). The complexity of the system is compounded by the fact that chronic activation of PKC isozymes is followed by their down-regulation, making it difficult to conclude whether it is the unregulated activation or the subsequent loss of function that is important for tumor promotion.
Although the expression and function of PKC isozymes have been studied in many cell types, their role in tumor initiation or progression is still conjectural. In general, there is a propensity for unregulated activation of PKC and PKCßII to promote transformation in vitro, whereas PKC induces apoptosis (20). By contrast, the effects of PKC appear to vary according to the cell type or conditions of activation, with some reports implicating PKC in tumor promotion (21) and others in tumor suppression or apoptosis (22, 23, 24, 25).
Given the potential of PKC isozymes to regulate signal transduction pathways in ways that can either promote or inhibit transformation, it is plausible that somatic mutations that alter their function may occur during progression of human tumors including those of the thyroid. For example PKCß (26, 27) and PKC (28) have been reported to be overexpressed in thyroid neoplasms. Human thyroid neoplasms represent an appropriate model in which to explore the role of PKCs in tumorigenesis because they fit a paradigm of multistage tumor progression. Moreover, PKC isozymes act as both antagonists (29) and intermediates (5, 30) of the signaling network activated by TSH, the most significant thyroid cell growth and differentiation factor. Both the TSH receptor (31) and stimulatory GTP-binding regulatory protein of adenylyl cyclase (32) are targets of somatic activating mutations in benign thyroid neoplasms. The TSH receptor also couples to PLC (33) and induces PKC activity. Prevostel et al. (35) reported that a specific somatic mutation of PKC, originally discovered in invasive pituitary adenomas, was also present in 5 of 10 follicular thyroid neoplasms (35). This point mutation resulting in a glycine for aspartic acid substitution at position 294 did not appear to modify the enzymatic activity of the isozyme in vitro but was associated with altered subcellular distribution and greater growth potential in rat fibroblasts (36). This observation, which is of great potential significance, has not been verified in other thyroid tumor series.
To our knowledge, the only other report of a spontaneously occurring somatic mutation of a PKC isozyme in human cancer is a complex rearrangement of PKC in a follicular thyroid carcinoma cell line (37). This mutation was identified by comparative genomic hybridization, followed by positional cloning of a locus on chromosome 2p21 found to be commonly amplified in thyroid neoplasms (28%), including the follicular thyroid cancer cell line WRO. The gene for PKC was found to lie within the 2p21 amplicon in WRO cells, and encoded for a C-terminal truncated form of the isozyme (amino acids 1–116). Functional studies of the truncated PKC demonstrated that it acted as a dominant-negative inhibitor of wild-type PKC translocation and conferred cells with resistance to apoptosis induced by a variety of stimuli (38). Moreover, the increase in survival was associated with a block in p53 induction and elevated MDM2 levels. Murine Double Minute Clone 2 (MDM2) is thought to function as an oncogene by forming heterodimers with p53 and targeting it to the proteasome for degradation (39). It is not known whether thyroid neoplasms are subject to similar or related PKC genetic defects. Here we explored a large number of human thyroid neoplasms for mutations and changes in expression of PKC and PKC.
Materials and Methods
DNA isolation
Isolation of DNA and RNA from frozen tissue. Human thyroid tissues were either collected at surgery and immediately frozen in liquid N2 or recovered from paraffin-embedded samples. Tissues were obtained through the Tissue Procurement Facilities of the Cedars-Sinai Medical Center and the University of Cincinnati General Clinical Research Center after appropriate informed consent. Whenever possible, samples from tumor and normal thyroid of the same patient were obtained. Tissues that were snap frozen in liquid N2 immediately after surgery were ground under liquid N2 and the DNA and RNA isolated using the guanadinium-CsCl procedure previously described (40). DNA and RNA concentrations were determined by absorbance at 260 nm.
Isolation of DNA from paraffin-embedded tissue. Both normal and tumor tissues were carefully microdissected from the paraffin blocks. DNA was isolated from paraffin-embedded tissue as previously described (41).
Single-strand conformation polymorphism analysis (SSCP)
SSCP analysis was performed using a previously reported method (42). Briefly, PCR mixtures were prepared with 200 ng genomic DNA [or 1.0 µl cDNA reaction prepared as described (43)], 10 pmol of each primer, 100 µM dNTPs, 1 µCi 32PdCTP, 0.5–2.0 mM MgCl2, 10 mM Tris HCl (pH 9.0), 50 mM KCl, and 1U Taq polymerase (Promega Corp., Madison, WI) in a final volume of 20 µl. Amplifications were carried out for 35 cycles with annealing temperatures optimized for each primer pair. The reaction mixture was then diluted in DNA gel-loading buffer (95% formamide, 10 mM NaOH, 0.25% bromophenol blue, 0.25% xylene cyanol), denatured by incubating at 94 C for 5 min, placed on ice, and immediately loaded onto a 0.50%–0.75% MDE (AT Biochem, Malvern, PA), 0.6x TBE gel with or without 20 mM HEPES. Gels were run at 300 V for 12–18 h at room temperature. Autoradiography was performed with an intensifying screen at -70 C for 4–48 h.
Construction of positive controls for PKC SSCP.
We generated positive controls for the screening of genomic DNA for the PKC A881G mutation, using an overlapping PCR approach. The genomic control for wild-type PKC was obtained using the PKC-E primer pair to amplify genomic DNA (Table 1
). The 722-bp genomic fragment containing part of PKC exon 7, the entire intron 7, and part of exon 8 were cloned into the pCR vector using the TA cloning kit (Invitrogen, Carlsbad, CA). To convert the A at position 881 to a G, we first created fragment A using the sense primer from the PKC-E primer pair and the primer 5'TTCCTCGCCCCCTTCCGGAATGGGTACG3' and the cloned PKC-E fragment as template. The latter primer converted the T to a C in the antisense strand. The fragment B was then created using the antisense primer from the PKC-E primer pair and the primer 5'GAAGGGGGCGAGGAAGGAAACATGGAAC3'. The latter primer converted the A to a G in the sense strand. The fragments A and B were then denatured, annealed, and amplified with the PKC-E primer pair. The resulting PCR product was then cloned into the pCR vector using the TA cloning kit and the sequence verified using an ABI sequencing machine.
|
Specific allele oligonucleotide hybridization (SAOH)
Genomic DNA from all samples was amplified by PCR as described above. Twenty microliters of the PCR mixture was denatured by heating at 94 C for 2 min in 100 µl of 0.4 N NaOH + 25 mM EDTA. The samples were immediately placed on ice, mixed with 100 µl of 2 M Tris HCl (pH 7.4), and then applied to a prewetted Hybond-N+H nylon membrane (Amersham, Piscataway, NJ) under vacuum using a slot blot apparatus. Target DNA was immobilized with UV cross-linking followed by a 30-min incubation at 80 C. The membranes were then incubated overnight at 42 C in 10 ml of hybridization buffer [0.25 M NaH2PO4, (pH 7.2), 1 mM EDTA, 7% SDS, 1% BSA, and 15% formamide] containing a 32P-labeled oligonucleotide complementary to the mutant PKC (see Table 1
). The membrane was washed three times with 20 mM Na2HPO4, 1 mM EDTA, and 1% SDS. The same membrane was subsequently stripped by boiling in a 0.1% SDS solution and then rehybridized with the oligonucleotide complimentary to wild-type PKC (Table 1).
Southern blot analysis
Ten micrograms genomic DNA from paired papillary carcinomas (PC) and corresponding normal thyroid tissue were digested with EcoRI, electrophoresed through a 1.0% agarose gel, and transferred to a nylon membrane (Micron Separation Inc., Westborough, MA). The membrane was probed with the full-length (2.2 kb) human PKC cDNA obtained by NheI digestion of the PKC/pBluebac expression vector, American Type Culture Collection, Manassas, VA) (44). The probe was labeled with 32P-dCTP by random priming (Stratagene, San Diego, CA).
Semiquantitative RT-PCR
Two micrograms total RNA were reverse transcribed with 200 U Superscript reverse transcriptase (Life Technologies, Inc.-BRL, Grand Island, NY) in the presence of 2.5 µM random 9-mer primers, 20 µM dNTP for 60 min at 37 C, followed by a 5-min heat inactivation at 95 C. Two microliters of the cDNA reaction mixture were then used as a template in a duplex PCR reaction containing 1 µM of the primer pairs for amplification of ß-actin (5'ATGATATCGCCGCGCTCGTCGTC3' and 5'CATGGCTGGGGTGTTGAAGGTCTC3') and either PKC (PKC-13, see Table 4) or PKC (PKC-A, see Table 1), 20 µM dNTP, and 1.5 mM MgCl2. Other components in the PCR reaction were as suggested by the manufacturer (Perkin-Elmer Corp., Boston, MA). The PCR conditions were 94 C for 45 sec, 56 C for 60 sec, and 72 C for 30 sec for 25 cycles, followed by a 5-min extension at 72 C. Control experiments indicated that at 25 cycles, amplification of PKC, PKC, and ß-actin was within the linear phase. Reactions performed in the absence of reverse transcription yielded no product, indicating that the primer pairs used are specific to cDNA. The PCR products were electrophoresed through a 1.5% agarose gel, transferred to nylon membranes (Micron Separation Inc.), and the membrane probed with 32P-labeled oligos complimentary to ß-actin, PKC, or PKC PCR product. Band intensity was determined using a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) and used to calculate the percent of PKC or mRNA in the tumor vs. the corresponding normal tissue, after normalization with ß-actin.
|
Total tissue lysates. Frozen thyroid tissue was placed in ice-cold buffer A [10 mM Tris-HCl (pH 7.5), 5 mM EDTA, 100 µg/ml PMSF, 4 mM EGTA, 1 µg/ml aprotinin, 5 µg/ml E-64, 1 µg/ml leupeptin, and 1 µg/ml pepstatin] containing 1% Triton X-100 and homogenized with a polytron. The homogenate was then centrifuged at 10,000 x g for 15 min at 4 C, the supernatant collected, and the protein concentration determined. An equal amount of protein from each sample was then subjected to SDS-PAGE.
Preparation of soluble and particulate fractions. Frozen thyroid tissue was placed in ice-cold buffer A and homogenized with a polytron. Soluble and particulate fractions were then separated by centrifugation at 100,000 x g for 1 h at 4 C. The supernatant (soluble fraction) was removed and the pellet resuspended in buffer A containing 1% Triton X-100. The Triton X-100 insoluble material was removed by centrifugation at 100,000 x g for 1 h at 4 C and the supernatant collected (particulate fraction). The distribution of the PKC isozymes in the various fractions was then analyzed by Western blotting.
Western blot analysis.
Protein from total cell lysate or soluble/particulate fractions was subjected to SDS-PAGE and Western blotting as described (45, 46). Briefly, blots were hybridized with antibodies to the indicated proteins and then with their corresponding species-specific horseradish peroxidase (HRP)-conjugated secondary IgG and visualized using ECL (Amersham Pharmacia Biotech Inc., Piscataway, NJ) as directed by the manufacturer. The images were captured using x-ray film or the Image Station (Eastman Kodak Co., New Haven, CT). To confirm similar loading between normal and tumor samples, the membranes were stained with Ponceau S before hybridization with antibodies (fractionated cell extracts) or reprobed with anti-ß-actin IgG (total cell extracts). To quantify PKC levels in Western blots containing the fractionated cell extracts, multiple-exposure x-rays were taken and the one judged to be the most representative was scanned using the Image Station (Kodak). To quantify PKC levels in Western blots containing the total cell extracts, the Image Station was used to capture the image. In both cases the 1D software (Kodak) was used to determine band intensity. The percent of PKC or in the tumor vs. corresponding normal tissue was calculated, after normalization with ß-actin (total cell extracts) or Ponceau S staining (fractionated cell extracts).
Statistical analysis
To test for correlation between PKC and MDM2, we first applied Spearman’s rank correlation. As an additional strategy, we counted the number of patients who had either discordant or concordant measurements of these two proteins (concordance was defined as both values being either above or below the average levels for each protein in all tumors). With this approach, if there was no significant correlation, the chance for these two proteins in any one patient to be discordant is the same as the chance that they will be concordant.
Results
SSCP analysis of PKC
To amplify the region of PKC harboring the 881A>G mutation, previously referred to as position 908 of the nucleotide sequence (28), we initially selected primer pair PKC-A (Table 1), used by Prevostel et al. (28) in their initial description of this structural defect. Despite varying PCR conditions and techniques, we were unable to obtain a PCR product of the predicted size using genomic DNA as template. However, we did obtain the appropriate product with thyroid tissue cDNA, suggesting that this region contained one or more introns. These experiments were conducted before the availability of information from the Human Genome Sequencing Database, and we therefore empirically designed alternative sets of primers to map the location of the introns. The primer pair PKC-E consistently gave a larger-than-predicted PCR product with genomic DNA, which allowed us to map and sequence a 516-bp intron between bases 821 and 822. This intron was subsequently confirmed by a Blat search of the PKC coding sequence vs. the UCSC Human Genome Project Working Draft (http://genome.ucsc.edu/) (Table 2). In addition, the Blat analysis identified an additional 43642-bp intron between bases 918 and 919. Using the sequence from the PKC-E PCR product, we designed two primer pairs, PKC-I and PKC-J, which were then used to amplify the target region of PKC from genomic DNA. To validate the SSCP screening of genomic DNA for the position 881A>G substitution (amino acid 294), we generated controls by cloning a genomic fragment of the wild-type PKC gene flanking position 881 into the pCR vector. In addition, an A-to-G substitution at 881 was generated by site-directed mutagenesis. Analysis of PCR products generated by either primer pairs I or J demonstrated that, under the SSCP conditions employed, we could distinguish between the wild-type and mutant PKC at position 881 (Fig. 1A).
|
|
. Here all tumor samples present a similar pattern, in contrast to the faster migrating band seen with the mutant DNA control. Only five tumors displayed suspect mobility shifts. These bands were excised from the gel, DNA extracted, and product reamplified and sequenced. In all five cases, a wild-type sequence was found. In addition, we directly sequenced three additional PCR products from tumor samples with normal SSCP patterns, and all were wild type.
SAOH analysis of PKC.
Because of the discrepancy between our findings and those of the previously reported study (28), we elected to repeat the screen for the 881A>G substitution using another methodology. SAOH was performed on 29 of the 62 neoplasms examined by SSCP as well as an additional 15 FAs and 14 PCs. Altogether 49 thyroid neoplasms (31 FAs, 10 PCs, 7 FCs, and 1 AC) were examined by SAOH. An oligonucleotide probe containing the wild-type sequence of PKC hybridized to PCR amplified tumor genomic DNA products from each of the 49 cases (Fig. 2A), whereas only the PKC mutant controls hybridized to the probe containing the 881A>G substitution (Fig. 2B). These results confirm that the 881A>G mutation is not present in this series of thyroid neoplasms.
|
by SSCP.
To investigate the occurrence of point mutations of PKC in thyroid neoplasms, we examined 15 PCs, 10 FAs, and 6 FCs for point mutations in the V1 region (mutated in the WRO cell line) or the region containing the phosphate transfer domain and activation loop. We determined the intron/exon junctions of the PKC gene in these two regions using a Blat search of the PKC coding sequence vs. the UCSC Human Genome Project Working Draft (http://genome.ucsc.edu). This showed that the V1 region was part of a single exon, whereas the phosphate transfer domain and activation loop was encoded in four different exons (Table 3). With this information we designed primer pairs 1–5 within the respective flanking introns to amplify the indicated exons using genomic DNA as template (Table 4). Because the size of exon 1 (nucleotides 1–348) is beyond the optimal range for SSCP analysis, we used two overlapping primer pairs for this region. Sequencing of PCR products from shifted bands identified the following changes: a 1761C>T silent polymorphism in 7 of 31 samples, and an A-to-G substitution 23 bp into intron 1 in 10 of 31 samples. The 1761C>T substitution was confirmed to be a germline variation by sequencing corresponding normal tissue. The A-to-G intron substitution was identified as a single nucleotide polymorphism in the NCBI database. No other changes were found. To determine whether other regions of PKC were mutated, we examined the entire coding sequence of PKC in 3 FCs and 13 PCs. Twelve overlapping pairs of primers spanning the entire length of the PKC coding sequence were used to screen these samples using cDNA as a template (Table 4). Besides additional confirmation of the 1761C>T polymorphism, no other changes were found.
|
by Southern blotting.
The mutation of PKC previously reported in WRO cells was a complex rearrangement resulting in expression of a truncated gene product (37). To investigate whether similar changes were present in PCs, Southern blots of EcoRI digested DNA from nine normal/tumor pairs were probed with 32P-labeled full length PKC cDNA. None of the tumors exhibited restriction fragments that varied in size or intensity from those seen in the corresponding normal tissues (Fig. 3), indicating that large-scale rearrangements were not present.
|
and in PC by Western blotting.
In a previous report, PKC was found to be elevated in human follicular thyroid neoplasms, compared with paired normal thyroid controls by Western blotting (28). There is also evidence that the subcellular distribution of 881A>G PKC is abnormal in Rat 6 cells in vitro. In addition, we have previously reported that expression of a truncated mutant of PKC containing the V1 domain of the protein abrogates activation-induced translocation of endogenous PKC (38). To determine whether similar alterations in abundance or localization of either PKC or PKC were present in PCs, Western blots of particulate and soluble fractions from six normal/tumor paired specimens of thyroid PCs were sequentially probed with anti-PKC or anti-PKC IgGs. As shown in Fig. 4A, there was no consistent difference in subcellular distribution of PKC or PKC between the tumor and normal tissues from the same patients. However, in four of the six tumors, PKC expression was markedly reduced, compared with corresponding normal tissue (Fig. 4A and Table 5). In contrast, PKC levels were similar or slightly higher in the six tumors (Fig. 4A, Table 5). To exclude potential confounding effects of losses during fractionation, Western blots of total lysates from an additional five normal/tumor pairs of PCs were examined. PKC levels were markedly reduced in four of five PCs, whereas only one of five had lower PKC immunoreactivity (Fig. 4B and Table 5). Thus, altogether 8 of 11 PCs had markedly decreased levels of PKC. To determine whether the reduced abundance of PKC was due to a decrease in PKC mRNA, RT-PCR was used to quantify PKC mRNA levels in seven PCs with reduced and two with normal PKC protein levels. As summarized in Table 5, tumors with reduced PKC protein did not have a corresponding reduction in PKC mRNA. These results suggest that a translational, or more likely a posttranslational mechanism, is responsible for the reduced level of PKC protein seen in the PC tissues (Table 5).
|
|
.
In a previous report, we showed that PKC may be involved in signal transduction pathways regulating MDM2 expression or stability (38). We investigated whether the reduction in PKC levels observed in the PCs was associated with changes in abundance of MDM2. Western blots containing total cell extracts demonstrated a 1.6- to 4-fold increase in expression of MDM2 in four of five PCs (Fig. 4C). Western blots containing insoluble and soluble fraction (data not shown) identified an additional three of six PCs with elevated MDM2 levels. Interestingly, all tumors with elevated MDM2 expression also had reduced expression of PKC. The inverse relationship between PKC and MDM2 levels was first examined with Spearman’s rank correlation. The correlation coefficient between PKC and MDM2 was -0.57 with a P value of 0.0679, whereas the correlation coefficient between PKC and MDM2 was -0.45 with a P value of 0.1466. This was highly suggestive but not conclusive evidence for a negative correlation between PKC and MDM2 levels in thyroid papillary carcinomas. However, this statistical tool assumes a linear relationship, which may not be the case. To further investigate whether there is a negative correlation between PKC and MDM2, we counted the number of patients that had discordant levels of these two proteins (see Materials and Methods). When we categorized the data as described, 9 of 11 patients had discordant levels of PKC and MDM2. The probability of this happening under the assumption that concordant cases are equally probable as discordant ones (P value) is less than 0.01, supporting the negative correlation between PKC and MDM2 expression in thyroid papillary carcinomas.
Analysis of PKC and in follicular adenomas.
To determine whether follicular adenomas also had similar reduction in PKC, Western blots of total lysates from normal/tumor pairs of FAs were performed. We found that two of the three neoplasms had reduced PKC protein levels (51.9% and 65.1%), compared with corresponding normal tissue. Fresh frozen samples of FCs were not available for Western blot analysis.
Discussion
The purpose of this study was to explore the possible role of genetic or epigenetic changes in PKC and in thyroid tumorigenesis. The rationale was based in part on the fact that PKC isozymes are positioned in the effector pathway of several known thyroid growth factors and oncogenes. In addition, a specific role for putative somatic mutations of PKC has been proposed in thyroid follicular neoplasms. A role for gain-of-function mutations in PKC was initially proposed by Megidish and Mazurek (47), who identified abnormal subcellular distribution of PKC in UV-induced fibrosarcoma cell lines. PKC cDNA from one of these cell lines was found to contain four somatic mutations leading to three amino acid substitutions in the regulatory domain and one in the catalytic domain (47, 48, 49). Mutant, but not wild-type, PKC evoked transformation of Balb/c 3T3 fibroblasts, although Borner et al. (50) were unable to reproduce these observations. In light of this, the identification of spontaneously arising somatic point mutations of PKC in human pituitary and thyroid neoplasms was of major interest. In the case of human thyroid tumors, their presence in both benign and malignant neoplasms appeared to place PKC mutations as one of the early events in thyroid tumor progression. One notable feature was the presence of an identical A-to-G transition at base pair 881 in all tumors, a rare occurrence in tumor genetics. Here we were unable to confirm the presence of the PKC 881 mutation in any of the 91 thyroid neoplasms we tested with SSCP, SAOH, or by direct sequencing. We used multiple screening modalities because of initial difficulties in replicating the conditions used in the original report and for added verification. In the original report, the authors used primer pair PKC-A (Table 1) to generate genomic PCR products used to screen for mutations. However, we identified two introns within the region amplified by this primer pair (Table 2), suggesting that the Prevostel et al. study (28) was likely performed on cDNA. We cannot rule out the possibility that our inability to find the 881 mutation of PKC is because of regional differences in prevalence of this anomaly. We did not specifically study autonomously functioning thyroid nodules or undifferentiated carcinomas, and it is conceivable, although unlikely, that mutations may be confined to these histotypes.
Of all PKC isozymes, PKC has proven to be the most consistently transforming when transfected into murine fibroblasts (2, 3). When overexpressed in rat 6 embryonal fibroblasts, PKC produced malignant transformation in the absence of treatment with phorbol esters. In the presence of 12-O-Tetradecanoyl Phorbol 13-acetate, PKC-transfected cells exhibited a rearranged actin cytoskeleton and were growth inhibited, probably due in part to interference of the overexpressed isozyme with the translocation and activation of other PKC isozymes. We focused our attention on the role of this isozyme in thyroid cancer following the discovery of a rearrangement in the V1 region of PKC in the thyroid carcinoma cell line WRO. This rearrangement encoded a truncated PKC (amino acid 1–116) that acted as a dominant-negative inhibitor of translocation of the wild-type form of the isozyme (38). However, we found no large-scale rearrangements in the PKC gene by Southern blotting of nine normal/tumor pairs of papillary carcinomas. In addition to the loss of function found in cells expressing the truncated V1 domain, others have shown that kinase-dead mutants of PKC (51) or mutations in the activation loop of PKC (52) also act as dominant-negative inhibitors. Because mutants in these three domains have functional consequences, we focused our screening efforts in these regions. The two SSCP conditions we employed (with and without 20 mM HEPES) have been reported to be up to 96% efficient in detecting point mutations (53). Although it is likely that our sensitivity may be lower than this, we believe that our inability to find mutations in the V1, kinase domain, or activation loop of PKC in 30 thyroid neoplasms indicates these regions are rarely if ever altered in thyroid neoplasms. Although we cannot exclude the possibility that other regions of PKC may occasionally harbor somatic changes, it seems unlikely because we found no mutations in the 3 FCs and 13 PCs in which the entire PKC coding sequence was examined.
In this report, we demonstrate by Western blotting that PKC levels are significantly and often strikingly reduced in the majority of the thyroid PCs we examined. Our data suggest that the reduced expression of PKC is likely a posttranscriptional event affecting translation or stability of the PKC protein. Evidence for this includes: (1) comprehensive screening of the entire coding sequence in six PCs with reduced expression of PKC did not identify mutations altering the PKC amino acid sequence; and (2) lack of correspondence between PKC mRNA as detected by semiquantitative RT-PCR and immunoreactive PKC levels in papillary carcinomas. Of note, PKC protein levels were not decreased in the majority of the tumors examined and indeed tended to be higher, as described initially by Prevostel et al. (28) in a small number of follicular neoplasms. Differences in cellular content or tissue architecture between normal and tumor tissues can alter protein representation in Western blots. However, this is unlikely to account for the reduction in PKC seen in the tumor tissues. As shown in Fig. 4, B and C, all but one of the tumor samples had PKC and MDM2 levels that were either similar or greater than those found in normal tissue. Furthermore, one would predict that if protein representation changes were due to differences in tissue architecture (i.e. more acellular colloid in normal samples), then similar alterations in mRNA levels would also be observed, which was not the case. The cause of the isozyme-specific decrease in PKC abundance remains to be clarified. However, one explanation may be that the presence of a sustained upstream activation signal leads to down-regulation of the isozyme. In this regard, we have recently observed that acute expression of the oncogenes RET/PTC1 or RET/PTC3 in rat thyroid PCCL3 cells results in isozyme-specific translocation of PKC. Furthermore, a reduction in PKC levels is found in cells chronically expressing RET/PTC3 (Knauf, J.A., and J.A. Fagin, unpublished data).
The MDM2 gene has been classified as an oncogene based on its behavior in human tumors (39, 54). Activating mutations of MDM2 are rare in cancers; however, overexpression of MDM2 is found in a wide variety of human tumors (55), including thyroid cancers (56). In a previous report, we found that expression of a dominant-negative PKC mutant protects thyroid cells from doxorubicin-induced apoptosis, which was associated with increased degradation of p53, likely because of higher MDM2 levels (38). Accordingly, here we demonstrate that in all seven PC with overexpression of MDM2, there was also a reduction in PKC levels. These data raise the possibility that PKC may either directly or indirectly regulate levels of MDM2 in thyroid cells, thus impacting the ability of cells to mount p53-mediated stress responses.
We conclude that post-transcriptional changes resulting in decreased abundance of PKC are frequent in thyroid neoplasms. The significance of the isozyme-specific decrease in PKC abundance remains to be clarified. However, based on functional studies in thyroid cells in culture (38), we propose that decreased abundance of this PKC isozyme may promote tumor progression by prolonging cellular life span.
Acknowledgments
Footnotes
J.A.K. and L.S.W. contributed equally to this work.
This work was supported in part by NIH Grants CA50706 and CA72597 (to J.A.F.), K01DK02781 (to J.A.K.), and M01-RR08084.
Abbreviations: AC, Anaplastic carcinoma; FA, follicular adenoma; FC, follicular carcinoma; HRP, horseradish peroxidase; PC, papillary carcinoma; PMA, phorbol 12-myristate 13-acetate; SAOH, specific allele oligonucleotide hybridization; SSCP, single-strand conformation polymorphism analysis.
Received April 2, 2001.
Accepted December 6, 2001.
References
isoform of protein kinase C is an oncogene when overexpressed in rat fibroblasts. Oncogene 8:2095–2104[Medline]
and - in NIH 3T3 cells induces opposite effects on growth, morphology, anchorage dependence, and tumorigenicity. J Biol Chem 268:6090–6096 inhibits the growth and tumorigenicity of human glioblastoma cells. Neurosurgery 35:904–908[Medline]
protein kinase C in nerve growth factor-induced differentiation of PC12 cells. Cell Growth Differ 5:395–403[Abstract]
to the cytosol. Implications in apoptosis. J Biol Chem 272:2452–2458 in the epidermis are resistant to skin tumor promotion by 12-O-tetradecanoylphorbol-13-acetate. Cancer Res 59:5710–5718 in their epidermis exhibit reduced papilloma burden but enhanced carcinoma formation after tumor promotion. Cancer Res 60:595–602. Eur J Biochem 259:555–564[Medline]
is oncogenic in rat colonic epithelial cells. Oncogene 12:847–854[Medline]
and decreased expression of protein kinase C-. Cell Growth Differ 1:653–660[Abstract]
mutant is present in human thyroid neoplasms. Oncogene 11:669–674[Medline]
-protein kinase-C. J Clin Endocrinol Metab 77:1125–1129[Abstract]
and tumorigenesis of the endocrine gland. Horm Res 47:140–144[Medline]
originally found in human tumors: aberrant subcellular translocation and effects on growth control. Oncogene 14:677–685[CrossRef][Medline]
(PKC) in thyroid cell death: a truncated chimeric PKC cloned from a thyroid cancer cell line protects thyroid cells from apoptosis. J Biol Chem 274:23414–23425. Biochim Biophys Acta 1134:154–160
, -, and - in T cell activation. J Biol Chem 270:9833–9839, novel PKC- and PKC-theta, but not atypical PKC-lambda are MARCKS kinases in intact NIH 3T3 fibroblasts. J Biol Chem 272:4072–4078 to transform fibroblasts. Nature 353:78–80[CrossRef][Medline]
and C upon mitogenic stimulation of quiescent rat 3Y1 fibroblasts. J Biol Chem 269:17495–17501This article has been cited by other articles:
 |
|
 |
|
  K. Krause, S. Karger, S.-Y. Sheu, T. Aigner, R. Kursawe, O. Gimm, K.-W. Schmid, H. Dralle, and D. Fuhrer Evidence for a role of the amyloid precursor protein in thyroid carcinogenesis J. Endocrinol., August 1, 2008; 198(2): 291 - 299. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Santiago-Walker, A. J. Fikaris, G. D. Kao, E. J. Brown, M. G. Kazanietz, and J. L. Meinkoth Protein Kinase C {delta} Stimulates Apoptosis by Initiating G1 Phase Cell Cycle Progression and S Phase Arrest J. Biol. Chem., September 16, 2005; 280(37): 32107 - 32114. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Lang Regulating Renal Drug Elimination? J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1535 - 1536. [Full Text] [PDF]
|
|
|
|
 |
|
 C. Quittau-Prevostel, N. Delaunay, A. Collazos, A. Vallentin, and D. Joubert Targeting of PKC{alpha} and {epsilon} in the pituitary: a highly regulated mechanism involving a GD(E)E motif of the V3 region J. Cell Sci., January 1, 2004; 117(1): 63 - 72. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mutation analysis
