help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knauf, J. A.
Right arrow Articles by Fagin, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knauf, J. A.
Right arrow Articles by Fagin, J. A.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 5 2150-2159
Copyright © 2002 by The Endocrine Society

Other Original Articles

Isozyme-Specific Abnormalities of PKC in Thyroid Cancer: Evidence for Post-Transcriptional Changes in PKC Epsilon

Jeffrey A. Knauf, Laura S. Ward, Yuri E. Nikiforov, Marina Nikiforova, Efisio Puxeddu, Mario Medvedovic, Tamar Liron, Daria Mochly-Rosen and James A. Fagin

Division of Endocrinology and Metabolism (J.A.K., L.S.W., Y.E.N., M.N., E.P., J.A.F.), University of Cincinnati College of Medicine, Cincinnati, Ohio 45267; Department of Environmental Health (M.M.), University of Cincinnati, Cincinnati, Ohio 45267; and Department of Molecular Pharmacology (T.L., D.M.-R.), Stanford University School of Medicine, Stanford, California 94305

Address all correspondence and requests for reprints to: Jeffrey A. Knauf, Ph.D., Division of Endocrinology and Metabolism, University of Cincinnati College of Medicine, P.O. Box 670547, Cincinnati, Ohio 45267-0547. E-mail: . jeffrey.knauf{at}uc.edu

Abstract

PKC isozymes are the major binding proteins for tumor-promoting phorbol esters, and PKC activity is abnormal in a number of different human cancers. Less is known about putative structural and functional changes of specific PKC isozymes in human neoplasms. A single-point mutation of PKC{alpha} at position 881 of the coding sequence has been observed in human pituitary adenomas and up to 50% of thyroid follicular neoplasms, and a rearrangement of PKC{epsilon} was reported in a thyroid follicular carcinoma cell line, suggesting that these signaling proteins may play a role in thyroid tumorigenesis. To explore this possibility, we examined thyroid neoplasms for mutations and changes in expression levels of PKC{epsilon} or {alpha}. None of the 57 follicular adenomas, 26 papillary carcinomas (PCs), 7 follicular carcinomas, or the anaplastic carcinoma harbored the PKC{alpha} 881A>G mutation. Moreover, none of 15 PCs, 10 follicular adenomas, or 6 follicular carcinomas showed evidence of mutations of PKC{epsilon}. However, 8 of 11 PCs had major isozyme-specific reductions of the PKC{epsilon} protein, which occurred through either translational or posttranslational mechanisms. These data indicate that post-transcriptional changes in PKC{epsilon} are highly prevalent in thyroid tumors and may play a significant role in their development.

PKC IS A SERINE-THREONINE kinase initially discovered on the basis of its activation in vitro by Ca2+, phospholipids, and diacylglycerol (1). PKC consists of a family of 12 isozymes that differ in their structure, cofactor requirements for activation, subcellular localization, and substrate specificity. PKC isozymes play a proven role in signal transduction pathways regulating cell growth (2, 3, 4, 5), differentiation (6, 7), and apoptosis (8). The distribution of expression of PKC isozymes differs between cell types, as do their biological properties, allowing for considerable functional diversity (9). There has been considerable interest in the potential role of PKC isozymes in the multistage process of carcinogenesis (10, 11). This relates in part to the discovery that phorbol esters such as phorbol 12-myristate 13-acetate (PMA), which act by substituting for diacylglycerol as activators of PKC isozymes, also serve as powerful tumor promoters for mouse keratinocytes (12, 13). The skin cancer model illustrates some of the unresolved issues regarding PKC signaling in tumor development. Although PMA alone is not carcinogenic in skin, it increases the sensitivity for papilloma formation in response to other tumor initiators. PMA results in activation of most PKC isozymes; however, it is not clear which of these is primarily responsible for tumor promotion. For example, other PKC activators such as bryostatin and 12-deoxyphorbol-13-phenylacetate are either inactive or even inhibitory as tumor promoters in skin, which is thought to be due to a distinct profile of activation and down-regulation of the individual PKC isozymes (14, 15, 16, 17). Indeed, selective modulation of individual PKC isozymes in keratinocytes of transgenic mice resulted in quite distinct phenotypes. Whereas overexpression of PKC{delta} decreased both incidence and promotion of skin tumors (18), overexpression of PKC{epsilon} under the control of the same promoter decreased papilloma burden and accelerated progression to carcinomas (19). The complexity of the system is compounded by the fact that chronic activation of PKC isozymes is followed by their down-regulation, making it difficult to conclude whether it is the unregulated activation or the subsequent loss of function that is important for tumor promotion.

Although the expression and function of PKC isozymes have been studied in many cell types, their role in tumor initiation or progression is still conjectural. In general, there is a propensity for unregulated activation of PKC{alpha} and PKCßII to promote transformation in vitro, whereas PKC{delta} induces apoptosis (20). By contrast, the effects of PKC{epsilon} appear to vary according to the cell type or conditions of activation, with some reports implicating PKC{epsilon} in tumor promotion (21) and others in tumor suppression or apoptosis (22, 23, 24, 25).

Given the potential of PKC isozymes to regulate signal transduction pathways in ways that can either promote or inhibit transformation, it is plausible that somatic mutations that alter their function may occur during progression of human tumors including those of the thyroid. For example PKCß (26, 27) and PKC{alpha} (28) have been reported to be overexpressed in thyroid neoplasms. Human thyroid neoplasms represent an appropriate model in which to explore the role of PKCs in tumorigenesis because they fit a paradigm of multistage tumor progression. Moreover, PKC isozymes act as both antagonists (29) and intermediates (5, 30) of the signaling network activated by TSH, the most significant thyroid cell growth and differentiation factor. Both the TSH receptor (31) and stimulatory GTP-binding regulatory protein of adenylyl cyclase (32) are targets of somatic activating mutations in benign thyroid neoplasms. The TSH receptor also couples to PLC (33) and induces PKC activity. Prevostel et al. (35) reported that a specific somatic mutation of PKC{alpha}, originally discovered in invasive pituitary adenomas, was also present in 5 of 10 follicular thyroid neoplasms (35). This point mutation resulting in a glycine for aspartic acid substitution at position 294 did not appear to modify the enzymatic activity of the isozyme in vitro but was associated with altered subcellular distribution and greater growth potential in rat fibroblasts (36). This observation, which is of great potential significance, has not been verified in other thyroid tumor series.

To our knowledge, the only other report of a spontaneously occurring somatic mutation of a PKC isozyme in human cancer is a complex rearrangement of PKC{epsilon} in a follicular thyroid carcinoma cell line (37). This mutation was identified by comparative genomic hybridization, followed by positional cloning of a locus on chromosome 2p21 found to be commonly amplified in thyroid neoplasms (28%), including the follicular thyroid cancer cell line WRO. The gene for PKC{epsilon} was found to lie within the 2p21 amplicon in WRO cells, and encoded for a C-terminal truncated form of the isozyme (amino acids 1–116). Functional studies of the truncated PKC{epsilon} demonstrated that it acted as a dominant-negative inhibitor of wild-type PKC{epsilon} translocation and conferred cells with resistance to apoptosis induced by a variety of stimuli (38). Moreover, the increase in survival was associated with a block in p53 induction and elevated MDM2 levels. Murine Double Minute Clone 2 (MDM2) is thought to function as an oncogene by forming heterodimers with p53 and targeting it to the proteasome for degradation (39). It is not known whether thyroid neoplasms are subject to similar or related PKC{epsilon} genetic defects. Here we explored a large number of human thyroid neoplasms for mutations and changes in expression of PKC{alpha} and PKC{epsilon}.

Materials and Methods

DNA isolation

Isolation of DNA and RNA from frozen tissue. Human thyroid tissues were either collected at surgery and immediately frozen in liquid N2 or recovered from paraffin-embedded samples. Tissues were obtained through the Tissue Procurement Facilities of the Cedars-Sinai Medical Center and the University of Cincinnati General Clinical Research Center after appropriate informed consent. Whenever possible, samples from tumor and normal thyroid of the same patient were obtained. Tissues that were snap frozen in liquid N2 immediately after surgery were ground under liquid N2 and the DNA and RNA isolated using the guanadinium-CsCl procedure previously described (40). DNA and RNA concentrations were determined by absorbance at 260 nm.

Isolation of DNA from paraffin-embedded tissue. Both normal and tumor tissues were carefully microdissected from the paraffin blocks. DNA was isolated from paraffin-embedded tissue as previously described (41).

Single-strand conformation polymorphism analysis (SSCP)

SSCP analysis was performed using a previously reported method (42). Briefly, PCR mixtures were prepared with 200 ng genomic DNA [or 1.0 µl cDNA reaction prepared as described (43)], 10 pmol of each primer, 100 µM dNTPs, 1 µCi {alpha}32PdCTP, 0.5–2.0 mM MgCl2, 10 mM Tris HCl (pH 9.0), 50 mM KCl, and 1U Taq polymerase (Promega Corp., Madison, WI) in a final volume of 20 µl. Amplifications were carried out for 35 cycles with annealing temperatures optimized for each primer pair. The reaction mixture was then diluted in DNA gel-loading buffer (95% formamide, 10 mM NaOH, 0.25% bromophenol blue, 0.25% xylene cyanol), denatured by incubating at 94 C for 5 min, placed on ice, and immediately loaded onto a 0.50%–0.75% MDE (AT Biochem, Malvern, PA), 0.6x TBE gel with or without 20 mM HEPES. Gels were run at 300 V for 12–18 h at room temperature. Autoradiography was performed with an intensifying screen at -70 C for 4–48 h.

Construction of positive controls for PKC{alpha} SSCP. We generated positive controls for the screening of genomic DNA for the PKC{alpha} A881G mutation, using an overlapping PCR approach. The genomic control for wild-type PKC{alpha} was obtained using the PKC{alpha}-E primer pair to amplify genomic DNA (Table 1Go). The 722-bp genomic fragment containing part of PKC{alpha} exon 7, the entire intron 7, and part of exon 8 were cloned into the pCR vector using the TA cloning kit (Invitrogen, Carlsbad, CA). To convert the A at position 881 to a G, we first created fragment A using the sense primer from the PKC{alpha}-E primer pair and the primer 5'TTCCTCGCCCCCTTCCGGAATGGGTACG3' and the cloned PKC{alpha}-E fragment as template. The latter primer converted the T to a C in the antisense strand. The fragment B was then created using the antisense primer from the PKC{alpha}-E primer pair and the primer 5'GAAGGGGGCGAGGAAGGAAACATGGAAC3'. The latter primer converted the A to a G in the sense strand. The fragments A and B were then denatured, annealed, and amplified with the PKC{alpha}-E primer pair. The resulting PCR product was then cloned into the pCR vector using the TA cloning kit and the sequence verified using an ABI sequencing machine.


View this table:
[in this window]
[in a new window]
  		Table 1. Primers used in PKC{alpha} mutation analysis

 
Sequencing analysis. Aberrantly migrating bands were excised from the gel and boiled in 200 µl H20 for 10 min. The PCR products were then reamplified and sequenced using an ABI sequencing machine. Alternatively, PCR products were subcloned into the pCR vector using the TA cloning kit (Invitrogen) and the inserts sequenced using an ABI sequencing machine. At least six inserts for each PCR product were sequenced.

Specific allele oligonucleotide hybridization (SAOH)

Genomic DNA from all samples was amplified by PCR as described above. Twenty microliters of the PCR mixture was denatured by heating at 94 C for 2 min in 100 µl of 0.4 N NaOH + 25 mM EDTA. The samples were immediately placed on ice, mixed with 100 µl of 2 M Tris HCl (pH 7.4), and then applied to a prewetted Hybond-N+H nylon membrane (Amersham, Piscataway, NJ) under vacuum using a slot blot apparatus. Target DNA was immobilized with UV cross-linking followed by a 30-min incubation at 80 C. The membranes were then incubated overnight at 42 C in 10 ml of hybridization buffer [0.25 M NaH2PO4, (pH 7.2), 1 mM EDTA, 7% SDS, 1% BSA, and 15% formamide] containing a 32P-labeled oligonucleotide complementary to the mutant PKC{alpha} (see Table 1Go). The membrane was washed three times with 20 mM Na2HPO4, 1 mM EDTA, and 1% SDS. The same membrane was subsequently stripped by boiling in a 0.1% SDS solution and then rehybridized with the oligonucleotide complimentary to wild-type PKC{alpha} (Table 1Go).

Southern blot analysis

Ten micrograms genomic DNA from paired papillary carcinomas (PC) and corresponding normal thyroid tissue were digested with EcoRI, electrophoresed through a 1.0% agarose gel, and transferred to a nylon membrane (Micron Separation Inc., Westborough, MA). The membrane was probed with the full-length (2.2 kb) human PKC{epsilon} cDNA obtained by NheI digestion of the PKC{epsilon}/pBluebac expression vector, American Type Culture Collection, Manassas, VA) (44). The probe was labeled with 32P-dCTP by random priming (Stratagene, San Diego, CA).

Semiquantitative RT-PCR

Two micrograms total RNA were reverse transcribed with 200 U Superscript reverse transcriptase (Life Technologies, Inc.-BRL, Grand Island, NY) in the presence of 2.5 µM random 9-mer primers, 20 µM dNTP for 60 min at 37 C, followed by a 5-min heat inactivation at 95 C. Two microliters of the cDNA reaction mixture were then used as a template in a duplex PCR reaction containing 1 µM of the primer pairs for amplification of ß-actin (5'ATGATATCGCCGCGCTCGTCGTC3' and 5'CATGGCTGGGGTGTTGAAGGTCTC3') and either PKC{epsilon} (PKC{epsilon}-13, see Table 4Go) or PKC{alpha} (PKC{alpha}-A, see Table 1Go), 20 µM dNTP, and 1.5 mM MgCl2. Other components in the PCR reaction were as suggested by the manufacturer (Perkin-Elmer Corp., Boston, MA). The PCR conditions were 94 C for 45 sec, 56 C for 60 sec, and 72 C for 30 sec for 25 cycles, followed by a 5-min extension at 72 C. Control experiments indicated that at 25 cycles, amplification of PKC{epsilon}, PKC{alpha}, and ß-actin was within the linear phase. Reactions performed in the absence of reverse transcription yielded no product, indicating that the primer pairs used are specific to cDNA. The PCR products were electrophoresed through a 1.5% agarose gel, transferred to nylon membranes (Micron Separation Inc.), and the membrane probed with 32P-labeled oligos complimentary to ß-actin, PKC{alpha}, or PKC{epsilon} PCR product. Band intensity was determined using a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA) and used to calculate the percent of PKC{epsilon} or {alpha} mRNA in the tumor vs. the corresponding normal tissue, after normalization with ß-actin.


View this table:
[in this window]
[in a new window]
  		Table 4. Primers used in PKC{varepsilon} mutation analysis

 
Lysate preparation and Western blotting

Total tissue lysates. Frozen thyroid tissue was placed in ice-cold buffer A [10 mM Tris-HCl (pH 7.5), 5 mM EDTA, 100 µg/ml PMSF, 4 mM EGTA, 1 µg/ml aprotinin, 5 µg/ml E-64, 1 µg/ml leupeptin, and 1 µg/ml pepstatin] containing 1% Triton X-100 and homogenized with a polytron. The homogenate was then centrifuged at 10,000 x g for 15 min at 4 C, the supernatant collected, and the protein concentration determined. An equal amount of protein from each sample was then subjected to SDS-PAGE.

Preparation of soluble and particulate fractions. Frozen thyroid tissue was placed in ice-cold buffer A and homogenized with a polytron. Soluble and particulate fractions were then separated by centrifugation at 100,000 x g for 1 h at 4 C. The supernatant (soluble fraction) was removed and the pellet resuspended in buffer A containing 1% Triton X-100. The Triton X-100 insoluble material was removed by centrifugation at 100,000 x g for 1 h at 4 C and the supernatant collected (particulate fraction). The distribution of the PKC isozymes in the various fractions was then analyzed by Western blotting.

Western blot analysis. Protein from total cell lysate or soluble/particulate fractions was subjected to SDS-PAGE and Western blotting as described (45, 46). Briefly, blots were hybridized with antibodies to the indicated proteins and then with their corresponding species-specific horseradish peroxidase (HRP)-conjugated secondary IgG and visualized using ECL (Amersham Pharmacia Biotech Inc., Piscataway, NJ) as directed by the manufacturer. The images were captured using x-ray film or the Image Station (Eastman Kodak Co., New Haven, CT). To confirm similar loading between normal and tumor samples, the membranes were stained with Ponceau S before hybridization with antibodies (fractionated cell extracts) or reprobed with anti-ß-actin IgG (total cell extracts). To quantify PKC{epsilon} levels in Western blots containing the fractionated cell extracts, multiple-exposure x-rays were taken and the one judged to be the most representative was scanned using the Image Station (Kodak). To quantify PKC{epsilon} levels in Western blots containing the total cell extracts, the Image Station was used to capture the image. In both cases the 1D software (Kodak) was used to determine band intensity. The percent of PKC{epsilon} or {alpha} in the tumor vs. corresponding normal tissue was calculated, after normalization with ß-actin (total cell extracts) or Ponceau S staining (fractionated cell extracts).

Statistical analysis

To test for correlation between PKC{epsilon} and MDM2, we first applied Spearman’s rank correlation. As an additional strategy, we counted the number of patients who had either discordant or concordant measurements of these two proteins (concordance was defined as both values being either above or below the average levels for each protein in all tumors). With this approach, if there was no significant correlation, the chance for these two proteins in any one patient to be discordant is the same as the chance that they will be concordant.

Results

SSCP analysis of PKC{alpha}

To amplify the region of PKC{alpha} harboring the 881A>G mutation, previously referred to as position 908 of the nucleotide sequence (28), we initially selected primer pair PKC{alpha}-A (Table 1Go), used by Prevostel et al. (28) in their initial description of this structural defect. Despite varying PCR conditions and techniques, we were unable to obtain a PCR product of the predicted size using genomic DNA as template. However, we did obtain the appropriate product with thyroid tissue cDNA, suggesting that this region contained one or more introns. These experiments were conducted before the availability of information from the Human Genome Sequencing Database, and we therefore empirically designed alternative sets of primers to map the location of the introns. The primer pair PKC{alpha}-E consistently gave a larger-than-predicted PCR product with genomic DNA, which allowed us to map and sequence a 516-bp intron between bases 821 and 822. This intron was subsequently confirmed by a Blat search of the PKC{alpha} coding sequence vs. the UCSC Human Genome Project Working Draft (http://genome.ucsc.edu/) (Table 2Go). In addition, the Blat analysis identified an additional 43642-bp intron between bases 918 and 919. Using the sequence from the PKC{alpha}-E PCR product, we designed two primer pairs, PKC{alpha}-I and PKC{alpha}-J, which were then used to amplify the target region of PKC{alpha} from genomic DNA. To validate the SSCP screening of genomic DNA for the position 881A>G substitution (amino acid 294), we generated controls by cloning a genomic fragment of the wild-type PKC{alpha} gene flanking position 881 into the pCR vector. In addition, an A-to-G substitution at 881 was generated by site-directed mutagenesis. Analysis of PCR products generated by either primer pairs I or J demonstrated that, under the SSCP conditions employed, we could distinguish between the wild-type and mutant PKC{alpha} at position 881 (Fig. 1AGo).


View this table:
[in this window]
[in a new window]
  		Table 2. Exon/intron junctions of the PKC{alpha} gene

 


View larger version (65K):
[in this window]
[in a new window]
  		Figure 1. SSCP analysis of PKC{alpha} mutations in thyroid neoplasms. A, Validation of the controls used for the SSCP screening. Primer pairs PKC{alpha}-I (lanes 1–2) and PKC{alpha}-J (lanes 3–4) were used to amplify the wild-type (Wt) and mutant (881A>G) templates in the presence of {alpha}P (32 ) dCTP. The PCR products were electrophoresed through an SSCP gel, dried, and exposed to X-film at -70 C with intensifying screen. B, Representative autoradiogram of an SSCP gel containing {alpha}P (32 ) dCTP-labeled PCR products generated by amplification of the indicated tumor type using primer pair PKC{alpha}-J. The gel contained 6 FAs, 7 PCs, and 5 FCs. The only PCR product displaying an aberrantly migrating band (lane 1) was generated from the control template containing the PKC{alpha} 881A>G mutation.

 
Primer pairs I and J were subsequently used to screen genomic DNA of 62 thyroid tumors: 42 follicular adenomas (FAs), 12 PCs, 7 follicular carcinomas (FCs), and 1 anaplastic carcinoma (AC). A representative SSCP gel using primer pair J is shown in Fig. 1BGo. Here all tumor samples present a similar pattern, in contrast to the faster migrating band seen with the mutant DNA control. Only five tumors displayed suspect mobility shifts. These bands were excised from the gel, DNA extracted, and product reamplified and sequenced. In all five cases, a wild-type sequence was found. In addition, we directly sequenced three additional PCR products from tumor samples with normal SSCP patterns, and all were wild type.

SAOH analysis of PKC{alpha}. Because of the discrepancy between our findings and those of the previously reported study (28), we elected to repeat the screen for the 881A>G substitution using another methodology. SAOH was performed on 29 of the 62 neoplasms examined by SSCP as well as an additional 15 FAs and 14 PCs. Altogether 49 thyroid neoplasms (31 FAs, 10 PCs, 7 FCs, and 1 AC) were examined by SAOH. An oligonucleotide probe containing the wild-type sequence of PKC{alpha} hybridized to PCR amplified tumor genomic DNA products from each of the 49 cases (Fig. 2AGo), whereas only the PKC{alpha} mutant controls hybridized to the probe containing the 881A>G substitution (Fig. 2BGo). These results confirm that the 881A>G mutation is not present in this series of thyroid neoplasms.



View larger version (52K):
[in this window]
[in a new window]
  		Figure 2. SAOH analysis of thyroid neoplasms. Representative autoradiogram of a membrane dotted with PCR products generated by amplification of 35 tumor samples or the indicated control templates using primer pair PKC{alpha}-J. The membrane was hybridized with 32P-labeled oligonucleotide complementary to the PKC{alpha} 881A>G (left) or 32P-labeled oligonucleotide complementary to wild-type PKC{alpha} (right) (see Table 1Go). The arrows indicate the location of PCR products generated from the following templates: (N) wild-type PKC{alpha}, (M) PKC{alpha} 881A>G mutation, and (N/M) 1:4 mixture of PKC{alpha} 881A>G to wild type.

 
Analysis of PKC{epsilon} by SSCP. To investigate the occurrence of point mutations of PKC{epsilon} in thyroid neoplasms, we examined 15 PCs, 10 FAs, and 6 FCs for point mutations in the V1 region (mutated in the WRO cell line) or the region containing the phosphate transfer domain and activation loop. We determined the intron/exon junctions of the PKC{epsilon} gene in these two regions using a Blat search of the PKC{epsilon} coding sequence vs. the UCSC Human Genome Project Working Draft (http://genome.ucsc.edu). This showed that the V1 region was part of a single exon, whereas the phosphate transfer domain and activation loop was encoded in four different exons (Table 3Go). With this information we designed primer pairs 1–5 within the respective flanking introns to amplify the indicated exons using genomic DNA as template (Table 4Go). Because the size of exon 1 (nucleotides 1–348) is beyond the optimal range for SSCP analysis, we used two overlapping primer pairs for this region. Sequencing of PCR products from shifted bands identified the following changes: a 1761C>T silent polymorphism in 7 of 31 samples, and an A-to-G substitution 23 bp into intron 1 in 10 of 31 samples. The 1761C>T substitution was confirmed to be a germline variation by sequencing corresponding normal tissue. The A-to-G intron substitution was identified as a single nucleotide polymorphism in the NCBI database. No other changes were found. To determine whether other regions of PKC{epsilon} were mutated, we examined the entire coding sequence of PKC{epsilon} in 3 FCs and 13 PCs. Twelve overlapping pairs of primers spanning the entire length of the PKC{epsilon} coding sequence were used to screen these samples using cDNA as a template (Table 4Go). Besides additional confirmation of the 1761C>T polymorphism, no other changes were found.


View this table:
[in this window]
[in a new window]
  		Table 3. Exon/intron junctions of the PKC{varepsilon} gene

 
Analysis of PKC{epsilon} by Southern blotting. The mutation of PKC{epsilon} previously reported in WRO cells was a complex rearrangement resulting in expression of a truncated gene product (37). To investigate whether similar changes were present in PCs, Southern blots of EcoRI digested DNA from nine normal/tumor pairs were probed with 32P-labeled full length PKC{epsilon} cDNA. None of the tumors exhibited restriction fragments that varied in size or intensity from those seen in the corresponding normal tissues (Fig. 3Go), indicating that large-scale rearrangements were not present.



View larger version (76K):
[in this window]
[in a new window]
  		Figure 3. Southern blot analysis of PKC{epsilon} in PCs. Southern blot containing 10 µg EcoRI-digested DNA from paired normal (N) and PC tumor tissue samples (T). The blot was hybridized with a 32P-labeled full length PKC{epsilon} cDNA and exposed to x-ray film at -70 C with intensifying screen.

 
Analysis of PKC{epsilon} and {alpha} in PC by Western blotting. In a previous report, PKC{alpha} was found to be elevated in human follicular thyroid neoplasms, compared with paired normal thyroid controls by Western blotting (28). There is also evidence that the subcellular distribution of 881A>G PKC{alpha} is abnormal in Rat 6 cells in vitro. In addition, we have previously reported that expression of a truncated mutant of PKC{epsilon} containing the V1 domain of the protein abrogates activation-induced translocation of endogenous PKC{epsilon} (38). To determine whether similar alterations in abundance or localization of either PKC{epsilon} or PKC{alpha} were present in PCs, Western blots of particulate and soluble fractions from six normal/tumor paired specimens of thyroid PCs were sequentially probed with anti-PKC{epsilon} or anti-PKC{alpha} IgGs. As shown in Fig. 4AGo, there was no consistent difference in subcellular distribution of PKC{epsilon} or PKC{alpha} between the tumor and normal tissues from the same patients. However, in four of the six tumors, PKC{epsilon} expression was markedly reduced, compared with corresponding normal tissue (Fig. 4AGo and Table 5Go). In contrast, PKC{alpha} levels were similar or slightly higher in the six tumors (Fig. 4AGo, Table 5Go). To exclude potential confounding effects of losses during fractionation, Western blots of total lysates from an additional five normal/tumor pairs of PCs were examined. PKC{epsilon} levels were markedly reduced in four of five PCs, whereas only one of five had lower PKC{alpha} immunoreactivity (Fig. 4BGo and Table 5Go). Thus, altogether 8 of 11 PCs had markedly decreased levels of PKC{epsilon}. To determine whether the reduced abundance of PKC{epsilon} was due to a decrease in PKC{epsilon} mRNA, RT-PCR was used to quantify PKC{epsilon} mRNA levels in seven PCs with reduced and two with normal PKC{epsilon} protein levels. As summarized in Table 5Go, tumors with reduced PKC{epsilon} protein did not have a corresponding reduction in PKC{epsilon} mRNA. These results suggest that a translational, or more likely a posttranslational mechanism, is responsible for the reduced level of PKC{epsilon} protein seen in the PC tissues (Table 5Go).



View larger version (58K):
[in this window]
[in a new window]
  		Figure 4. Western blot analysis of PKC{alpha}, PKC{epsilon}, and MDM2 in PC. A, Fifty micrograms of protein from either the soluble (S) or particulate (P) fractions of PC or corresponding normal thyroid tissue samples were electrophoresed in a 7.5% SDS-PAGE and transferred to a nitrocellulose membrane. B, Fifty micrograms of protein from total cell lysates of PCs or corresponding normal thyroid tissue were electrophoresed in a 7.5% SDS-PAGE and transferred to a nitrocellulose membrane. PKC{epsilon} and PKC{alpha} were detected using rabbit polyclonal anti-PKC{epsilon} anti-PKC{alpha} IgG, respectively (Santa Cruz Biotechnology, Santa Cruz, CA), and a HRP-conjugated goat antirabbit IgG. ß-Actin was detected using monoclonal anti-ß-actin IgG (Santa Cruz Biotechnology) and a HRP-conjugated goat antimouse IgG. C, Membrane from panel B was reprobed with mouse monoclonal anti-MDM2 IgG (Santa Cruz Biotechnology) and a HRP-conjugated goat antimouse IgG.

 

View this table:
[in this window]
[in a new window]
  		Table 5. Analysis of PKC{alpha} and {varepsilon} in thyroid papillary carcinomas

 
Increase in MDM2 expression is associated with reduced expression of PKC{epsilon}. In a previous report, we showed that PKC{epsilon} may be involved in signal transduction pathways regulating MDM2 expression or stability (38). We investigated whether the reduction in PKC{epsilon} levels observed in the PCs was associated with changes in abundance of MDM2. Western blots containing total cell extracts demonstrated a 1.6- to 4-fold increase in expression of MDM2 in four of five PCs (Fig. 4CGo). Western blots containing insoluble and soluble fraction (data not shown) identified an additional three of six PCs with elevated MDM2 levels. Interestingly, all tumors with elevated MDM2 expression also had reduced expression of PKC{epsilon}. The inverse relationship between PKC{epsilon} and MDM2 levels was first examined with Spearman’s rank correlation. The correlation coefficient between PKC{epsilon} and MDM2 was -0.57 with a P value of 0.0679, whereas the correlation coefficient between PKC{alpha} and MDM2 was -0.45 with a P value of 0.1466. This was highly suggestive but not conclusive evidence for a negative correlation between PKC{epsilon} and MDM2 levels in thyroid papillary carcinomas. However, this statistical tool assumes a linear relationship, which may not be the case. To further investigate whether there is a negative correlation between PKC{epsilon} and MDM2, we counted the number of patients that had discordant levels of these two proteins (see Materials and Methods). When we categorized the data as described, 9 of 11 patients had discordant levels of PKC{epsilon} and MDM2. The probability of this happening under the assumption that concordant cases are equally probable as discordant ones (P value) is less than 0.01, supporting the negative correlation between PKC{epsilon} and MDM2 expression in thyroid papillary carcinomas.

Analysis of PKC{epsilon} and {alpha} in follicular adenomas. To determine whether follicular adenomas also had similar reduction in PKC{epsilon}, Western blots of total lysates from normal/tumor pairs of FAs were performed. We found that two of the three neoplasms had reduced PKC{epsilon} protein levels (51.9% and 65.1%), compared with corresponding normal tissue. Fresh frozen samples of FCs were not available for Western blot analysis.

Discussion

The purpose of this study was to explore the possible role of genetic or epigenetic changes in PKC{alpha} and {epsilon} in thyroid tumorigenesis. The rationale was based in part on the fact that PKC isozymes are positioned in the effector pathway of several known thyroid growth factors and oncogenes. In addition, a specific role for putative somatic mutations of PKC{alpha} has been proposed in thyroid follicular neoplasms. A role for gain-of-function mutations in PKC{alpha} was initially proposed by Megidish and Mazurek (47), who identified abnormal subcellular distribution of PKC{alpha} in UV-induced fibrosarcoma cell lines. PKC{alpha} cDNA from one of these cell lines was found to contain four somatic mutations leading to three amino acid substitutions in the regulatory domain and one in the catalytic domain (47, 48, 49). Mutant, but not wild-type, PKC{alpha} evoked transformation of Balb/c 3T3 fibroblasts, although Borner et al. (50) were unable to reproduce these observations. In light of this, the identification of spontaneously arising somatic point mutations of PKC{alpha} in human pituitary and thyroid neoplasms was of major interest. In the case of human thyroid tumors, their presence in both benign and malignant neoplasms appeared to place PKC{alpha} mutations as one of the early events in thyroid tumor progression. One notable feature was the presence of an identical A-to-G transition at base pair 881 in all tumors, a rare occurrence in tumor genetics. Here we were unable to confirm the presence of the PKC{alpha} 881 mutation in any of the 91 thyroid neoplasms we tested with SSCP, SAOH, or by direct sequencing. We used multiple screening modalities because of initial difficulties in replicating the conditions used in the original report and for added verification. In the original report, the authors used primer pair PKC{alpha}-A (Table 1Go) to generate genomic PCR products used to screen for mutations. However, we identified two introns within the region amplified by this primer pair (Table 2Go), suggesting that the Prevostel et al. study (28) was likely performed on cDNA. We cannot rule out the possibility that our inability to find the 881 mutation of PKC{alpha} is because of regional differences in prevalence of this anomaly. We did not specifically study autonomously functioning thyroid nodules or undifferentiated carcinomas, and it is conceivable, although unlikely, that mutations may be confined to these histotypes.

Of all PKC isozymes, PKC{epsilon} has proven to be the most consistently transforming when transfected into murine fibroblasts (2, 3). When overexpressed in rat 6 embryonal fibroblasts, PKC{epsilon} produced malignant transformation in the absence of treatment with phorbol esters. In the presence of 12-O-Tetradecanoyl Phorbol 13-acetate, PKC{epsilon}-transfected cells exhibited a rearranged actin cytoskeleton and were growth inhibited, probably due in part to interference of the overexpressed isozyme with the translocation and activation of other PKC isozymes. We focused our attention on the role of this isozyme in thyroid cancer following the discovery of a rearrangement in the V1 region of PKC{epsilon} in the thyroid carcinoma cell line WRO. This rearrangement encoded a truncated PKC{epsilon} (amino acid 1–116) that acted as a dominant-negative inhibitor of translocation of the wild-type form of the isozyme (38). However, we found no large-scale rearrangements in the PKC{epsilon} gene by Southern blotting of nine normal/tumor pairs of papillary carcinomas. In addition to the loss of function found in cells expressing the truncated V1 domain, others have shown that kinase-dead mutants of PKC{epsilon} (51) or mutations in the activation loop of PKC{epsilon} (52) also act as dominant-negative inhibitors. Because mutants in these three domains have functional consequences, we focused our screening efforts in these regions. The two SSCP conditions we employed (with and without 20 mM HEPES) have been reported to be up to 96% efficient in detecting point mutations (53). Although it is likely that our sensitivity may be lower than this, we believe that our inability to find mutations in the V1, kinase domain, or activation loop of PKC{epsilon} in 30 thyroid neoplasms indicates these regions are rarely if ever altered in thyroid neoplasms. Although we cannot exclude the possibility that other regions of PKC{epsilon} may occasionally harbor somatic changes, it seems unlikely because we found no mutations in the 3 FCs and 13 PCs in which the entire PKC{epsilon} coding sequence was examined.

In this report, we demonstrate by Western blotting that PKC{epsilon} levels are significantly and often strikingly reduced in the majority of the thyroid PCs we examined. Our data suggest that the reduced expression of PKC{epsilon} is likely a posttranscriptional event affecting translation or stability of the PKC{epsilon} protein. Evidence for this includes: (1) comprehensive screening of the entire coding sequence in six PCs with reduced expression of PKC{epsilon} did not identify mutations altering the PKC{epsilon} amino acid sequence; and (2) lack of correspondence between PKC{epsilon} mRNA as detected by semiquantitative RT-PCR and immunoreactive PKC{epsilon} levels in papillary carcinomas. Of note, PKC{alpha} protein levels were not decreased in the majority of the tumors examined and indeed tended to be higher, as described initially by Prevostel et al. (28) in a small number of follicular neoplasms. Differences in cellular content or tissue architecture between normal and tumor tissues can alter protein representation in Western blots. However, this is unlikely to account for the reduction in PKC{epsilon} seen in the tumor tissues. As shown in Fig. 4Go, B and C, all but one of the tumor samples had PKC{alpha} and MDM2 levels that were either similar or greater than those found in normal tissue. Furthermore, one would predict that if protein representation changes were due to differences in tissue architecture (i.e. more acellular colloid in normal samples), then similar alterations in mRNA levels would also be observed, which was not the case. The cause of the isozyme-specific decrease in PKC{epsilon} abundance remains to be clarified. However, one explanation may be that the presence of a sustained upstream activation signal leads to down-regulation of the isozyme. In this regard, we have recently observed that acute expression of the oncogenes RET/PTC1 or RET/PTC3 in rat thyroid PCCL3 cells results in isozyme-specific translocation of PKC{epsilon}. Furthermore, a reduction in PKC{epsilon} levels is found in cells chronically expressing RET/PTC3 (Knauf, J.A., and J.A. Fagin, unpublished data).

The MDM2 gene has been classified as an oncogene based on its behavior in human tumors (39, 54). Activating mutations of MDM2 are rare in cancers; however, overexpression of MDM2 is found in a wide variety of human tumors (55), including thyroid cancers (56). In a previous report, we found that expression of a dominant-negative PKC{epsilon} mutant protects thyroid cells from doxorubicin-induced apoptosis, which was associated with increased degradation of p53, likely because of higher MDM2 levels (38). Accordingly, here we demonstrate that in all seven PC with overexpression of MDM2, there was also a reduction in PKC{epsilon} levels. These data raise the possibility that PKC{epsilon} may either directly or indirectly regulate levels of MDM2 in thyroid cells, thus impacting the ability of cells to mount p53-mediated stress responses.

We conclude that post-transcriptional changes resulting in decreased abundance of PKC{epsilon} are frequent in thyroid neoplasms. The significance of the isozyme-specific decrease in PKC{epsilon} abundance remains to be clarified. However, based on functional studies in thyroid cells in culture (38), we propose that decreased abundance of this PKC isozyme may promote tumor progression by prolonging cellular life span.

Acknowledgments

Footnotes

J.A.K. and L.S.W. contributed equally to this work.

This work was supported in part by NIH Grants CA50706 and CA72597 (to J.A.F.), K01DK02781 (to J.A.K.), and M01-RR08084.

Abbreviations: AC, Anaplastic carcinoma; FA, follicular adenoma; FC, follicular carcinoma; HRP, horseradish peroxidase; PC, papillary carcinoma; PMA, phorbol 12-myristate 13-acetate; SAOH, specific allele oligonucleotide hybridization; SSCP, single-strand conformation polymorphism analysis.

Received April 2, 2001.

Accepted December 6, 2001.

References

  1. Mellor H, Parker PJ 1998 The extended protein kinase C superfamily. Biochem J 332:281–292
  2. Cacace AM, Guadagno SN, Krauss RS, Fabbro D, Weinstein IB 1993 The {epsilon} isoform of protein kinase C is an oncogene when overexpressed in rat fibroblasts. Oncogene 8:2095–2104[Medline]
  3. Mischak H, Goodnight JA, Kolch W, Martiny-Baron G, Schaechtle C, Kazanietz MG, Blumberg PM, Pierce JH, Mushinski JF 1993 Overexpression of protein kinase C-{Delta} and -{epsilon} in NIH 3T3 cells induces opposite effects on growth, morphology, anchorage dependence, and tumorigenicity. J Biol Chem 268:6090–6096[Abstract/Free Full Text]
  4. Ahmad S, Mineta T, Martuza RL, Glazer RI 1994 Antisense expression of protein kinase C {alpha} inhibits the growth and tumorigenicity of human glioblastoma cells. Neurosurgery 35:904–908[Medline]
  5. Fujimoto J, Brenner-Gati L 1992 Protein kinase-C activation during thyrotropin-stimulated proliferation of rat FRTL-5 thyroid cells. Endocrinology 130:1587–1592[Abstract/Free Full Text]
  6. Gamard CJ, Blobe GC, Hannun YA, Obeid LM 1994 Specific role for protein kinase C ß in cell differentiation. Cell Growth Differ 5:405–409[Abstract]
  7. Wooten MW, Zhou G, Seibenhener ML, Coleman ES 1994 A role for {zeta} protein kinase C in nerve growth factor-induced differentiation of PC12 cells. Cell Growth Differ 5:395–403[Abstract]
  8. Sawai H, Okazaki T, Takeda Y, Tashima M, Sawada H, Okuma M, Kishi S, Umehara H, Domae N 1997 Ceramide-induced translocation of protein kinase C-8 and -{epsilon} to the cytosol. Implications in apoptosis. J Biol Chem 272:2452–2458[Abstract/Free Full Text]
  9. Hug H, Sarre TF 1993 Protein kinase C isoenzymes: divergence in signal transduction? Biochem J 291:329–343
  10. O’Brian CA, Ward NE 1989 Biology of the protein kinase C family. Cancer Metastasis Rev 8:199–214[CrossRef][Medline]
  11. Blobe GC, Obeid LM, Hannun YA 1994 Regulation of protein kinase C and role in cancer biology. Cancer Metastasis Rev 13:411–431[CrossRef][Medline]
  12. Marks F, Gschwendt M 1995 Protein kinase C and skin tumor promotion. Mutat Res 333:161–172[CrossRef][Medline]
  13. DiGiovanni J 1992 Multistage carcinogenesis in mouse skin. Pharmacol Ther 54:63–128[CrossRef][Medline]
  14. Gschwendt M, Furstenberger G, Rose-John S, Rogers M, Kittstein W, Pettit GR, Herald CL, Marks F 1988 Bryostatin 1, an activator of protein kinase C, mimics as well as inhibits biological effects of the phorbol ester TPA in vivo and in vitro. Carcinogenesis 9:555–562[Abstract/Free Full Text]
  15. Hennings H, Blumberg PM, Pettit GR, Herald CL, Shores R, Yuspa SH 1987 Bryostatin 1, an activator of protein kinase C, inhibits tumor promotion by phorbol esters in SENCAR mouse skin. Carcinogenesis 8:1343–1346[Abstract/Free Full Text]
  16. Szallasi Z, Smith CB, Pettit GR, Blumberg PM 1994 Differential regulation of protein kinase C isozymes by bryostatin 1 and phorbol 12-myristate 13-acetate in NIH 3T3 fibroblasts. J Biol Chem 269:2118–2124[Abstract/Free Full Text]
  17. Szallasi Z, Kosa K, Smith CB, Dlugosz AA, Williams EK, Yuspa SH, Blumberg PM 1995 Differential regulation by anti-tumor-promoting 12-deoxyphorbol- 13-phenylacetate reveals distinct roles of the classical and novel protein kinase C isozymes in biological responses of primary mouse keratinocytes. Mol Pharmacol 47:258–265[Abstract]
  18. Reddig PJ, Dreckschmidt NE, Ahrens H, Simsiman R, Tseng CP, Zou J, Oberley TD, Verma AK 1999 Transgenic mice overexpressing protein kinase C {Delta} in the epidermis are resistant to skin tumor promotion by 12-O-tetradecanoylphorbol-13-acetate. Cancer Res 59:5710–5718[Abstract/Free Full Text]
  19. Reddig PJ, Dreckschmidt NE, Zou J, Bourguignon SE, Oberley TD, Verma AK 2000 Transgenic mice overexpressing protein kinase C {epsilon} in their epidermis exhibit reduced papilloma burden but enhanced carcinoma formation after tumor promotion. Cancer Res 60:595–602[Abstract/Free Full Text]
  20. Gschwendt M 1999 Protein kinase C {delta}. Eur J Biochem 259:555–564[Medline]
  21. Perletti GP, Folini M, Lin HC, Mischak H, Piccinini F, Tashjian AHJ 1996 Overexpression of protein kinase C {epsilon} is oncogenic in rat colonic epithelial cells. Oncogene 12:847–854[Medline]
  22. Manzow S, Richter KH, Stempka L, Furstenberger G, Marks F 2000 Evidence against a role of general protein kinase C down-regulation in skin tumor promotion. Int J Cancer 85:503–507[CrossRef][Medline]
  23. Borner C, Guadagno SN, Hsieh LL, Hsiao WL, Weinstein IB 1990 Transformation by a ras oncogene causes increased expression of protein kinase C-{alpha} and decreased expression of protein kinase C-{epsilon}. Cell Growth Differ 1:653–660[Abstract]
  24. Borner C, Guadagno SN, Hsiao WW, Fabbro D, Barr M, Weinstein IB 1992 Expression of four protein kinase C isoforms in rat fibroblasts. Differential alterations in ras-, src-, and fos-transformed cells. J Biol Chem 267:12900–12910[Abstract/Free Full Text]
  25. Pongracz J, Clark P, Neoptolemos JP, Lord JM 1995 Expression of protein kinase C isoenzymes in colorectal cancer tissue and their differential activation by different bile acids. Int J Cancer 61:35–39[Medline]
  26. Hagiwara M, Hachiya T, Watanabe M, Usuda N, Iida F, Tamai K, Hidaka H 1990 Assessment of protein kinase C isozymes by enzyme immunoassay and overexpression of type II in thyroid adenocarcinoma. Cancer Res 50:5515–5519[Abstract/Free Full Text]
  27. Shimizu T, Usuda N, Sugenoya A, Masuda H, Hagiwara M, Hidaka H, Nagata T, Iida F 1991 Immunohistochemical evidence for the overexpression of protein kinase C in proliferative diseases of human thyroid. Cell Mol Biol 37:813–821[Medline]
  28. Prevostel C, Alvaro V, Boisvilliers F, Martin A, Jaffol C, Joubert D 1995 The natural protein kinase C {alpha} mutant is present in human thyroid neoplasms. Oncogene 11:669–674[Medline]
  29. Kraiem Z, Sadeh O, Yosef M, Aharon A 1995 Mutual antagonistic interactions between the thyrotropin (adenosine 3',5'-monophosphate) and protein kinase C/epidermal growth factor (tyrosine kinase) pathways in cell proliferation and differentiation of cultured human thyroid follicles. Endocrinology 136:585–590[Abstract]
  30. Matowe WC, Ginsberg J 1995 Increased membrane-bound protein kinase C in porcine thyroid cells following TSH exposure. Clin Invest Med 18:186–192[Medline]
  31. Parma J, Duprez L, Van Sande J, Cochaux P, Gervy C, Mockel J, Dumont J, Vassart G 1993 Somatic mutations in the thyrotropin receptor gene cause hyperfunctioning thyroid adenomas. Nature 365:649–651[CrossRef][Medline]
  32. Lyons J, Landis CA, Harsh G, Vallar L, Grunewald K, Feichtinger H, Duh Q-Y, Clark OH, Kawasaki E, Bourne HR, McCormick F 1990 Two G protein oncogenes in human endocrine tumors. Science 249:655–659[Abstract/Free Full Text]
  33. Laurent E, Mockel J, Van Sande J, Graff I, Dumont JE 1987 Dual activation by thyrotropin of the phospholipase C and cyclic AMP cascades in human thyroid. Mol Cell Endocrinol 52:273–278[CrossRef][Medline]
  34. Alvaro V, Levy L, Dubray C, Roche A, Peillon F, Querat B, Joubert D 1993 Invasive human pituitary tumors express a point-mutated {alpha}-protein kinase-C. J Clin Endocrinol Metab 77:1125–1129[Abstract]
  35. Prevostel C, Martin A, Alvaro V, Jaffiol C, Joubert D 1997 Protein kinase C {alpha} and tumorigenesis of the endocrine gland. Horm Res 47:140–144[Medline]
  36. Alvaro V, Prevostel C, Joubert D, Slosberg E, Weinstein BI 1997 Ectopic expression of a mutant form of PKC {alpha} originally found in human tumors: aberrant subcellular translocation and effects on growth control. Oncogene 14:677–685[CrossRef][Medline]
  37. Chen X, Knauf JA, Gonsky R, Wang M, Lai EH, Chissoe S, Fagin JA, Korenberg JR 1998 From amplification to gene in thyroid cancer: a high-resolution mapped bacterial-artificial-chromosome resource for cancer chromosome aberrations guides gene discovery after comparative genome hybridization. Am J Hum Genet 63:625–637[CrossRef][Medline]
  38. Knauf JA, Elisei R, Mochly-Rosen D, Liron T, Chen XN, Gonsky R, Korenberg JR, Fagin JA 1999 Involvement of protein kinase C {epsilon} (PKC{epsilon}) in thyroid cell death: a truncated chimeric PKC{epsilon} cloned from a thyroid cancer cell line protects thyroid cells from apoptosis. J Biol Chem 274:23414–23425[Abstract/Free Full Text]
  39. Freedman DA, Wu L, Levine AJ 1999 Functions of the MDM2 oncoprotein. Cell Mol Life Sci 55:96–107[CrossRef][Medline]
  40. Davis LG, Dibner MD, Battery JF 1986 Basic methods in molecular biology. New York: Elsevier
  41. Nikiforov YE, Nikiforova MN, Gnepp DR, Fagin JA 1996 Prevalence of mutations of ras and p53 in benign and malignant thyroid tumors from children exposed to radiation after the Chernobyl nuclear accident. Oncogene 13:687–693[Medline]
  42. Orita M, Suzuki Y, Sekiya T, Hayashi K 1989 Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874–879[CrossRef][Medline]
  43. Gonsky R, Knauf JA, Elisei R, Wang JW, Su S, Fagin JA 1997 Identification of rapid turnover transcripts overexpressed in thyroid tumors and thyroid cancer cell lines: use of a targeted differential RNA display method to select for mRNA subsets. Nucleic Acids Res 25:3823–3831[Abstract/Free Full Text]
  44. Burns D, Strickland M, Holmes W, Loomis C, Ballas L 1992 Sequence and expression of human protein kinase C-{epsilon}. Biochim Biophys Acta 1134:154–160
  45. Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685[CrossRef][Medline]
  46. Towbin H, Staehelin T, Gordon J 1979 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 76:4350–4354[Abstract/Free Full Text]
  47. Megidish T, Mazurek N 1989 A mutant protein kinase C that can transform fibroblasts. Nature 342:807–811[CrossRef][Medline]
  48. Genot EM, Parker PJ, Cantrell DA 1995 Analysis of the role of protein kinase C-{alpha}, -{epsilon}, and -{zeta} in T cell activation. J Biol Chem 270:9833–9839[Abstract/Free Full Text]
  49. Uberall F, Giselbrecht S, Hellbert K, Fresser F, Bauer B, Gschwendt M, Grunicke HH, Baier G 1997 Conventional PKC-{alpha}, novel PKC-{epsilon} and PKC-theta, but not atypical PKC-lambda are MARCKS kinases in intact NIH 3T3 fibroblasts. J Biol Chem 272:4072–4078[Abstract/Free Full Text]
  50. Borner C, Filipuzzi I, Weinstein IB, Imber R 1991 Failure of wild-type or a mutant form of protein kinase C-{alpha} to transform fibroblasts. Nature 353:78–80[CrossRef][Medline]
  51. Ohno S, Mizuno K, Adachi Y, Hata A, Akita Y, Akimoto K, Osada S, Hirai S, Suzuki K 1994 Activation of novel protein kinases C {delta} and C {epsilon} upon mitogenic stimulation of quiescent rat 3Y1 fibroblasts. J Biol Chem 269:17495–17501[Abstract/Free Full Text]
  52. Garcia-Paramio P, Cabrerizo Y, Bornancin F, Parker PJ 1998 The broad specificity of dominant inhibitory protein kinase C mutants infers a common step in phosphorylation. Biochem J 333:631–636
  53. Liu Q, Sommer SS 1998 The SSCP phenomenon: addition of HEPES buffer dramatically affects electrophoretic mobility. Biotechniques 25:50–52, 54, 56[Medline]
  54. Momand J, Wu HH, Dasgupta G 2000 MDM2—master regulator of the p53 tumor suppressor protein. Gene 242:15–29[CrossRef][Medline]
  55. Momand J, Jung D, Wilczynski S, Niland J 1998 The MDM2 gene amplification database. Nucleic Acids Res 26:3453–3459[Abstract/Free Full Text]
  56. Horie S, Maeta H, Endo K, Ueta T, Takashima K, Terada T 2001 Overexpression of p53 protein and MDM2 in papillary carcinomas of the thyroid: correlations with clinicopathologic features. Pathol Int 51:11–15[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J EndocrinolHome page
K. Krause, S. Karger, S.-Y. Sheu, T. Aigner, R. Kursawe, O. Gimm, K.-W. Schmid, H. Dralle, and D. Fuhrer
Evidence for a role of the amyloid precursor protein in thyroid carcinogenesis
J. Endocrinol., August 1, 2008; 198(2): 291 - 299.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. E. Santiago-Walker, A. J. Fikaris, G. D. Kao, E. J. Brown, M. G. Kazanietz, and J. L. Meinkoth
Protein Kinase C {delta} Stimulates Apoptosis by Initiating G1 Phase Cell Cycle Progression and S Phase Arrest
J. Biol. Chem., September 16, 2005; 280(37): 32107 - 32114.
[Abstract] [Full Text] [PDF]

Home page
 J. Am. Soc. Nephrol.Home page
F. Lang
Regulating Renal Drug Elimination?
J. Am. Soc. Nephrol., June 1, 2005; 16(6): 1535 - 1536.
[Full Text] [PDF]

Home page
 J. Cell Sci.Home page
C. Quittau-Prevostel, N. Delaunay, A. Collazos, A. Vallentin, and D. Joubert
Targeting of PKC{alpha} and {epsilon} in the pituitary: a highly regulated mechanism involving a GD(E)E motif of the V3 region
J. Cell Sci., January 1, 2004; 117(1): 63 - 72.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Knauf, J. A.
Right arrow Articles by Fagin, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Knauf, J. A.
Right arrow Articles by Fagin, J. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals