help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khoo, M. L. C.
Right arrow Articles by Asa, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khoo, M. L. C.
Right arrow Articles by Asa, S. L.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 4 1810-1813
Copyright © 2002 by The Endocrine Society


Other Original Articles

Cyclin D1 Protein Expression Predicts Metastatic Behavior in Thyroid Papillary Microcarcinomas But Is Not Associated with Gene Amplification

Mark L. C. Khoo, Shereen Ezzat, Jeremy L. Freeman and Sylvia L. Asa

Department of Pathology, University Health Network (M.L.C.K., S.L.A.); Departments of Otolaryngology (M.L.C.K., J.L.F.) and Medicine (Endocrinology) (S.E.), Mount Sinai Hospital; and Departments of Laboratory Medicine and Pathobiology (S.L.A.), Otolaryngology (J.L.F.), and Medicine (S.E.), University of Toronto, Toronto, Ontario, Canada M5G 2M9

Address all correspondence and requests for reprints to: Sylvia L. Asa, M.D., Ph.D., Department of Pathology, University Health Network, 610 University Avenue, Suite 4-302, Toronto, Ontario M5G 2 M9, Canada. E-mail: . sylvia.asa{at}uhn.on.ca

Abstract

Overexpression of cyclin D1 occurs in several malignancies, often due to gene amplification, and this has been associated with aggressive tumor behavior, a higher incidence of lymph node metastases, and a poorer prognosis. The role of cyclin D1 in the pathogenesis of thyroid malignancy is unknown; however, cyclin D1 expression has been reported to occur in a proportion of well differentiated thyroid carcinomas. Micropapillary carcinomas of the thyroid are common incidental findings that almost always behave in an indolent manner and remain quiescent. However, rare microcarcinomas behave aggressively and metastasize early, giving rise to clinically significant disease. We hypothesized that cyclin D1 might play a role in the aggressive behavior of metastasizing papillary microcarcinomas. We reviewed the histopathology reports of 2,000 patients who underwent thyroid surgery at our institution between 1995–1999 and identified 22 patients who presented with gross regional metastases from a primary papillary microcarcinoma. These patients formed the index cohort for this analysis. As controls, we selected 34 patients with nonmetastasizing microcarcinomas. We studied these tumors for immunoreactivity to cyclin D1 on immunohistochemistry and analyzed 13 tumors that diffusely expressed cyclin D1 for gene amplification by differential PCR. Twenty of the 22 (90.9%) metastasizing papillary microcarcinomas expressed cyclin D1, compared with 3 of the 34 (8.8%) nonmetastasizing papillary microcarcinomas (P < 0.001). However, of the 13 tumors that showed diffuse immunoreactivity for cyclin D1 on immunohistochemistry, none showed amplification of the cyclin D1 gene on differential PCR. We conclude that cyclin D1 is significantly overexpressed in metastasizing papillary microcarcinomas of the thyroid. This is likely due to mechanisms other than gene amplification. Cyclin D1 immunohistochemistry may be a valuable tool in predicting metastatic potential in papillary microcarcinomas.

PAPILLARY MICROCARCINOMAS (PMCs) of the thyroid are defined as small papillary carcinomas measuring less than 1 cm in maximum dimension. They are extremely common findings on histopathology following both thyroid surgery and autopsy (1). The vast majority of PMCs behave in an indolent manner and do not give rise to clinically significant disease (1). Therefore, when these tumors are encountered, most clinicians regard them as incidental findings of little clinical significance.

Although larger papillary thyroid carcinomas have a strong propensity to metastasize to regional lymph nodes, lymph node metastases from PMCs are very uncommon. Nonetheless, on rare occasions, a PMC behaves aggressively and metastasizes early, presenting with clinically evident lymph node metastases. These tumors then result in significant morbidity and mortality (2).

At present, traditional histopathological assessment cannot distinguish between the typical PMC, which almost always remains quiescent, and the unusual PMC, which has the potential to behave aggressively. Recent data suggest that down-regulation of p27 may predict the potential for more aggressive behavior in some of these tumors (3).

The cyclin D1 gene is located on chromosome 11q23 and encodes a nuclear protein that is a positive regulator of the cell cycle, facilitating G1 to S phase transition (4). Overexpression of cyclin D1 protein has been found to occur in several malignancies and has been linked to a more aggressive tumor phenotype and a poorer prognosis (5, 6, 7). Cyclin D1 overexpression has also been associated with an increased incidence of lymph node metastases in several cancers (8, 9, 10).

The full spectrum of genetic alterations that underlie cyclin D1 overexpression has not been determined, but certain alterations have been identified, including pericentrimeric chromosomal inversion in parathyroid adenomas t(11,14), and translocation in mantle cell and other B cell non-Hodgkin lymphomas. However, the commonest genetic alteration resulting in cyclin D1 overexpression is amplification of the cyclin D1 gene, and this has been shown to occur in a significant proportion of breast, esophageal, lung, and head and neck squamous carcinomas (11, 12, 13, 14).

Little is known about the role that cyclin D1 plays in the pathogenesis of thyroid cancer. Normal thyroid cells do not show nuclear immunoreactivity for cyclin D1 on immunohistochemistry. However, cyclin D1 expression has been reported to occur in some papillary thyroid carcinomas (15, 16, 17, 18) as well as some Hurthle cell carcinomas (19). Cyclin D1 overexpression has also been reported to be more frequent in poorly differentiated thyroid tumors, compared with well differentiated thyroid tumors (20). A recent report suggests that cyclin D1 expression may be a prognostic factor in papillary thyroid carcinoma (17). Cyclin D1 expression by micropapillary thyroid carcinomas has not been examined. Moreover, the genetic basis of cyclin D1 expression in thyroid carcinomas is not known.

We hypothesized that cyclin D1 overexpression might play a role in the aggressive behavior of metastasizing PMCs. We also hypothesized that this overexpression might be due to amplification of the cyclin D1 gene.

Patients and Methods

The aim of this study was to assess cyclin D1 expression in metastasizing and nonmetastasizing papillary microcarcinomas of the thyroid and to examine cyclin D1 gene amplification in tumors that overexpressed cyclin D1.

Patients

We reviewed the histopathology reports of 2,000 patients who underwent thyroid surgery at our institution after informed consent between 1995–1999 and identified 22 patients who presented with gross lymph node metastases from a primary papillary microcarcinoma of the thyroid gland. These 22 patients formed the index cohort for this analysis. We also randomly selected a control group of 34 patients with incidentally discovered papillary microcarcinomas unassociated with larger thyroid carcinomas of follicular cell derivation and without evidence of metastases on gross and microscopic evaluation. These latter patients all had thyroid surgery for nonmalignant indications, and the PMC was an incidental finding on routine histopathology. All 34 patients had lymph nodes included in the surgical specimen that included thyroid isthmus, all lymph nodes were confirmed to be negative for metastatic malignancy, and all control patients had at least 5 yr of follow-up with no evidence of recurrent or metastatic papillary carcinoma.

We assessed cyclin D1 protein expression in these tumors by immunohistochemistry and selected tumors that overexpressed cyclin D1 for analysis of gene amplification by differential PCR assay.

Immunohistochemistry

Formalin-fixed paraffin-embedded tissue sections 3-µm thick were dewaxed in toluene and rehydrated through graded alcohols to water. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide. Antigen retrieval was performed in 10 mM citrate buffer (pH 6.0) inside a microwave pressure cooker. Endogenous biotin detection was blocked with the Avidin-Biotin blocking kit (Vector Laboratories, Inc. Burlingame, CA).

Primary antibody incubation was carried out overnight at room temperature using a mouse monoclonal antibody for cyclin D1 (Clone DCS-6, DAKO Corp. A/S, Glostrup, Denmark) at 1:50 dilution. Thereafter, slides were washed in PBS, and secondary incubations were carried out using Biotin anti-mouse/anti-rabbit IgG followed by streptavidin-HRP (Signet Pathology System, Dedham, MA) for 30 min. Immunoreactivity was revealed by incubation in 3-amino-9-ethylcarbazol. Slides were counterstained in hematoxylin and mounted on crystal mount. Positive controls were human tumors with known overexpression and amplification of the cyclin D1 gene. Negative controls replaced primary antibody with normal mouse ascites.

Quantitation

Assessment of immunoreactivity was done jointly by two of the authors (M.L.C.K. and S.L.A.). Cyclin D1 expression was graded on the basis of both the intensity of staining within the tumor cells and the percentage of positive cells within each tumor. Only nuclear staining was considered to be positive expression, and isolated cytoplasmic staining was ignored.

The intensity of nuclear staining was graded from 0 to 3 as follows: grade 0, absence of staining; grade 1, faint nuclear staining (requiring high power assessment); grade 2, moderate nuclear staining (easily appreciated at low power); and grade 3, staining for intense nuclear staining.

We graded the distribution of positive cells in tumors that stained for cyclin D1 as follows: grade 1, focal staining in less than 10% of tumor cells; grade 2, fairly widespread staining in 10–50% of tumor cells; and grade 3, diffuse staining in more than 50% of tumor cells.

For the purposes of statistical analysis, tumors were divided into expressers and nonexpressers of cyclin D1. Most tumors that expressed cyclin D1 showed moderate to intense nuclear staining as well as widespread to diffuse distribution of positive cells within the tumor. Nonexpressers generally showed complete absence of nuclear staining within the entire tumor. However, a small number of tumors (3 of 56) showed very faint and very focal nuclear staining (grade 1 intensity, grade 1 distribution). The significance of this faint isolated expression was unclear, and because this pattern was so different from the typical positive staining, we elected to regard these tumors as negative expressers of cyclin D1.

DNA extraction and analysis

Formalin-fixed paraffin-embedded tissue sections were deparaffinized with xylene for 20 min, washed with 100% alcohol for 3 min, then oven-dried at 50 C for 30 min. DNA was then extracted using the QIAGEN DNA extraction kit, following the manufacturer’s instructions with one modification: we digested the tissue for 48 h, adding an additional 20 µl of proteinase K after the first 24 h.

To investigate gene amplification in tumors that overexpressed cyclin D1, we chose 13 tumors that showed diffuse cyclin D1 expression throughout the entire lesion. This ensured that after microdissection and removal of the surrounding non-neoplastic thyroid or lymph node tissue, at least 75% of the remaining tumor cells were expressers of cyclin D1. Then, DNA was extracted from these cells and analyzed by differential PCR. Of the 13 tumors, we selected 9 tumors that showed intense cyclin D1 expression and 4 tumors that showed moderate cyclin D1 expression. We hypothesized that if we did find gene amplification in these tumors, the degree of gene amplification might correlate with the intensity of cyclin D1 expression. For each tumor sample, a paired normal sample of thyroid tissue taken from the contralateral thyroid lobe was analyzed as a control.

For each tumor, two or three 10-µm sections were used for DNA extraction. These sections were taken immediately after the 3-µm sections for immunohistochemistry to ensure identical topography with the stained slide. Using the stained slide as a guide, these tissue sections were dissected with a disposable needle to remove as much of the surrounding normal tissue as possible. This ensured that the DNA extracted was mostly tumor derived. For each control, two sections of normal contralateral thyroid were used for DNA extraction.

For optimizing the PCR, two types of normal DNA were used: fresh DNA from buffy coat leukocytes, and paraffin extracted DNA from normal thyroid tissue. As a positive control, DNA from Fadu cells (a squamous carcinoma cell line known to have cyclin D1 gene amplification) was used.

Differential PCR

This method for detecting cyclin D1 gene amplification has been used for analyzing several tumor types (21, 22, 23, 24). When first described (21), the authors coamplified a 152-bp fragment of the cyclin D1 gene with a 112-bp fragment of the dopamine D2 receptor gene. Both of these genes are located on the long arm of chromosome 11. However, it has been noted that the efficiency of the cyclin D1 primers is inferior to that of the dopamine receptor primers. During optimization of the PCR conditions, we found it difficult to amplify the cyclin D1 gene fragment. We therefore designed a new cyclin D1 sense primer. Using this new sense primer together with the original cyclin D1 gene antisense primer, we obtained improved amplification of the cyclin D1 gene fragment. The efficiency of the dopamine D2 receptor primers was satisfactory. PCR conditions were as originally described (21).

In our differential PCR, we coamplified a 140-bp fragment of the cyclin D1 gene with a 112-bp fragment of the dopamine D2 receptor gene. The 2 sets of primers used were as follows: cyclin D1, (167–186) 5'GCTGCGAAGTGGAAACCATC3' and (306–287) 5'CAGGACCTCCTTCTGCACAC3'; dopamine D2 receptor, (7–28) 5'CCACTGAATCTGTCCTGGTATG3' and (118–96) 5'GCGTGGCATAGTAGTTGTAGTGC3'.

Statistical analysis

Univariate analysis was performed using the {chi}2 test. Those parameters showing statistical significance were also analyzed by multivariate analysis using cox regression. Statistical significance was ascribed at P < 0.05.

Results

Immunoreactivity for cyclin D1 was not seen in any of the fibrovascular cells or in the non-neoplastic thyroid follicular cells. This was true for both normal thyroid tissue and hyperplastic nodules. However, of the 22 metastasizing papillary microcarcinomas, 20 (90.9%) of the tumors showed cyclin D1 expression that was moderate to strong in intensity and widespread to diffuse in distribution (Fig. 1Go). The remaining two tumors showed very faint and very focal (involving a handful of cells) nuclear expression, but because the significance of this staining was uncertain, these tumors were regarded as nonexpressers of cyclin D1. Cytoplasmic staining was occasionally seen in some of the tumor cells, but this finding was also not regarded to be significant. Conversely, of the 34 incidentally discovered, nonmetastasizing papillary microcarcinomas, only 3 tumors (8.8%) showed cyclin D1 expression. Thirty of the 34 tumors showed complete absence of cyclin D1 immunoreactivity (Fig. 2Go), similar to surrounding normal thyroid tissue. One tumor showed very faint and focal nuclear staining and was considered a nonexpresser. The difference in immunoreactivity for cyclin D1 between the two groups of papillary microcarcinomas was highly significant (P < 0.001). There was no difference, however, in the size of microcarcinomas between the two groups.



View larger version (124K):
[in this window]
[in a new window]
 
Figure 1. Cyclin D1 immunoreactivity in a papillary microcarcinoma with metastasis. a, The tumor shows diffuse intense nuclear staining for cyclin D1 (original magnification, x20). b, The majority of tumor cell nuclei exhibit positivity for cyclin D1 with strong immunoreactivity in most cells (original magnification, x40).

 


View larger version (120K):
[in this window]
[in a new window]
 
Figure 2. Cyclin D1 immunoreactivity in an incidentally discovered papillary microcarcinoma with no metastasis. a, The tumor shows no nuclear staining for cyclin D1 (original magnification, x20). b, A few scattered tumor cell nuclei exhibit very faint positivity for cyclin D1 with no immunoreactivity in most cells (original magnification, x40).

 
We analyzed 13 tumors that overexpressed cyclin D1 and their paired normal controls for gene amplification by differential PCR (Fig. 3Go). The average ratio of cyclin D1 to D2 receptor was 0.45 (range, 0.39 to 0.78) in normal tissue and normal leukocytes. Cyclin D1 gene amplification was, however, confirmed in the Fadu cell line positive control, where the ratio exceeded 3. We found no evidence of cyclin D1 gene amplification in any of the tumors. Most tumor samples were within the range of normal, one was 1.09, and one ratio was 1.5. Only a ratio in excess of 2 has been considered to reflect gene amplification (21, 22, 23, 24).



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Differential PCR for cyclin D1 amplification. T1 to T4 are four representative tumor samples (T) with paired normal tissue (N). The positive control is the Fadu cell line, and the negative control is normal leukocytes. The upper band in each lane is the 140-bp fragment of cyclin D1, and the lower band is the 112-bp fragment of the D2 receptor.

 
Discussion

Cyclin D1 protein overexpression is seen in a wide variety of tumors and has been associated with increased tumor aggressiveness, an increased incidence of lymph node metastases, and a poorer prognosis (5, 6, 7). Of the genetic alterations known to underlie overexpression of cyclin D1, gene amplification is the commonest.

The role of cyclin D1 in the pathogenesis of thyroid malignancy has not been widely investigated, although cyclin D1 overexpression has been documented in a proportion of thyroid carcinomas (16, 17, 18, 19) and one report suggests that cyclin D1 expression is a prognostic factor for outcome (17).

We have found that cyclin D1 overexpression predicts lymph node metastasis in clinical papillary thyroid carcinomas (25). In this study, we hypothesized that cyclin D1 overexpression might allow us to identify the subgroup of papillary microcarcinomas with a potential for metastatic behavior.

We found that the majority of incidentally discovered microcarcinomas did not express cyclin D1 using immunohistochemistry and that the 8.8% incidence of expression was also lower than previously reported for clinical papillary carcinomas, which ranged from 31–63% (15, 16, 17, 18, 25, 26).

However, over 90% of the metastasizing microcarcinomas expressed cyclin D1, and this was higher than previously reported rates for clinical papillary carcinomas. This indicates that these two groups of microcarcinomas with starkly different clinical behavior yet similar morphologic features differ at the molecular level. Cyclin D1 immunohistochemistry appears to be a useful marker for identifying small carcinomas of thyroid that have the potential for more aggressive behavior and might benefit from more aggressive treatment. Thus far, we have not identified a difference in the clinical behavior of metastatic lesions with or without cyclin D1 overexpression. However, this observation is following adequate treatment of the papillary microcarcinomas, and any potential difference in behavior may be ameliorated by treatment.

The commonest genetic alteration underlying cyclin D1 overexpression in many different malignancies is gene amplification. We found no evidence of gene amplification in the thyroid tumors that overexpressed cyclin D1. This phenomenon has been reported to occur in a subgroup of other malignancies that overexpress this oncogene (27). These tumors may have a hitherto uncharacterized genetic alteration, or the cyclin D1 protein expression may be controlled at a posttranscriptional level.

In conclusion, cyclin D1 is significantly overexpressed in papillary microcarcinomas that metastasize to regional lymph nodes. This association between cyclin D1 overexpression and lymph node metastases is similar to reports in other malignancies. However, unlike these other cancers, cyclin D1 gene amplification does not appear to underlie the protein expression in papillary thyroid carcinoma. Cyclin D1 immunohistochemistry may prove valuable in predicting metastatic potential in papillary microcarcinomas of the thyroid gland.

Acknowledgments

We gratefully acknowledge the technical assistance of James Ho and Kelvin So and the advice of Nona Arneson. The Fadu cells were kindly donated by Dr. Suzanne Kamel-Reid.

Footnotes

This work was supported in part by Temmy Latner/Dynacare and by the Rita Banach Thyroid Cancer Research Fund.

Abbreviation: PMC, Papillary microcarcinoma.

Received June 28, 2001.

Accepted December 6, 2001.

References

  1. Fink A, Tomlinson G, Freeman JL, Rosen IB, Asa SL 1996 Occult micropapillary carcinoma associated with benign follicular thyroid disease and unrelated thyroid neoplasms. Mod Pathol 9:816–820[Medline]
  2. Sugitani I, Yanagisawa A, Shimizu A, Kato M, Fujimoto Y 1998 Clinicopathologic and immunohistochemical studies of papillary thyroid microcarcinoma presenting with cervical lymphadenopathy. World J Surg 22:731–737[CrossRef][Medline]
  3. Khoo M, Freeman JL, Witterick IJ, Irish JC, Rotstein LE, Gullane PJ, Asa SL Underexpression of p27/Kip1 in metastasizing papillary microcarcinomas of the thyroid. Arch Otolaryngol Head Neck Surg, in press
  4. Pestell RG, Albanese C, Reutens AT, Segall JE, Lee RJ, Arnold A 1999 The cyclins and cyclin-dependent kinase inhibitors in hormonal regulation of proliferation and differentiation. Endocr Rev 20:501–534[Abstract/Free Full Text]
  5. Fracchiolla NS, Pruneri G, Pignataro L, Carboni N, Capaccio P, Boletini A, Buffa R, Neri A 1997 Molecular and immunohistochemical analysis of the bcl-1/cyclin D1 gene in laryngeal squamous cell carcinomas: correlation of protein expression with lymph node metastases and advanced clinical stage. Cancer 79:1114–1121[CrossRef][Medline]
  6. Pignataro L, Pruneri G, Carboni N, Capaccio P, Cesana BM, Neri A, Buffa R 1998 Clinical relevance of cyclin D1 protein overexpression in laryngeal squamous cell carcinoma. J Clin Oncol 16:3069–3077[Abstract/Free Full Text]
  7. Frierson Jr HF, Gaffey MJ, Zukerberg LR, Arnold A, Williams ME 1996 Immunohistochemical detection and gene amplification of cyclin D1 in mammary infiltrating ductal carcinoma. Mod Pathol 9:725–730[Medline]
  8. Takes RP, Baatenburg de Jong RJ, Schuuring E, Hermans J, Vis AA, Litvinov SV, van Krieken JH 1997 Markers for assessment of nodal metastasis in laryngeal carcinoma. Arch Otolaryngol Head Neck Surg 123:412–419
  9. Masuda M, Hirakawa N, Nakashima T, Kuratomi Y, Komiyama S 1996 Cyclin D1 overexpression in primary hypopharyngeal carcinomas. Cancer 78:390–395[CrossRef][Medline]
  10. Capaccio P, Pruneri G, Carboni N, Pagliari AV, Buffa R, Neri A, Ottaviani A, Pignataro L 1997 Cyclin D1 protein expression is related to clinical progression in laryngeal squamous cell carcinomas. J Laryngol Otol 111:622–626[Medline]
  11. Buckley MF, Sweeney KJ, Hamilton JA, Sini RL, Manning DL, Nicholson RI, deFazio A, Watts CK, Musgrove EA, Sutherland RL 1993 Expression and amplification of cyclin genes in human breast cancer. Oncogene 8:2127–2133[Medline]
  12. Jiang W, Kahn SM, Tomita N, Zhang YJ, Lu SH, Weinstein IB 1992 Amplification and expression of the human cyclin D gene in esophageal cancer. Cancer Res 52:2980–2983[Abstract/Free Full Text]
  13. Jares P, Fernandez PL, Campo E, Nadal A, Bosch F, Aiza G, Nayach I, Traserra J, Cardesa A 1994 PRAD-1/cyclin D1 gene amplification correlates with messenger RNA overexpression and tumor progression in human laryngeal carcinomas. Cancer Res 54:4813–4817[Abstract/Free Full Text]
  14. Williams ME, Gaffey MJ, Weiss LM, Wilczynski SP, Schuuring E, Levine PA 1993 Chromosome 11Q13 amplification in head and neck squamous cell carcinoma. Arch Otolaryngol Head Neck Surg 119:1238–1243
  15. Basolo F, Caligo MA, Pinchera A, Fedeli F, Baldanzi A, Miccoli P, Iacconi P, Fontanini G, Pacini F 2000 Cyclin D1 overexpression in thyroid carcinomas: relation with clinico-pathological parameters, retinoblastoma gene product, and Ki67 labeling index. Thyroid 10:741–746[Medline]
  16. Lazzereschi D, Sambuco L, Carnovale Scalzo C, Ranieri A, Mincione G, Nardi F, Colletta G 1998 Cyclin D1 and cyclin E expression in malignant thyroid cells and in human thyroid carcinomas. Int J Cancer 76:806–811[CrossRef][Medline]
  17. Muro-Cacho CA, Holt T, Klotch D, Mora L, Livingston S, Futran N 1999 Cyclin D1 expression as a prognostic parameter in papillary carcinoma of the thyroid. Otolaryngol Head Neck Surg 120:200–207[CrossRef][Medline]
  18. Zou M, Shi Y, Farid NR, al Sedairy ST 1998 Inverse association between cyclin D1 overexpression and retinoblastoma gene mutation in thyroid carcinomas. Endocrine 8:61–64[CrossRef][Medline]
  19. Erickson LA, Jin L, Goellner JR, Lohse C, Pankratz VS, Zukerberg LR, Thompson GB, van Heerden JA, Grant CS, Lloyd RV 2000 Pathologic features, proliferative activity, and cyclin D1 expression in Hurthle cell neoplasms of the thyroid. Mod Pathol 13:186–192[CrossRef][Medline]
  20. Wang S, Lloyd RV, Hutzler MJ, Safran MS, Patwardhan NA, Khan A 2000 The role of cell cycle regulatory protein, cyclin D1, in the progression of thyroid cancer. Mod Pathol 13:882–887[CrossRef][Medline]
  21. Gramlich TL, Fritsch CR, Maurer D, Eberle M, Gansler TS 1994 Differential polymerase chain reaction assay of cyclin D1 gene amplification in esophageal carcinoma. Diagn Mol Pathol 3:255–259[Medline]
  22. Kyomoto R, Kumazawa H, Toda Y, Sakaida N, Okamura A, Iwanaga M, Shintaku M, Yamashita T, Hiai H, Fukumoto M 1997 Cyclin-D1-gene amplification is a more potent prognostic factor than its protein over-expression in human head-and-neck squamous-cell carcinoma. Int J Cancer 74:576–581[CrossRef][Medline]
  23. Suzuki H, Moriya J, Nakahata A, Fujioka Y, Inoue K, Nagashima K 1998 Cyclin D1 gene amplification in esophageal carcinosarcoma shown by differential polymerase chain reaction. Hum Pathol 29:662–667[CrossRef][Medline]
  24. Takano Y, Takenaka H, Kato Y, Masuda M, Mikami T, Saegusa M, Okayasu I 1999 Cyclin D1 overexpression in invasive breast cancers: correlation with cyclin-dependent kinase 4 and oestrogen receptor overexpression, and lack of correlation with mitotic activity. J Cancer Res Clin Oncol 125:505–512[CrossRef][Medline]
  25. Khoo MLC, Beasley NJP, Ezzat S, Freeman JL, Asa SL 2002 Overexpression of cyclin D1 and underexpression of p27 predict lymph node metastases in papillary thyroid carcinoma. J Clin Endocrinol Metab 87:1814–1818[Abstract/Free Full Text]
  26. Wang S, Wuu J, Savas L, Patwardhan N, Khan A 1998 The role of cell cycle regulatory proteins, cyclin D1, cyclin E, and p27 in thyroid carcinogenesis. Hum Pathol 29:1304–1309[CrossRef][Medline]
  27. Hosokawa Y, Arnold A 1998 Mechanism of cyclin D1 (CCND1, PRAD1) overexpression in human cancer cells: analysis of allele-specific expression. Genes Chromosomes Cancer 22:66–71[CrossRef][Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
E. Roti, E. C degli Uberti, M. Bondanelli, and L. E Braverman
Thyroid papillary microcarcinoma: a descriptive and meta-analysis study
Eur. J. Endocrinol., December 1, 2008; 159(6): 659 - 673.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
J.-J. Lee, A. Y M Au, T. Foukakis, M. Barbaro, N. Kiss, R. Clifton-Bligh, J. Staaf, A. Borg, L. Delbridge, B. G Robinson, et al.
Array-CGH identifies cyclin D1 and UBCH10 amplicons in anaplastic thyroid carcinoma
Endocr. Relat. Cancer, September 1, 2008; 15(3): 801 - 815.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Vasko, A. V. Espinosa, W. Scouten, H. He, H. Auer, S. Liyanarachchi, A. Larin, V. Savchenko, G. L. Francis, A. de la Chapelle, et al.
Gene expression and functional evidence of epithelial-to-mesenchymal transition in papillary thyroid carcinoma invasion
PNAS, February 20, 2007; 104(8): 2803 - 2808.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. Paternot, J. E. Dumont, and P. P. Roger
Differential Utilization of Cyclin D1 and Cyclin D3 in the Distinct Mitogenic Stimulations by Growth Factors and TSH of Human Thyrocytes in Primary Culture
Mol. Endocrinol., December 1, 2006; 20(12): 3279 - 3292.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. S. Jo, S. Li, J. H. Song, K. H. Kwon, J. C. Lee, S. Y. Rha, H. J. Lee, J. Y. Sul, G. R. Kweon, H.-k. Ro, et al.
Influence of the BRAF V600E Mutation on Expression of Vascular Endothelial Growth Factor in Papillary Thyroid Cancer
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3667 - 3670.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
J Bondi, A Husdal, G Bukholm, J M Nesland, A Bakka, and I R K Bukholm
Expression and gene amplification of primary (A, B1, D1, D3, and E) and secondary (C and H) cyclins in colon adenocarcinomas and correlation with patient outcome
J. Clin. Pathol., May 1, 2005; 58(5): 509 - 514.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
G. Cheng, A. E. Lewis, and J. L. Meinkoth
Ras Stimulates Aberrant Cell Cycle Progression and Apoptosis in Rat Thyroid Cells
Mol. Endocrinol., March 1, 2003; 17(3): 450 - 459.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. L. C. Khoo, N. J. P. Beasley, S. Ezzat, J. L. Freeman, and S. L. Asa
Overexpression of Cyclin D1 and Underexpression of p27 Predict Lymph Node Metastases in Papillary Thyroid Carcinoma
J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1814 - 1818.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Khoo, M. L. C.
Right arrow Articles by Asa, S. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Khoo, M. L. C.
Right arrow Articles by Asa, S. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals