| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Department of Pathology, University Health Network (M.L.C.K., S.L.A.); Departments of Otolaryngology (M.L.C.K., J.L.F.) and Medicine (Endocrinology) (S.E.), Mount Sinai Hospital; and Departments of Laboratory Medicine and Pathobiology (S.L.A.), Otolaryngology (J.L.F.), and Medicine (S.E.), University of Toronto, Toronto, Ontario, Canada M5G 2M9
Address all correspondence and requests for reprints to: Sylvia L. Asa, M.D., Ph.D., Department of Pathology, University Health Network, 610 University Avenue, Suite 4-302, Toronto, Ontario M5G 2 M9, Canada. E-mail: . sylvia.asa{at}uhn.on.ca
Abstract
Overexpression of cyclin D1 occurs in several malignancies, often due to gene amplification, and this has been associated with aggressive tumor behavior, a higher incidence of lymph node metastases, and a poorer prognosis. The role of cyclin D1 in the pathogenesis of thyroid malignancy is unknown; however, cyclin D1 expression has been reported to occur in a proportion of well differentiated thyroid carcinomas. Micropapillary carcinomas of the thyroid are common incidental findings that almost always behave in an indolent manner and remain quiescent. However, rare microcarcinomas behave aggressively and metastasize early, giving rise to clinically significant disease. We hypothesized that cyclin D1 might play a role in the aggressive behavior of metastasizing papillary microcarcinomas. We reviewed the histopathology reports of 2,000 patients who underwent thyroid surgery at our institution between 19951999 and identified 22 patients who presented with gross regional metastases from a primary papillary microcarcinoma. These patients formed the index cohort for this analysis. As controls, we selected 34 patients with nonmetastasizing microcarcinomas. We studied these tumors for immunoreactivity to cyclin D1 on immunohistochemistry and analyzed 13 tumors that diffusely expressed cyclin D1 for gene amplification by differential PCR. Twenty of the 22 (90.9%) metastasizing papillary microcarcinomas expressed cyclin D1, compared with 3 of the 34 (8.8%) nonmetastasizing papillary microcarcinomas (P < 0.001). However, of the 13 tumors that showed diffuse immunoreactivity for cyclin D1 on immunohistochemistry, none showed amplification of the cyclin D1 gene on differential PCR. We conclude that cyclin D1 is significantly overexpressed in metastasizing papillary microcarcinomas of the thyroid. This is likely due to mechanisms other than gene amplification. Cyclin D1 immunohistochemistry may be a valuable tool in predicting metastatic potential in papillary microcarcinomas.
PAPILLARY MICROCARCINOMAS (PMCs) of the thyroid are defined as small papillary carcinomas measuring less than 1 cm in maximum dimension. They are extremely common findings on histopathology following both thyroid surgery and autopsy (1). The vast majority of PMCs behave in an indolent manner and do not give rise to clinically significant disease (1). Therefore, when these tumors are encountered, most clinicians regard them as incidental findings of little clinical significance.
Although larger papillary thyroid carcinomas have a strong propensity to metastasize to regional lymph nodes, lymph node metastases from PMCs are very uncommon. Nonetheless, on rare occasions, a PMC behaves aggressively and metastasizes early, presenting with clinically evident lymph node metastases. These tumors then result in significant morbidity and mortality (2).
At present, traditional histopathological assessment cannot distinguish between the typical PMC, which almost always remains quiescent, and the unusual PMC, which has the potential to behave aggressively. Recent data suggest that down-regulation of p27 may predict the potential for more aggressive behavior in some of these tumors (3).
The cyclin D1 gene is located on chromosome 11q23 and encodes a nuclear protein that is a positive regulator of the cell cycle, facilitating G1 to S phase transition (4). Overexpression of cyclin D1 protein has been found to occur in several malignancies and has been linked to a more aggressive tumor phenotype and a poorer prognosis (5, 6, 7). Cyclin D1 overexpression has also been associated with an increased incidence of lymph node metastases in several cancers (8, 9, 10).
The full spectrum of genetic alterations that underlie cyclin D1 overexpression has not been determined, but certain alterations have been identified, including pericentrimeric chromosomal inversion in parathyroid adenomas t(11,14), and translocation in mantle cell and other B cell non-Hodgkin lymphomas. However, the commonest genetic alteration resulting in cyclin D1 overexpression is amplification of the cyclin D1 gene, and this has been shown to occur in a significant proportion of breast, esophageal, lung, and head and neck squamous carcinomas (11, 12, 13, 14).
Little is known about the role that cyclin D1 plays in the pathogenesis of thyroid cancer. Normal thyroid cells do not show nuclear immunoreactivity for cyclin D1 on immunohistochemistry. However, cyclin D1 expression has been reported to occur in some papillary thyroid carcinomas (15, 16, 17, 18) as well as some Hurthle cell carcinomas (19). Cyclin D1 overexpression has also been reported to be more frequent in poorly differentiated thyroid tumors, compared with well differentiated thyroid tumors (20). A recent report suggests that cyclin D1 expression may be a prognostic factor in papillary thyroid carcinoma (17). Cyclin D1 expression by micropapillary thyroid carcinomas has not been examined. Moreover, the genetic basis of cyclin D1 expression in thyroid carcinomas is not known.
We hypothesized that cyclin D1 overexpression might play a role in the aggressive behavior of metastasizing PMCs. We also hypothesized that this overexpression might be due to amplification of the cyclin D1 gene.
Patients and Methods
The aim of this study was to assess cyclin D1 expression in metastasizing and nonmetastasizing papillary microcarcinomas of the thyroid and to examine cyclin D1 gene amplification in tumors that overexpressed cyclin D1.
Patients
We reviewed the histopathology reports of 2,000 patients who underwent thyroid surgery at our institution after informed consent between 19951999 and identified 22 patients who presented with gross lymph node metastases from a primary papillary microcarcinoma of the thyroid gland. These 22 patients formed the index cohort for this analysis. We also randomly selected a control group of 34 patients with incidentally discovered papillary microcarcinomas unassociated with larger thyroid carcinomas of follicular cell derivation and without evidence of metastases on gross and microscopic evaluation. These latter patients all had thyroid surgery for nonmalignant indications, and the PMC was an incidental finding on routine histopathology. All 34 patients had lymph nodes included in the surgical specimen that included thyroid isthmus, all lymph nodes were confirmed to be negative for metastatic malignancy, and all control patients had at least 5 yr of follow-up with no evidence of recurrent or metastatic papillary carcinoma.
We assessed cyclin D1 protein expression in these tumors by immunohistochemistry and selected tumors that overexpressed cyclin D1 for analysis of gene amplification by differential PCR assay.
Immunohistochemistry
Formalin-fixed paraffin-embedded tissue sections 3-µm thick were dewaxed in toluene and rehydrated through graded alcohols to water. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide. Antigen retrieval was performed in 10 mM citrate buffer (pH 6.0) inside a microwave pressure cooker. Endogenous biotin detection was blocked with the Avidin-Biotin blocking kit (Vector Laboratories, Inc. Burlingame, CA).
Primary antibody incubation was carried out overnight at room temperature using a mouse monoclonal antibody for cyclin D1 (Clone DCS-6, DAKO Corp. A/S, Glostrup, Denmark) at 1:50 dilution. Thereafter, slides were washed in PBS, and secondary incubations were carried out using Biotin anti-mouse/anti-rabbit IgG followed by streptavidin-HRP (Signet Pathology System, Dedham, MA) for 30 min. Immunoreactivity was revealed by incubation in 3-amino-9-ethylcarbazol. Slides were counterstained in hematoxylin and mounted on crystal mount. Positive controls were human tumors with known overexpression and amplification of the cyclin D1 gene. Negative controls replaced primary antibody with normal mouse ascites.
Quantitation
Assessment of immunoreactivity was done jointly by two of the authors (M.L.C.K. and S.L.A.). Cyclin D1 expression was graded on the basis of both the intensity of staining within the tumor cells and the percentage of positive cells within each tumor. Only nuclear staining was considered to be positive expression, and isolated cytoplasmic staining was ignored.
The intensity of nuclear staining was graded from 0 to 3 as follows: grade 0, absence of staining; grade 1, faint nuclear staining (requiring high power assessment); grade 2, moderate nuclear staining (easily appreciated at low power); and grade 3, staining for intense nuclear staining.
We graded the distribution of positive cells in tumors that stained for cyclin D1 as follows: grade 1, focal staining in less than 10% of tumor cells; grade 2, fairly widespread staining in 1050% of tumor cells; and grade 3, diffuse staining in more than 50% of tumor cells.
For the purposes of statistical analysis, tumors were divided into expressers and nonexpressers of cyclin D1. Most tumors that expressed cyclin D1 showed moderate to intense nuclear staining as well as widespread to diffuse distribution of positive cells within the tumor. Nonexpressers generally showed complete absence of nuclear staining within the entire tumor. However, a small number of tumors (3 of 56) showed very faint and very focal nuclear staining (grade 1 intensity, grade 1 distribution). The significance of this faint isolated expression was unclear, and because this pattern was so different from the typical positive staining, we elected to regard these tumors as negative expressers of cyclin D1.
DNA extraction and analysis
Formalin-fixed paraffin-embedded tissue sections were deparaffinized with xylene for 20 min, washed with 100% alcohol for 3 min, then oven-dried at 50 C for 30 min. DNA was then extracted using the QIAGEN DNA extraction kit, following the manufacturers instructions with one modification: we digested the tissue for 48 h, adding an additional 20 µl of proteinase K after the first 24 h.
To investigate gene amplification in tumors that overexpressed cyclin D1, we chose 13 tumors that showed diffuse cyclin D1 expression throughout the entire lesion. This ensured that after microdissection and removal of the surrounding non-neoplastic thyroid or lymph node tissue, at least 75% of the remaining tumor cells were expressers of cyclin D1. Then, DNA was extracted from these cells and analyzed by differential PCR. Of the 13 tumors, we selected 9 tumors that showed intense cyclin D1 expression and 4 tumors that showed moderate cyclin D1 expression. We hypothesized that if we did find gene amplification in these tumors, the degree of gene amplification might correlate with the intensity of cyclin D1 expression. For each tumor sample, a paired normal sample of thyroid tissue taken from the contralateral thyroid lobe was analyzed as a control.
For each tumor, two or three 10-µm sections were used for DNA extraction. These sections were taken immediately after the 3-µm sections for immunohistochemistry to ensure identical topography with the stained slide. Using the stained slide as a guide, these tissue sections were dissected with a disposable needle to remove as much of the surrounding normal tissue as possible. This ensured that the DNA extracted was mostly tumor derived. For each control, two sections of normal contralateral thyroid were used for DNA extraction.
For optimizing the PCR, two types of normal DNA were used: fresh DNA from buffy coat leukocytes, and paraffin extracted DNA from normal thyroid tissue. As a positive control, DNA from Fadu cells (a squamous carcinoma cell line known to have cyclin D1 gene amplification) was used.
Differential PCR
This method for detecting cyclin D1 gene amplification has been used for analyzing several tumor types (21, 22, 23, 24). When first described (21), the authors coamplified a 152-bp fragment of the cyclin D1 gene with a 112-bp fragment of the dopamine D2 receptor gene. Both of these genes are located on the long arm of chromosome 11. However, it has been noted that the efficiency of the cyclin D1 primers is inferior to that of the dopamine receptor primers. During optimization of the PCR conditions, we found it difficult to amplify the cyclin D1 gene fragment. We therefore designed a new cyclin D1 sense primer. Using this new sense primer together with the original cyclin D1 gene antisense primer, we obtained improved amplification of the cyclin D1 gene fragment. The efficiency of the dopamine D2 receptor primers was satisfactory. PCR conditions were as originally described (21).
In our differential PCR, we coamplified a 140-bp fragment of the cyclin D1 gene with a 112-bp fragment of the dopamine D2 receptor gene. The 2 sets of primers used were as follows: cyclin D1, (167186) 5'GCTGCGAAGTGGAAACCATC3' and (306287) 5'CAGGACCTCCTTCTGCACAC3'; dopamine D2 receptor, (728) 5'CCACTGAATCTGTCCTGGTATG3' and (11896) 5'GCGTGGCATAGTAGTTGTAGTGC3'.
Statistical analysis
Univariate analysis was performed using the
2 test. Those parameters showing statistical significance were also analyzed by multivariate analysis using cox regression. Statistical significance was ascribed at P < 0.05.
Results
Immunoreactivity for cyclin D1 was not seen in any of the fibrovascular cells or in the non-neoplastic thyroid follicular cells. This was true for both normal thyroid tissue and hyperplastic nodules. However, of the 22 metastasizing papillary microcarcinomas, 20 (90.9%) of the tumors showed cyclin D1 expression that was moderate to strong in intensity and widespread to diffuse in distribution (Fig. 1
). The remaining two tumors showed very faint and very focal (involving a handful of cells) nuclear expression, but because the significance of this staining was uncertain, these tumors were regarded as nonexpressers of cyclin D1. Cytoplasmic staining was occasionally seen in some of the tumor cells, but this finding was also not regarded to be significant. Conversely, of the 34 incidentally discovered, nonmetastasizing papillary microcarcinomas, only 3 tumors (8.8%) showed cyclin D1 expression. Thirty of the 34 tumors showed complete absence of cyclin D1 immunoreactivity (Fig. 2
), similar to surrounding normal thyroid tissue. One tumor showed very faint and focal nuclear staining and was considered a nonexpresser. The difference in immunoreactivity for cyclin D1 between the two groups of papillary microcarcinomas was highly significant (P < 0.001). There was no difference, however, in the size of microcarcinomas between the two groups.
|
|
|
Cyclin D1 protein overexpression is seen in a wide variety of tumors and has been associated with increased tumor aggressiveness, an increased incidence of lymph node metastases, and a poorer prognosis (5, 6, 7). Of the genetic alterations known to underlie overexpression of cyclin D1, gene amplification is the commonest.
The role of cyclin D1 in the pathogenesis of thyroid malignancy has not been widely investigated, although cyclin D1 overexpression has been documented in a proportion of thyroid carcinomas (16, 17, 18, 19) and one report suggests that cyclin D1 expression is a prognostic factor for outcome (17).
We have found that cyclin D1 overexpression predicts lymph node metastasis in clinical papillary thyroid carcinomas (25). In this study, we hypothesized that cyclin D1 overexpression might allow us to identify the subgroup of papillary microcarcinomas with a potential for metastatic behavior.
We found that the majority of incidentally discovered microcarcinomas did not express cyclin D1 using immunohistochemistry and that the 8.8% incidence of expression was also lower than previously reported for clinical papillary carcinomas, which ranged from 3163% (15, 16, 17, 18, 25, 26).
However, over 90% of the metastasizing microcarcinomas expressed cyclin D1, and this was higher than previously reported rates for clinical papillary carcinomas. This indicates that these two groups of microcarcinomas with starkly different clinical behavior yet similar morphologic features differ at the molecular level. Cyclin D1 immunohistochemistry appears to be a useful marker for identifying small carcinomas of thyroid that have the potential for more aggressive behavior and might benefit from more aggressive treatment. Thus far, we have not identified a difference in the clinical behavior of metastatic lesions with or without cyclin D1 overexpression. However, this observation is following adequate treatment of the papillary microcarcinomas, and any potential difference in behavior may be ameliorated by treatment.
The commonest genetic alteration underlying cyclin D1 overexpression in many different malignancies is gene amplification. We found no evidence of gene amplification in the thyroid tumors that overexpressed cyclin D1. This phenomenon has been reported to occur in a subgroup of other malignancies that overexpress this oncogene (27). These tumors may have a hitherto uncharacterized genetic alteration, or the cyclin D1 protein expression may be controlled at a posttranscriptional level.
In conclusion, cyclin D1 is significantly overexpressed in papillary microcarcinomas that metastasize to regional lymph nodes. This association between cyclin D1 overexpression and lymph node metastases is similar to reports in other malignancies. However, unlike these other cancers, cyclin D1 gene amplification does not appear to underlie the protein expression in papillary thyroid carcinoma. Cyclin D1 immunohistochemistry may prove valuable in predicting metastatic potential in papillary microcarcinomas of the thyroid gland.
Acknowledgments
We gratefully acknowledge the technical assistance of James Ho and Kelvin So and the advice of Nona Arneson. The Fadu cells were kindly donated by Dr. Suzanne Kamel-Reid.
Footnotes
This work was supported in part by Temmy Latner/Dynacare and by the Rita Banach Thyroid Cancer Research Fund.
Abbreviation: PMC, Papillary microcarcinoma.
Received June 28, 2001.
Accepted December 6, 2001.
References
This article has been cited by other articles:
![]() |
J.-J. Lee, A. Y M Au, T. Foukakis, M. Barbaro, N. Kiss, R. Clifton-Bligh, J. Staaf, A. Borg, L. Delbridge, B. G Robinson, et al. Array-CGH identifies cyclin D1 and UBCH10 amplicons in anaplastic thyroid carcinoma Endocr. Relat. Cancer, September 1, 2008; 15(3): 801 - 815. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vasko, A. V. Espinosa, W. Scouten, H. He, H. Auer, S. Liyanarachchi, A. Larin, V. Savchenko, G. L. Francis, A. de la Chapelle, et al. Gene expression and functional evidence of epithelial-to-mesenchymal transition in papillary thyroid carcinoma invasion PNAS, February 20, 2007; 104(8): 2803 - 2808. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Paternot, J. E. Dumont, and P. P. Roger Differential Utilization of Cyclin D1 and Cyclin D3 in the Distinct Mitogenic Stimulations by Growth Factors and TSH of Human Thyrocytes in Primary Culture Mol. Endocrinol., December 1, 2006; 20(12): 3279 - 3292. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Jo, S. Li, J. H. Song, K. H. Kwon, J. C. Lee, S. Y. Rha, H. J. Lee, J. Y. Sul, G. R. Kweon, H.-k. Ro, et al. Influence of the BRAF V600E Mutation on Expression of Vascular Endothelial Growth Factor in Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3667 - 3670. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Bondi, A Husdal, G Bukholm, J M Nesland, A Bakka, and I R K Bukholm Expression and gene amplification of primary (A, B1, D1, D3, and E) and secondary (C and H) cyclins in colon adenocarcinomas and correlation with patient outcome J. Clin. Pathol., May 1, 2005; 58(5): 509 - 514. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Cheng, A. E. Lewis, and J. L. Meinkoth Ras Stimulates Aberrant Cell Cycle Progression and Apoptosis in Rat Thyroid Cells Mol. Endocrinol., March 1, 2003; 17(3): 450 - 459. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. C. Khoo, N. J. P. Beasley, S. Ezzat, J. L. Freeman, and S. L. Asa Overexpression of Cyclin D1 and Underexpression of p27 Predict Lymph Node Metastases in Papillary Thyroid Carcinoma J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1814 - 1818. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |