| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Division of Medical Genetics, Department of Genetics (J.P.T., R.C.T.), University of Leicester, Leicester LE1 7RH, United Kingdom; and Division of Clinical Sciences (North) (R.A.M., P.F.W., A.P.W.), University of Sheffield, Northern General Hospital, Sheffield S5 7AU United Kingdom
Address all correspondence and requests for reprints to: Richard C. Trembath, Division of Medical Genetics, Departments of Medicine and Genetics, Adrian Building, University of Leicester, University Road, Leicester LE1 7RH, United Kingdom. E-mail: . rtrembat{at}hgmp.mrc.ac.uk
Abstract
Pendred syndrome (PDS) is an autosomal recessive disorder characterized by deafness and goiter. Phenotypic heterogeneity is observed in affected individuals, and thyroid dysfunction is particularly variable. The syndrome is caused by mutations in the PDS (SLC26A4) gene, encoding an anion transporter pendrin, which localizes to the apical membrane of thyroid follicular cells. PDS is thought to enable efflux iodide into the follicle lumen. More than 50 diseases causing mutations of PDS have been reported. Here we have investigated the effect of nine PDS missense mutations on pendrin localization and iodide transport with the view to understanding their functional impact. As demonstrated by transient expression of green fluorescent protein-tagged pendrin mutant constructs in mammalian cell lines, appropriate trafficking to the plasma membrane was observed for only two mutants. The remaining PDS mutants appear to be retained within the endoplasmic reticulum following transfection. Iodide efflux assays were performed using human embryonic kidney 293 cells transfected with mutant pendrin and cotransfected with sodium iodide transporter to provide a mechanism of iodide uptake. The results indicated loss of pendrin iodide transport for all mislocalizing mutations. However, PDS mutants are associated with variable thyroid dysfunction in affected subjects. We concluded that additional genetic and/or environmental factors influence the thyroid activity in Pendred syndrome.
PENDRED SYNDROME (PDS) is the most common cause of syndromic deafness, accounting for up to 10% of all hereditary hearing loss (1). An autosomal recessive disorder, PDS is classically described as the association of sensorineural hearing deficit and goiter (2). Goiter characteristically develops during puberty although earlier- and later-onset cases have been noted, typical histology moving from diffuse to multinodular in longstanding cases. At least 50% of cases have normal circulating levels of thyroid hormones, others developing clinical hypothyroidism (3). Most affected subjects demonstrate impaired iodide organification, as determined by a positive perchlorate discharge test (1). Hearing loss in PDS is prelingual, and in at least 80% of patients it is associated with structural defects of the inner ear including a dilatation of the vestibular aqueduct and the Mondini defect of the cochlea (4).
The PDS locus was originally linked to chromosomal region 7q31 (5, 6) and the PDS gene identified by bioinformatic positional cloning in 1997 (7). More than 50 independent PDS gene mutations have been characterized as causing PDS (7, 8, 9, 10, 11, 12, 13, 14) and nonsyndromic deafness, in some cases confirmed by a normal perchlorate discharge test (8, 9, 11, 13). PDS mutations are distributed throughout the coding sequence, being identified in 18 of the 21 exons. The majority of mutations are missense, with a smaller number of insertions, deletions, frameshift, and splice site mutations also reported (7, 8, 9, 10, 11, 12, 13, 14). The wide distribution of mutations and lack of clustering to any domain of the gene, together with the variable phenotype, serve to compound efforts to correlate phenotype with genotype.
PDS encodes pendrin, a transmembrane protein of 780 amino acids, predicted to have either 11 or 12 membrane-spanning domains (7, 15). Pendrin is a member of the solute carrier family 26A (SLC26A), a group of anion transporter-related proteins, which include prestin, an inner ear protein (16), and CLD, the protein defective in congenital chloride diarrhea (17, 18). Expression studies in Xenopus laevis oocytes also support a role for pendrin as a chloride and iodide transporter (19).
PDS mRNA is expressed in the cochlea, thyroid, and kidney (7). Immunohistochemical analysis has indicated that pendrin is specifically localized to the apical membrane of thyroid follicular cells (15, 20), suggesting that its role in the thyroid may be to transport iodide into the colloidal space. In contrast, the sodium iodide symporter (NIS) is expressed on the basolateral membrane of the follicular cell and imports iodide into the follicle (21). The possible role of pendrin in the inner ear is less clear; it has been hypothesized that the chloride transport function of pendrin is important in the homeostasis of the endolymph with ionic imbalance potentially responsible for auditory developmental malformation (22).
In this study we have characterized a number of missense mutations by transient expression in HeLa and human embryonic kidney (HEK) 293 cell lines with a view to understanding, at a cellular level, the mechanism by which these mutations contribute to the PDS phenotype. We have developed a system to assess iodide efflux of pendrin and sought to determine the affect of mutations on this aspect of transporter function. Immunofluorescence has been used to assess the correct targeting of mutant pendrin to the cell surface membrane.
Materials and Methods
Generation of a green fluorescent protein (GFP)-tagged PDS construct and mutagenesis
The C-terminal portion of the PDS cDNA, excluding the stop codon, was amplified using the following primers: sense 5'ACTGTTGACTGTGGTCCTGAG 3' and antisense 5'TCGGTACCAGGGATGCAAGTGTACGCA3'. This 833-bp amplicon was digested with HincII and KpnI and cloned into pCR II-TA (Invitrogen, Paisley, UK) containing the wild-type PDS cDNA-spanning nucleotides -5-2343 bp (A of the ATG start codon is designated as +1 according to the published cDNA sequence). This modified PDS cDNA sequence was subcloned into the XhoI-KpnI site of pEGFP-N1 (CLONTECH Laboratories, Inc., Basingstoke, UK) using standard cloning protocols to produce a construct encoding for a carboxy terminal GFP pendrin fusion protein.
The PDS mutants, with the exception of G102R, were made using the Quik Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) using the primers listed in Table 1
and according to the manufacturers protocol.
|
Cell culture and transfections
HEK 293 and HeLa cells were cultured in DMEM Glutamax (Life Technologies, Inc. Ltd., Paisley, UK) supplemented with 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37 C in a humidified atmosphere containing 5% CO2. Transfections were performed on cells grown to a confluence of 7080%, using Fugene 6 (Roche Diagnostics Ltd., Lewes, UK) according to the manufacturers instructions. Cells cultured on glass coverslips, in 30-mm plates, were transfected with 2.5 µg plasmid DNA for immunofluorescence experiments. Iodide efflux assays were performed on HEK 293 cells, in 15-mm plates, previously transfected with 1 µg DNA: 0.5 µg NIS pcDNA3, as previously described (23) to allow iodide loading of cells, and 0.5 µg PDS-EGFP-N1, as described above.
Immunofluorescence
Forty-eight hours after transfection, cells were washed twice with ice-cold PBS and fixed in methanol for 10 min at 4 C. For Golgi complex staining, fixed cells were blocked by three washes in PBS/3% BSA. Coverslips were incubated for 1 h with Golgi 58 K antimouse antibody (Sigma, Poole, UK) at a 1:100 dilution. Cells were again washed before incubation with biotinylated antimouse Ig (Amersham Pharmacia Biotech Ltd., Little Chalfont, UK), at a 1:100 dilution for 45 min. Washed cells were then incubated for another 45 min, in darkness, with Streptavadin Texas Red (Amersham Pharmacia Biotech) at a 1:200 dilution. To detect the endoplasmic reticulum (ER), after methanol fixation, cells were washed twice with PBS and then incubated for 20 min with concavalin A, Alexa Fluor 59 conjugate (Cambridge Bioscience, Cambridge, UK) at a concentration of 0.5 µg/ml. After a final wash in PBS, coverslips were mounted using 80% glycerol and 3% propyl gallate and visualized using an Axiophot fluorescence microscope (Carl Zeiss Ltd., Welwyn Garden City, Herts, UK).
Iodide efflux assay
Forty-eight hours after transfection, cells were washed once in serum-free DMEM medium and incubated for 1 h in 500 µl serum-free medium containing Na [125I] at 5 KBq/ml as the only source of iodide. The efflux assay was adapted from the method of Ajjan et al. (24). Cells were washed briefly in HBSS buffer and then incubated with 500 µl HBSS for 05 min after which HBSS was removed. Cells were solubilized by the addition of 500 µl 1N NaOH and the radioactivity measured using a
counter (Wizard automatic
counter, PerkinElmer Life Sciences Ltd., Cambridge, UK). All experiments were carried out three times on triplicate cultures. Transfection efficiency was determined by FACS analysis of GFP fluorescence and found to be approximately 50%. Statistical significance of the efflux assay results was determined by use of t test.
Results
We investigated nine missense mutations, previously characterized as disease causing from our cohort of Pendred patients: L117F, Q446R (8), V138F, T410M, Y556C, G672E (10), G209V (11), and G102R (Taylor, J. P., unpublished data). Table 2
shows a summary of the phenotypes associated with each of these mutations, and Fig. 1
indicates the location of the studied mutants on a predicted model of the pendrin protein.
|
|
Pendrin has been shown, by immunohistochemical analysis, to be located at the apical membrane of thyroid follicular cells (15, 20). To assess the effect of mutations on membrane targeting, we expressed wild-type and mutant GFP-tagged pendrin in HeLa cells and observed localization using immunofluorescence (Fig. 2
). Similar results were obtained using COS 7 cells and CHO-K1 cells (data not shown). These cells lack the polarization of thyroid follicular cells, yet wild-type pendrin was clearly present at the cell membrane. Mutants L117F and G209V showed a cell membrane protein distribution similar to that of the wild-type protein. Y556C and G672E mutants also showed a cell surface distribution in some cells (approximately 10% of those transfected), although the protein signal in these cells appeared to be less intense at the membrane. The remaining mutants, Q446R, V138F, T410M, and G102R, failed to reach the cell membrane and appeared to localize to distinct areas of the cytoplasm. We hypothesized that the retention of these mutants in the cytoplasm was caused by aberrant protein processing in either the ER or the Golgi. Using Concavalin A, an ER membrane stain, and a Golgi-specific antibody to label these organelles, respectively, we demonstrated that Q446R, V138F, T410M and G102R mutant pendrin colocalized with the ER (Fig. 3
). ER localization is observed with several mutant membrane transporter proteins that cause human disorders, for example
F508 CFTR (25), A147T and T126M AQP2 (26), and L707P AE1 (27) mutants.
|
|
Within the thyroid follicular cell, pendrin is speculated to mediate iodide efflux. To assess this specific iodide transport function in a heterologous cell system, we performed cotransfection with NIS, the sodium iodide symporter, to provide a mechanism by which cells could initially be loaded with iodide. NIS is known to import iodide into the thyroid follicular cell and so is the natural partner for pendrin within the thyroid. Figure 4
shows results from the cotransfection experiments. Cells transfected with NIS only showed a low rate of iodide efflux, most likely because of passive diffusion of iodide from the cells. Cells cotransfected with wild-type PDS efflux iodide at a high rate, losing up to 66% of accumulated iodide at 1 min of measurement. Cotransfection of all but two pendrin mutants resulted in a rate of efflux similar to that of cells transfected with NIS alone, indicating that these mutant proteins had lost their ability to transport iodide. L117F, however, exhibited a rate of iodide efflux statistically similar to that of the wild-type, and G209V showed the ability to partially efflux iodide albeit at a much reduced rate. Figure 5
shows the level of iodide efflux at 1 min of measurement.
|
|
To date, more than 50 pathogenic mutations of the PDS gene have been reported (7, 8, 9, 10, 11, 12, 13, 14, 28, 29). Here we have studied nine mutations, located throughout the gene, within predicted transmembrane domains, extracellular and intracellular regions, as indicated in Fig. 1
. Each mutation resulted in substitution of amino acid residues highly conserved across the SLC26A gene family, of which PDS is a member. Five mutants showed a complete failure to reach the membrane when transfected transiently in cell culture systems but were retained within the ER. Such misprocessing indicated that these mutations cause aberrant folding of the polypeptide, thus preventing full maturation and processing to the cell surface membrane. This mechanism has been described in a number of membrane transporter proteins, including the common
F508 CFTR mutation, which is also retained at the ER (25). Immunofluorescence studies of mutants Y556C and G672E indicate that the localization of these mutants to the membrane is partial, and the efflux assay demonstrated that the function of the protein that had reached the cell surface appropriately had been abolished.
Interestingly, of the two mutants, L117F and G209V, that did localize to the membrane, L117F performed as wild-type pendrin in the iodide efflux assay. This hydrophobic substitution of a highly conserved residue, located within the first predicted transmembrane domain, appears to have no deleterious effect. Our patient carrying L117F has no evidence of thyroid dysfunction at age 18 yr, of interest a second mutant PDS allele has not, to date, been identified (Table 2
), and alternative causes of dilated vestibular aqueduct (DVA) cannot be excluded. It is possible that this variant represents a functionally neutral polymorphism, although it was not present in a panel of 50 normal individuals (8). Pendrin has also been shown to transport chloride in a Xenopus oocyte system (30), and in the kidney there is evidence that it plays a role in the transport of OH-, HCO3-, and formate and may be a Cl-/base exchanger (31, 32). Hence, this mutation may have a specific effect on transport of these alternative ions, an impairment to which the inner ear is more sensitive.
The second correctly localizing mutation, G209V, is a conservative hydrophobic amino acid substitution of glycine to valine and causes a severe reduction in the ability of the protein to transport iodide. Within our cohort the mutation has been identified twice in the heterozygous state. In one individual, G209V was associated with the recurrent mutation, 1001+1G
A, and a positive perchlorate discharge test. A second patient with G209V has a negative perchlorate test and did not exhibit any thyroid pathology; however, the second mutation in this case has not been identified and is presumed to be within a noncoding region. The mutation has also previously been reported (9, 33). Usami et al. (11) recorded an individual with apparent nonsyndromic deafness homozygous for G209V but in whom, unfortunately, a perchlorate test had not been carried out. Two PDS alleles identified in a screen of individuals with nonsyndromic hearing loss associated with DVA that were expressed in an X. laevis oocyte system also showed a partial loss of iodide transport, although this study considered iodide influx only (34).
Two of the mutations investigated here, 1229 C
T (T410M) and 1337 A
G (Q446R), are documented as homozygous in individuals presenting with a DVA phenotype but normal thyroid pathology and a negative perchlorate discharge test (8). Our study indicated that both of these mutations are null alleles. Expression in HeLa, COS 7, and CHO cell lines all suggest that the mutant proteins are retained within the ER, the efflux assay demonstrating an inability to transport iodide. This result further supports the hypothesis that genetic background, perhaps together with nutritional factors including iodide uptake, plays a significant role in determining expression of the thyroid phenotype in PDS. These findings may not be unexpected in light of the recently reported pendrin mouse model (22). A targeted disruption of Pds, which removed exon 8 of the gene, caused mice homozygous for this change to have deafness associated with inner ear malformations, analgous with the human syndrome. Mice with an enlargement of the endolymphatic sac, duct, saccule, and an abnormal cochlea were observed. However, these mice showed a complete absence of any thyroid pathology. Other mouse models of thyroid disorders have been relevant to human disease (35, 36, 37); it will therefore be interesting when these mice are crossed to alternative genetic backgrounds.
The remaining mislocalizing mutations are associated with a range of thyroid pathology within our cohort. Such a spectrum of phenotype variability has long been noted in association with PDS (3). Examples of intrafamilial variability in the presentation of the thyroid phenotype, in which the mutation has been identified, have been reported. Masmoudi et al. (28) noted the missense mutation L445W to be present in a large consanguineous family in which histologically variable goitre was present in 11 of 23 affected individuals. Interestingly, none of these individuals tested positive in a perchlorate discharge test.
This observation, together with our mutational study, points toward some redundancy in the role of pendrin in the thyroid. It is now becoming clear that there may be an alternative iodide porter to facilitate efflux across the apical membrane. Some studies (38, 39) have suggested that iodide efflux is mediated by a TSH-induced iodide porter via either a cAMP or a Ca2+ PIP2 pathway; however, Golstein et al. (40) formally demonstrated the presence of two iodide channels in a plasma vesicle study, although no attempts were made to localize these conductances to either the apical or basal membrane.
In summary, this study has investigated nine missense mutations of the PDS gene associated with a spectrum of thyroid disease. The finding that the majority cause nonfunctional products confirms that the same primary genetic defect may be associated with different phenotypic expression and supports the fact that other genetic and environmental factors play a fundamental role in determining the presentation of PDS.
Acknowledgments
Footnotes
This work was supported by MRC(UK), Wellcome Trust, and Defeating Deafness.
Abbreviations: DVA, Dilated vestibular aqueduct; ER, endoplasmic reticulum; GFP, green fluorescent protein; HEK, human embryonic kidney, NIS, sodium iodide symporter; PDS, Pendred syndrome.
Received September 5, 2001.
Accepted January 14, 2002.
References
This article has been cited by other articles:
![]() |
S. Dossena, S. Rodighiero, V. Vezzoli, C. Nofziger, E. Salvioni, M. Boccazzi, E. Grabmayer, G. Botta, G. Meyer, L. Fugazzola, et al. Functional characterization of wild-type and mutated pendrin (SLC26A4), the anion transporter involved in Pendred syndrome J. Mol. Endocrinol., September 1, 2009; 43(3): 93 - 103. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dai, A. K. Stewart, F. Chebib, A. Hsu, J. Rozenfeld, D. Huang, D. Kang, V. Lip, H. Fang, H. Shao, et al. Distinct and novel SLC26A4/Pendrin mutations in Chinese and U.S. patients with nonsyndromic hearing loss Physiol Genomics, August 7, 2009; 38(3): 281 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bizhanova and P. Kopp The Sodium-Iodide Symporter NIS and Pendrin in Iodide Homeostasis of the Thyroid Endocrinology, March 1, 2009; 150(3): 1084 - 1090. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pera, S. Dossena, S. Rodighiero, M. Gandia, G. Botta, G. Meyer, F. Moreno, C. Nofziger, C. Hernandez-Chico, and M. Paulmichl Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA PNAS, November 25, 2008; 105(47): 18608 - 18613. [Abstract] [Full Text] [PDF] |
||||
![]() |
J S Yoon, H-J Park, S-Y Yoo, W Namkung, M J Jo, S K Koo, H-Y Park, W-S Lee, K H Kim, and M G Lee Heterogeneity in the processing defect of SLC26A4 mutants J. Med. Genet., July 1, 2008; 45(7): 411 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. N. Brownstein, A. A. Dror, D. Gilony, L. Migirov, K. Hirschberg, and K. B. Avraham A Novel SLC26A4 (PDS) Deafness Mutation Retained in the Endoplasmic Reticulum Arch Otolaryngol Head Neck Surg, April 1, 2008; 134(4): 403 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Dorwart, N. Shcheynikov, J. M. R. Baker, J. D. Forman-Kay, S. Muallem, and P. J. Thomas Congenital Chloride-losing Diarrhea Causing Mutations in the STAS Domain Result in Misfolding and Mistrafficking of SLC26A3 J. Biol. Chem., March 28, 2008; 283(13): 8711 - 8722. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Palos, M. E. R. Garcia-Rendueles, D. Araujo-Vilar, M. J. Obregon, R. M. Calvo, J. Cameselle-Teijeiro, S. B. Bravo, O. Perez-Guerra, L. Loidi, B. Czarnocka, et al. Pendred Syndrome in Two Galician Families: Insights into Clinical Phenotypes through Cellular, Genetic, and Molecular Studies J. Clin. Endocrinol. Metab., January 1, 2008; 93(1): 267 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Fugazzola, V. Cirello, S. Dossena, S. Rodighiero, M. Muzza, P. Castorina, F. Lalatta, U. Ambrosetti, P. Beck-Peccoz, G. Botta, et al. High phenotypic intrafamilial variability in patients with Pendred syndrome and a novel duplication in the SLC26A4 gene: clinical characterization and functional studies of the mutated SLC26A4 protein Eur. J. Endocrinol., September 1, 2007; 157(3): 331 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dallos, J. Zheng, and M. A. Cheatham Prestin and the cochlear amplifier J. Physiol., October 1, 2006; 576(1): 37 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zheng, G.-G. Du, K. Matsuda, A. Orem, S. Aguinaga, L. Deak, E. Navarrete, L. D. Madison, and P. Dallos The C-terminus of prestin influences nonlinear capacitance and plasma membrane targeting J. Cell Sci., July 1, 2005; 118(13): 2987 - 2996. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shepshelovich, L. Goldstein-Magal, A. Globerson, P. M. Yen, P. Rotman-Pikielny, and K. Hirschberg Protein synthesis inhibitors and the chemical chaperone TMAO reverse endoplasmic reticulum perturbation induced by overexpression of the iodide transporter pendrin J. Cell Sci., April 15, 2005; 118(8): 1577 - 1586. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kittanakom, E. Cordat, V. Akkarapatumwong, P.-t. Yenchitsomanus, and R. A. F. Reithmeier Trafficking Defects of a Novel Autosomal Recessive Distal Renal Tubular Acidosis Mutant (S773P) of the Human Kidney Anion Exchanger (kAE1) J. Biol. Chem., September 24, 2004; 279(39): 40960 - 40971. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Gillam, A. R. Sidhaye, E. J. Lee, J. Rutishauser, C. W. Stephan, and P. Kopp Functional Characterization of Pendrin in a Polarized Cell System: EVIDENCE FOR PENDRIN-MEDIATED APICAL IODIDE EFFLUX J. Biol. Chem., March 26, 2004; 279(13): 13004 - 13010. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Borck, C. Roth, U. Martine, G. Wildhardt, and J. Pohlenz Mutations in the PDS Gene in German Families with Pendred's Syndrome: V138F Is a Founder Mutation J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2916 - 2921. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Rotman-Pikielny, K. Hirschberg, P. Maruvada, K. Suzuki, I. E. Royaux, E. D. Green, L. D. Kohn, J. Lippincott-Schwartz, and P. M. Yen Retention of pendrin in the endoplasmic reticulum is a major mechanism for Pendred syndrome Hum. Mol. Genet., October 2, 2002; 11(21): 2625 - 2633. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bitner-Glindzicz Hereditary deafness and phenotyping in humans Br. Med. Bull., October 1, 2002; 63(1): 73 - 94. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |