This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Taylor, J. P. Articles by Trembath, R. C. Search for Related Content PubMed PubMed Citation Articles by Taylor, J. P. Articles by Trembath, R. C.

Mutations of the PDS Gene, Encoding Pendrin, Are Associated with Protein Mislocalization and Loss of Iodide Efflux: Implications for Thyroid Dysfunction in Pendred Syndrome

Division of Medical Genetics, Department of Genetics (J.P.T., R.C.T.), University of Leicester, Leicester LE1 7RH, United Kingdom; and Division of Clinical Sciences (North) (R.A.M., P.F.W., A.P.W.), University of Sheffield, Northern General Hospital, Sheffield S5 7AU United Kingdom

Address all correspondence and requests for reprints to: Richard C. Trembath, Division of Medical Genetics, Departments of Medicine and Genetics, Adrian Building, University of Leicester, University Road, Leicester LE1 7RH, United Kingdom. E-mail: . rtrembat{at}hgmp.mrc.ac.uk

Abstract

Pendred syndrome (PDS) is an autosomal recessive disorder characterized by deafness and goiter. Phenotypic heterogeneity is observed in affected individuals, and thyroid dysfunction is particularly variable. The syndrome is caused by mutations in the PDS (SLC26A4) gene, encoding an anion transporter pendrin, which localizes to the apical membrane of thyroid follicular cells. PDS is thought to enable efflux iodide into the follicle lumen. More than 50 diseases causing mutations of PDS have been reported. Here we have investigated the effect of nine PDS missense mutations on pendrin localization and iodide transport with the view to understanding their functional impact. As demonstrated by transient expression of green fluorescent protein-tagged pendrin mutant constructs in mammalian cell lines, appropriate trafficking to the plasma membrane was observed for only two mutants. The remaining PDS mutants appear to be retained within the endoplasmic reticulum following transfection. Iodide efflux assays were performed using human embryonic kidney 293 cells transfected with mutant pendrin and cotransfected with sodium iodide transporter to provide a mechanism of iodide uptake. The results indicated loss of pendrin iodide transport for all mislocalizing mutations. However, PDS mutants are associated with variable thyroid dysfunction in affected subjects. We concluded that additional genetic and/or environmental factors influence the thyroid activity in Pendred syndrome.

PENDRED SYNDROME (PDS) is the most common cause of syndromic deafness, accounting for up to 10% of all hereditary hearing loss (1). An autosomal recessive disorder, PDS is classically described as the association of sensorineural hearing deficit and goiter (2). Goiter characteristically develops during puberty although earlier- and later-onset cases have been noted, typical histology moving from diffuse to multinodular in longstanding cases. At least 50% of cases have normal circulating levels of thyroid hormones, others developing clinical hypothyroidism (3). Most affected subjects demonstrate impaired iodide organification, as determined by a positive perchlorate discharge test (1). Hearing loss in PDS is prelingual, and in at least 80% of patients it is associated with structural defects of the inner ear including a dilatation of the vestibular aqueduct and the Mondini defect of the cochlea (4).

The PDS locus was originally linked to chromosomal region 7q31 (5, 6) and the PDS gene identified by bioinformatic positional cloning in 1997 (7). More than 50 independent PDS gene mutations have been characterized as causing PDS (7, 8, 9, 10, 11, 12, 13, 14) and nonsyndromic deafness, in some cases confirmed by a normal perchlorate discharge test (8, 9, 11, 13). PDS mutations are distributed throughout the coding sequence, being identified in 18 of the 21 exons. The majority of mutations are missense, with a smaller number of insertions, deletions, frameshift, and splice site mutations also reported (7, 8, 9, 10, 11, 12, 13, 14). The wide distribution of mutations and lack of clustering to any domain of the gene, together with the variable phenotype, serve to compound efforts to correlate phenotype with genotype.

PDS encodes pendrin, a transmembrane protein of 780 amino acids, predicted to have either 11 or 12 membrane-spanning domains (7, 15). Pendrin is a member of the solute carrier family 26A (SLC26A), a group of anion transporter-related proteins, which include prestin, an inner ear protein (16), and CLD, the protein defective in congenital chloride diarrhea (17, 18). Expression studies in Xenopus laevis oocytes also support a role for pendrin as a chloride and iodide transporter (19).

PDS mRNA is expressed in the cochlea, thyroid, and kidney (7). Immunohistochemical analysis has indicated that pendrin is specifically localized to the apical membrane of thyroid follicular cells (15, 20), suggesting that its role in the thyroid may be to transport iodide into the colloidal space. In contrast, the sodium iodide symporter (NIS) is expressed on the basolateral membrane of the follicular cell and imports iodide into the follicle (21). The possible role of pendrin in the inner ear is less clear; it has been hypothesized that the chloride transport function of pendrin is important in the homeostasis of the endolymph with ionic imbalance potentially responsible for auditory developmental malformation (22).

In this study we have characterized a number of missense mutations by transient expression in HeLa and human embryonic kidney (HEK) 293 cell lines with a view to understanding, at a cellular level, the mechanism by which these mutations contribute to the PDS phenotype. We have developed a system to assess iodide efflux of pendrin and sought to determine the affect of mutations on this aspect of transporter function. Immunofluorescence has been used to assess the correct targeting of mutant pendrin to the cell surface membrane.

Materials and Methods

Generation of a green fluorescent protein (GFP)-tagged PDS construct and mutagenesis

The C-terminal portion of the PDS cDNA, excluding the stop codon, was amplified using the following primers: sense 5'ACTGTTGACTGTGGTCCTGAG 3' and antisense 5'TCGGTACCAGGGATGCAAGTGTACGCA3'. This 833-bp amplicon was digested with HincII and KpnI and cloned into pCR II-TA (Invitrogen, Paisley, UK) containing the wild-type PDS cDNA-spanning nucleotides -5-2343 bp (A of the ATG start codon is designated as +1 according to the published cDNA sequence). This modified PDS cDNA sequence was subcloned into the XhoI-KpnI site of pEGFP-N1 (CLONTECH Laboratories, Inc., Basingstoke, UK) using standard cloning protocols to produce a construct encoding for a carboxy terminal GFP pendrin fusion protein.

The PDS mutants, with the exception of G102R, were made using the Quik Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) using the primers listed in Table 1 and according to the manufacturer’s protocol.

Cell culture and transfections

HEK 293 and HeLa cells were cultured in DMEM Glutamax (Life Technologies, Inc. Ltd., Paisley, UK) supplemented with 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37 C in a humidified atmosphere containing 5% CO_2. Transfections were performed on cells grown to a confluence of 70–80%, using Fugene 6 (Roche Diagnostics Ltd., Lewes, UK) according to the manufacturer’s instructions. Cells cultured on glass coverslips, in 30-mm plates, were transfected with 2.5 µg plasmid DNA for immunofluorescence experiments. Iodide efflux assays were performed on HEK 293 cells, in 15-mm plates, previously transfected with 1 µg DNA: 0.5 µg NIS pcDNA3, as previously described (23) to allow iodide loading of cells, and 0.5 µg PDS-EGFP-N1, as described above.

Immunofluorescence

Forty-eight hours after transfection, cells were washed twice with ice-cold PBS and fixed in methanol for 10 min at 4 C. For Golgi complex staining, fixed cells were blocked by three washes in PBS/3% BSA. Coverslips were incubated for 1 h with Golgi 58 K antimouse antibody (Sigma, Poole, UK) at a 1:100 dilution. Cells were again washed before incubation with biotinylated antimouse Ig (Amersham Pharmacia Biotech Ltd., Little Chalfont, UK), at a 1:100 dilution for 45 min. Washed cells were then incubated for another 45 min, in darkness, with Streptavadin Texas Red (Amersham Pharmacia Biotech) at a 1:200 dilution. To detect the endoplasmic reticulum (ER), after methanol fixation, cells were washed twice with PBS and then incubated for 20 min with concavalin A, Alexa Fluor 59 conjugate (Cambridge Bioscience, Cambridge, UK) at a concentration of 0.5 µg/ml. After a final wash in PBS, coverslips were mounted using 80% glycerol and 3% propyl gallate and visualized using an Axiophot fluorescence microscope (Carl Zeiss Ltd., Welwyn Garden City, Herts, UK).

Iodide efflux assay

Forty-eight hours after transfection, cells were washed once in serum-free DMEM medium and incubated for 1 h in 500 µl serum-free medium containing Na [¹²⁵I] at 5 KBq/ml as the only source of iodide. The efflux assay was adapted from the method of Ajjan et al. (24). Cells were washed briefly in HBSS buffer and then incubated with 500 µl HBSS for 0–5 min after which HBSS was removed. Cells were solubilized by the addition of 500 µl 1N NaOH and the radioactivity measured using a counter (Wizard automatic counter, PerkinElmer Life Sciences Ltd., Cambridge, UK). All experiments were carried out three times on triplicate cultures. Transfection efficiency was determined by FACS analysis of GFP fluorescence and found to be approximately 50%. Statistical significance of the efflux assay results was determined by use of t test.

Results

We investigated nine missense mutations, previously characterized as disease causing from our cohort of Pendred patients: L117F, Q446R (8), V138F, T410M, Y556C, G672E (10), G209V (11), and G102R (Taylor, J. P., unpublished data). Table 2 shows a summary of the phenotypes associated with each of these mutations, and Fig. 1 indicates the location of the studied mutants on a predicted model of the pendrin protein.

View larger version (17K): [in this window] [in a new window]   Figure 1. Schematic representation of pendrin and the location of mutations studied. The topology of pendrin as predicted by the TMPRED program. Stars depict the mutations studied here, block shading indicates targeting to the plasma membrane, partial shading depicts partial membrane localization, and no shading indicates that the mutant pendrin is retained within the cytoplasm.

Pendrin has been shown, by immunohistochemical analysis, to be located at the apical membrane of thyroid follicular cells (15, 20). To assess the effect of mutations on membrane targeting, we expressed wild-type and mutant GFP-tagged pendrin in HeLa cells and observed localization using immunofluorescence (Fig. 2). Similar results were obtained using COS 7 cells and CHO-K1 cells (data not shown). These cells lack the polarization of thyroid follicular cells, yet wild-type pendrin was clearly present at the cell membrane. Mutants L117F and G209V showed a cell membrane protein distribution similar to that of the wild-type protein. Y556C and G672E mutants also showed a cell surface distribution in some cells (approximately 10% of those transfected), although the protein signal in these cells appeared to be less intense at the membrane. The remaining mutants, Q446R, V138F, T410M, and G102R, failed to reach the cell membrane and appeared to localize to distinct areas of the cytoplasm. We hypothesized that the retention of these mutants in the cytoplasm was caused by aberrant protein processing in either the ER or the Golgi. Using Concavalin A, an ER membrane stain, and a Golgi-specific antibody to label these organelles, respectively, we demonstrated that Q446R, V138F, T410M and G102R mutant pendrin colocalized with the ER (Fig. 3). ER localization is observed with several mutant membrane transporter proteins that cause human disorders, for example F508 CFTR (25), A147T and T126M AQP2 (26), and L707P AE1 (27) mutants.

View larger version (68K): [in this window] [in a new window]   Figure 2. Immunofluorescence of GFP-tagged pendrin. HeLa cells were transiently transfected with wild-type (A) or mutant (B–J) GFP-tagged pendrin. Mutant proteins L117F (C) and G209V (E) show strong membrane fluorescence similar to the wild-type. Mutants G102R (B), V138F (D), L236P (F), T410M (G), and Q446R (H) are not targeted to the cell membrane but retained within the cytoplasm. I and J show examples of cells, transfected with mutants Y556C and G672E, respectively, in which there is clearly some membrane localization, although more protein is retained in the cytoplasm, compared with the wild-type transfected cells. This distribution was typical of 10% of cells transfected with these mutant constructs; the remaining cells showed complete mislocalization of the protein, similar to that shown in B, D, F, G, and H.

View larger version (105K): [in this window] [in a new window]   Figure 3. Subcellular localization of wild-type pendrin and mutant pendrin, compared with intracellular organelles. A, C, E, G, I, K, M, and P show examples of HeLa cells 48 h after transfection with wild-type GFP-tagged pendrin or pendrin mutants that either mislocalize, localize to the cell membrane, or partially localize. B, F, J, and N show the corresponding cells stained for ER with concavalin A. D, H, L, and Q are stained for Golgi body with the Golgi 58K antibody.

Within the thyroid follicular cell, pendrin is speculated to mediate iodide efflux. To assess this specific iodide transport function in a heterologous cell system, we performed cotransfection with NIS, the sodium iodide symporter, to provide a mechanism by which cells could initially be loaded with iodide. NIS is known to import iodide into the thyroid follicular cell and so is the natural partner for pendrin within the thyroid. Figure 4 shows results from the cotransfection experiments. Cells transfected with NIS only showed a low rate of iodide efflux, most likely because of passive diffusion of iodide from the cells. Cells cotransfected with wild-type PDS efflux iodide at a high rate, losing up to 66% of accumulated iodide at 1 min of measurement. Cotransfection of all but two pendrin mutants resulted in a rate of efflux similar to that of cells transfected with NIS alone, indicating that these mutant proteins had lost their ability to transport iodide. L117F, however, exhibited a rate of iodide efflux statistically similar to that of the wild-type, and G209V showed the ability to partially efflux iodide albeit at a much reduced rate. Figure 5 shows the level of iodide efflux at 1 min of measurement.

View larger version (13K): [in this window] [in a new window]   Figure 4. The percentage radioiodide efflux over 5 min from HEK 293 cells transiently cotransfected with NIS plus the pEGFP-N1 vector only (•), NIS and wild-type pendrin (), or three of the mutant pendrin constructs: L117F (•), G209V (), or T410M (). The results are the mean of at least three separate experiments, each performed in triplicate. Error bars indicate a 95% confidence level. The %T0 axis represents iodide efflux and indicates the percentage change in the cell iodide content.

View larger version (18K): [in this window] [in a new window]   Figure 5. Percentage iodide efflux from HEK 293 cells transiently transfected with wild-type and mutant pendrin after 1 min of measurement. The results are the mean of at least three separate experiments, each performed in triplicate. Error bars indicate a 95% confidence level. The data were compared with NIS plus vector only transfection using a t test. The rate of efflux was not significantly different from the NIS control; P > 0.05 in all cases except *, P < 0.001 and **, P < 0.05.

To date, more than 50 pathogenic mutations of the PDS gene have been reported (7, 8, 9, 10, 11, 12, 13, 14, 28, 29). Here we have studied nine mutations, located throughout the gene, within predicted transmembrane domains, extracellular and intracellular regions, as indicated in Fig. 1. Each mutation resulted in substitution of amino acid residues highly conserved across the SLC26A gene family, of which PDS is a member. Five mutants showed a complete failure to reach the membrane when transfected transiently in cell culture systems but were retained within the ER. Such misprocessing indicated that these mutations cause aberrant folding of the polypeptide, thus preventing full maturation and processing to the cell surface membrane. This mechanism has been described in a number of membrane transporter proteins, including the common F508 CFTR mutation, which is also retained at the ER (25). Immunofluorescence studies of mutants Y556C and G672E indicate that the localization of these mutants to the membrane is partial, and the efflux assay demonstrated that the function of the protein that had reached the cell surface appropriately had been abolished.

Interestingly, of the two mutants, L117F and G209V, that did localize to the membrane, L117F performed as wild-type pendrin in the iodide efflux assay. This hydrophobic substitution of a highly conserved residue, located within the first predicted transmembrane domain, appears to have no deleterious effect. Our patient carrying L117F has no evidence of thyroid dysfunction at age 18 yr, of interest a second mutant PDS allele has not, to date, been identified (Table 2), and alternative causes of dilated vestibular aqueduct (DVA) cannot be excluded. It is possible that this variant represents a functionally neutral polymorphism, although it was not present in a panel of 50 normal individuals (8). Pendrin has also been shown to transport chloride in a Xenopus oocyte system (30), and in the kidney there is evidence that it plays a role in the transport of OH^-, HCO₃^-, and formate and may be a Cl^-/base exchanger (31, 32). Hence, this mutation may have a specific effect on transport of these alternative ions, an impairment to which the inner ear is more sensitive.

The second correctly localizing mutation, G209V, is a conservative hydrophobic amino acid substitution of glycine to valine and causes a severe reduction in the ability of the protein to transport iodide. Within our cohort the mutation has been identified twice in the heterozygous state. In one individual, G209V was associated with the recurrent mutation, 1001+1GA, and a positive perchlorate discharge test. A second patient with G209V has a negative perchlorate test and did not exhibit any thyroid pathology; however, the second mutation in this case has not been identified and is presumed to be within a noncoding region. The mutation has also previously been reported (9, 33). Usami et al. (11) recorded an individual with apparent nonsyndromic deafness homozygous for G209V but in whom, unfortunately, a perchlorate test had not been carried out. Two PDS alleles identified in a screen of individuals with nonsyndromic hearing loss associated with DVA that were expressed in an X. laevis oocyte system also showed a partial loss of iodide transport, although this study considered iodide influx only (34).

Two of the mutations investigated here, 1229 CT (T410M) and 1337 AG (Q446R), are documented as homozygous in individuals presenting with a DVA phenotype but normal thyroid pathology and a negative perchlorate discharge test (8). Our study indicated that both of these mutations are null alleles. Expression in HeLa, COS 7, and CHO cell lines all suggest that the mutant proteins are retained within the ER, the efflux assay demonstrating an inability to transport iodide. This result further supports the hypothesis that genetic background, perhaps together with nutritional factors including iodide uptake, plays a significant role in determining expression of the thyroid phenotype in PDS. These findings may not be unexpected in light of the recently reported pendrin mouse model (22). A targeted disruption of Pds, which removed exon 8 of the gene, caused mice homozygous for this change to have deafness associated with inner ear malformations, analgous with the human syndrome. Mice with an enlargement of the endolymphatic sac, duct, saccule, and an abnormal cochlea were observed. However, these mice showed a complete absence of any thyroid pathology. Other mouse models of thyroid disorders have been relevant to human disease (35, 36, 37); it will therefore be interesting when these mice are crossed to alternative genetic backgrounds.

The remaining mislocalizing mutations are associated with a range of thyroid pathology within our cohort. Such a spectrum of phenotype variability has long been noted in association with PDS (3). Examples of intrafamilial variability in the presentation of the thyroid phenotype, in which the mutation has been identified, have been reported. Masmoudi et al. (28) noted the missense mutation L445W to be present in a large consanguineous family in which histologically variable goitre was present in 11 of 23 affected individuals. Interestingly, none of these individuals tested positive in a perchlorate discharge test.

This observation, together with our mutational study, points toward some redundancy in the role of pendrin in the thyroid. It is now becoming clear that there may be an alternative iodide porter to facilitate efflux across the apical membrane. Some studies (38, 39) have suggested that iodide efflux is mediated by a TSH-induced iodide porter via either a cAMP or a Ca²⁺ PIP₂ pathway; however, Golstein et al. (40) formally demonstrated the presence of two iodide channels in a plasma vesicle study, although no attempts were made to localize these conductances to either the apical or basal membrane.

In summary, this study has investigated nine missense mutations of the PDS gene associated with a spectrum of thyroid disease. The finding that the majority cause nonfunctional products confirms that the same primary genetic defect may be associated with different phenotypic expression and supports the fact that other genetic and environmental factors play a fundamental role in determining the presentation of PDS.

Acknowledgments

Footnotes

This work was supported by MRC(UK), Wellcome Trust, and Defeating Deafness.

Abbreviations: DVA, Dilated vestibular aqueduct; ER, endoplasmic reticulum; GFP, green fluorescent protein; HEK, human embryonic kidney, NIS, sodium iodide symporter; PDS, Pendred syndrome.

Received September 5, 2001.

Accepted January 14, 2002.

References

1. Fraser GR 1965 association of congenital deafness with goitre (Pendred’s syndrome): a study of 207 families. Ann Hum Genet 28:201–249[Medline]
2. Pendred V 1896 Deaf-mutism and goitre. Lancet II:532
3. Reardon W, Coffey R, Chowdhury T, Grossman A, Jan H, Britton K, Kendall-Taylor P, Trembath R 1999 Prevalence, age of onset, and natural history of thyroid disease in Pendred syndrome. J Med Genet 36:595–598[Abstract/Free Full Text]
4. Phelps PD, Coffey RA, Trembath RC, Luxon LM, Grossman AB, Britton KE, Kendall-Taylor P, Graham JM, Cadge BC, Stephens SG, Pembrey ME, Reardon W 1998 Radiological malformations of the ear in Pendred syndrome. Clin Radiol 53:268–273[CrossRef][Medline]
5. Coyle B, Coffey R, Armour JA, Gausden E, Hochberg Z, Grossman A, Britton K, Pembrey M, Reardon W, Trembath R 1996 Pendred syndrome (goitre and sensorineural hearing loss) maps to chromosome 7 in the region containing the nonsyndromic deafness gene DFNB4. Nat Genet 12:421–423[CrossRef][Medline]
6. Sheffield VC, Kraiem Z, Beck JC, Nishimura D, Stone EM, Salameh M, Sadeh O, Glaser B 1996 Pendred syndrome maps to chromosome 7q21-34 and is caused by an intrinsic defect in thyroid iodine organification. Nat Genet 12:424–426[CrossRef][Medline]
7. Everett LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, Adawi F, Hazani E, Nassir E, Baxevanis AD, Sheffield VC, Green ED 1997 Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet 17:411–422[CrossRef][Medline]
8. Reardon W, O’Mahoney CF, Trembath R, Jan H, Phelps PD 2000 Enlarged vestibular aqueduct: a radiological marker of Pendred syndrome, and mutation of the PDS gene. Q J Med 93:99–104[Abstract/Free Full Text]
9. Campbell C, Cucci RA, Prasad S, Green GE, Edeal JB, Galer CE, Karniski LP, Sheffield VC, Smith RJ 2001 Pendred syndrome, DFNB4, and PDS/SLC26A4 identification of eight novel mutations and possible genotype-phenotype correlations. Hum Mutat 17:403–411[CrossRef][Medline]
10. Coyle B, Reardon W, Herbrick JA, Tsui LC, Gausden E, Lee J, Coffey R, Grueters A, Grossman A, Phelps PD, Luxon L, Kendall-Taylor P, Scherer SW, Trembath RC 1998 Molecular analysis of the PDS gene in Pendred syndrome. Hum Mol Genet 7:1105–1112[Abstract/Free Full Text]
11. Usami S, Abe S, Weston MD, Shinkawa H, Van Camp G, Kimberling WJ 1999 Non-syndromic hearing loss associated with enlarged vestibular aqueduct is caused by PDS mutations. Hum Genet 104:188–192[CrossRef][Medline]
12. Coucke PJ, Van Hauwe P, Everett LA, Demirhan O, Kabakkaya Y, Dietrich NL, Smith RJ, Coyle E, Reardon W, Trembath R, Willems PJ, Green ED, Van Camp G 1999 Identification of two different mutations in the PDS gene in an inbred family with Pendred syndrome. J Med Genet 36:475–477[Abstract/Free Full Text]
13. Li XC, Everett LA, Lalwani AK, Desmukh D, Friedman TB, Green ED, Wilcox ER 1998 A mutation in PDS causes non-syndromic recessive deafness. Nat Genet 18:215–217[CrossRef][Medline]
14. Gonzalez Trevino O, Karamanoglu Arseven O, Ceballos CJ, Vives VI, Ramirez RC, Gomez VV, Medeiros-Neto G, Kopp P 2001 Clinical and molecular analysis of three Mexican families with Pendred’s syndrome. Eur J Endocrinol 144:585–593[Abstract]
15. Royaux IE, Suzuki K, Mori A, Katoh R, Everett LA, Kohn LD, Green ED 2000 Pendrin, the protein encoded by the Pendred syndrome gene (PDS), is an apical porter of iodide in the thyroid and is regulated by thyroglobulin in FRTL-5 cells. Endocrinology 141:839–845[Abstract/Free Full Text]
16. Zheng J, Shen W, He DZ, Long KB, Madison LD, Dallos P 2000 Prestin is the motor protein of cochlear outer hair cells. Nature 405:149–155[CrossRef][Medline]
17. Everett LA, Green ED 1999 A family of mammalian anion transporters and their involvement in human genetic diseases. Hum Mol Genet 8:1883–1891[Abstract/Free Full Text]
18. Kere J, Lohi H, Hoglund P 1999 Genetic disorders of membrane transport III. Congenital chloride diarrhea. Am J Physiol 276:G7–G13
19. Scott DA, Wang R, Kreman TM, Sheffield VC, Karniski LP 1999 The Pendred syndrome gene encodes a chloride-iodide transport protein. Nat Genet 21:440–443[CrossRef][Medline]
20. Bidart JM, Mian C, Lazar V, Russo D, Filetti S, Caillou B, Schlumberger M 2000 Expression of pendrin and the Pendred syndrome (PDS) gene in human thyroid tissues. J Clin Endocrinol Metab 85:2028–2033[Abstract/Free Full Text]
21. Dohan O, De la Vieja A, Carrasco N 2000 Molecular study of the sodium-iodide symporter (NIS): a new field in thyroidology. Trends Endocrinol Metab 11:99–105[CrossRef][Medline]
22. Everett LA, Belyantseva IA, Noben-Trauth K, Cantos R, Chen A, Thakkar SI, Hoogstraten-Miller SL, Kachar B, Wu DK, Green ED 2001 Targeted disruption of mouse Pds provides insight about the inner-ear defects encountered in Pendred syndrome. Hum Mol Genet 10:153–161[Abstract/Free Full Text]
23. Ajjan RA, Kemp EH, Waterman EA, Watson PF, Endo T, Onaya T, Weetman AP 2000 Detection of binding and blocking autoantibodies to the human sodium-iodide symporter in patients with autoimmune thyroid disease. J Clin Endocrinol Metab 85:2020–2027[Abstract/Free Full Text]
24. Ajjan RA, Findlay C, Metcalfe RA, Watson PF, Crisp M, Ludgate M, Weetman AP 1998 The modulation of the human sodium iodide symporter activity by Graves’ disease sera. J Clin Endocrinol Metab 83:1217–1221[Abstract/Free Full Text]
25. Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, O’Riordan CR, Smith AE 1990 Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63:827–834[CrossRef][Medline]
26. Tamarappoo BK, Yang B, Verkman AS 1999 Misfolding of mutant aquaporin-2 water channels in nephrogenic diabetes insipidus. J Biol Chem 274:34825–34831[Abstract/Free Full Text]
27. Quilty JA, Reithmeier RA 2000 Trafficking and folding defects in hereditary spherocytosis mutants of the human red cell anion exchanger. Traffic 1:987–998[CrossRef][Medline]
28. Masmoudi S, Charfedine I, Hmani M, Grati M, Ghorbel AM, Elgaied-Boulila A, Drira M, Hardelin JP, Ayadi H 2000 Pendred syndrome: phenotypic variability in two families carrying the same PDS missense mutation. Am J Med Genet 90:38–44[CrossRef][Medline]
29. Lopez-Bigas N, Rabionet R, de Cid R, Govea N, Gasparini P, Zelante L, Arbones ML, Estivill X 1999 Splice-site mutation in the PDS gene may result in intrafamilial variability for deafness in Pendred syndrome. Hum Mutat 14:520–526[CrossRef][Medline]
30. Scott DA, Karniski LP 2000 Human pendrin expressed in Xenopus laevis oocytes mediates chloride/formate exchange. Am J Physiol Cell Physiol 278:C207–C211
31. Royaux IE, Wall SM, Karniski LP, Everett LA, Suzuki K, Knepper MA, Green ED 2001 Pendrin, encoded by the Pendred syndrome gene, resides in the apical region of renal intercalated cells and mediates bicarbonate secretion. Proc Natl Acad Sci USA 98:4221–4226[Abstract/Free Full Text]
32. Soleimani M, Greeley T, Petrovic S, Wang Z, Amlal H, Kopp P, Burnham CE 2001 Pendrin: an apical Cl-/OH-/HCO3- exchanger in the kidney cortex. Am J Physiol Renal Physiol 280:F356–F364
33. Van Hauwe P, Everett LA, Coucke P, Scott DA, Kraft ML, Ris-Stalpers C, Bolder C, Otten B, de Vijlder JJ, Dietrich NL, Ramesh A, Srisailapathy SC, Parving A, Cremers CW, Willems PJ, Smith RJ, Green ED, Van Camp G 1998 Two frequent missense mutations in Pendred syndrome. Hum Mol Genet 7:1099–1104[Abstract/Free Full Text]
34. Scott DA, Wang R, Kreman TM, Andrews M, McDonald JM, Bishop JR, Smith RJ, Karniski LP, Sheffield VC 2000 Functional differences of the PDS gene product are associated with phenotypic variation in patients with Pendred syndrome and non-syndromic hearing loss (DFNB4). Hum Mol Genet 9:1709–1715[Abstract/Free Full Text]
35. Beamer WJ, Eicher EM, Maltais LJ, Southard JL 1981 Inherited primary hypothyroidism in mice. Science 212:61–63[Abstract/Free Full Text]
36. De Felice M, Ovitt C, Biffali E, Rodriguez-Mallon A, Arra C, Anastassiadis K, Macchia PE, Mattei MG, Mariano A, Scholer H, Macchia V, Di Lauro R 1998 A mouse model for hereditary thyroid dysgenesis and cleft palate. Nat Genet 19:395–398[CrossRef][Medline]
37. Kimura S, Hara Y, Pineau T, Fernandez-Salguero P, Fox CH, Ward JM, Gonzalez FJ 1996 The T/ebp null mouse: thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, ventral forebrain, and pituitary. Genes Dev 10:60–69[Abstract/Free Full Text]
38. Nilsson M, Bjorkman U, Ekholm R, Ericson LE 1990 Iodide transport in primary cultured thyroid follicle cells: evidence of a TSH-regulated channel mediating iodide efflux selectively across the apical domain of the plasma membrane. Eur J Cell Biol 52:270–281[Medline]
39. Weiss SJ, Philp NJ, Grollman EF 1984 Effect of thyrotropin on iodide efflux in FRTL-5 cells mediated by Ca2+. Endocrinology 114:1108–1113[Abstract/Free Full Text]
40. Golstein P, Abramow M, Dumont JE, Beauwens R 1992 The iodide channel of the thyroid: a plasma membrane vesicle study. Am J Physiol 263:C590–C597

This article has been cited by other articles:

				S. Dossena, S. Rodighiero, V. Vezzoli, C. Nofziger, E. Salvioni, M. Boccazzi, E. Grabmayer, G. Botta, G. Meyer, L. Fugazzola, et al. Functional characterization of wild-type and mutated pendrin (SLC26A4), the anion transporter involved in Pendred syndrome J. Mol. Endocrinol., September 1, 2009; 43(3): 93 - 103. [Abstract] [Full Text] [PDF]

				P. Dai, A. K. Stewart, F. Chebib, A. Hsu, J. Rozenfeld, D. Huang, D. Kang, V. Lip, H. Fang, H. Shao, et al. Distinct and novel SLC26A4/Pendrin mutations in Chinese and U.S. patients with nonsyndromic hearing loss Physiol Genomics, August 7, 2009; 38(3): 281 - 290. [Abstract] [Full Text] [PDF]

				A. Bizhanova and P. Kopp The Sodium-Iodide Symporter NIS and Pendrin in Iodide Homeostasis of the Thyroid Endocrinology, March 1, 2009; 150(3): 1084 - 1090. [Abstract] [Full Text] [PDF]

				A. Pera, S. Dossena, S. Rodighiero, M. Gandia, G. Botta, G. Meyer, F. Moreno, C. Nofziger, C. Hernandez-Chico, and M. Paulmichl Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA PNAS, November 25, 2008; 105(47): 18608 - 18613. [Abstract] [Full Text] [PDF]

				J S Yoon, H-J Park, S-Y Yoo, W Namkung, M J Jo, S K Koo, H-Y Park, W-S Lee, K H Kim, and M G Lee Heterogeneity in the processing defect of SLC26A4 mutants J. Med. Genet., July 1, 2008; 45(7): 411 - 419. [Abstract] [Full Text] [PDF]

				Z. N. Brownstein, A. A. Dror, D. Gilony, L. Migirov, K. Hirschberg, and K. B. Avraham A Novel SLC26A4 (PDS) Deafness Mutation Retained in the Endoplasmic Reticulum Arch Otolaryngol Head Neck Surg, April 1, 2008; 134(4): 403 - 407. [Abstract] [Full Text] [PDF]

				M. R. Dorwart, N. Shcheynikov, J. M. R. Baker, J. D. Forman-Kay, S. Muallem, and P. J. Thomas Congenital Chloride-losing Diarrhea Causing Mutations in the STAS Domain Result in Misfolding and Mistrafficking of SLC26A3 J. Biol. Chem., March 28, 2008; 283(13): 8711 - 8722. [Abstract] [Full Text] [PDF]

				F. Palos, M. E. R. Garcia-Rendueles, D. Araujo-Vilar, M. J. Obregon, R. M. Calvo, J. Cameselle-Teijeiro, S. B. Bravo, O. Perez-Guerra, L. Loidi, B. Czarnocka, et al. Pendred Syndrome in Two Galician Families: Insights into Clinical Phenotypes through Cellular, Genetic, and Molecular Studies J. Clin. Endocrinol. Metab., January 1, 2008; 93(1): 267 - 277. [Abstract] [Full Text] [PDF]

				L. Fugazzola, V. Cirello, S. Dossena, S. Rodighiero, M. Muzza, P. Castorina, F. Lalatta, U. Ambrosetti, P. Beck-Peccoz, G. Botta, et al. High phenotypic intrafamilial variability in patients with Pendred syndrome and a novel duplication in the SLC26A4 gene: clinical characterization and functional studies of the mutated SLC26A4 protein Eur. J. Endocrinol., September 1, 2007; 157(3): 331 - 338. [Abstract] [Full Text] [PDF]

				P. Dallos, J. Zheng, and M. A. Cheatham Prestin and the cochlear amplifier J. Physiol., October 1, 2006; 576(1): 37 - 42. [Abstract] [Full Text] [PDF]

				J. Zheng, G.-G. Du, K. Matsuda, A. Orem, S. Aguinaga, L. Deak, E. Navarrete, L. D. Madison, and P. Dallos The C-terminus of prestin influences nonlinear capacitance and plasma membrane targeting J. Cell Sci., July 1, 2005; 118(13): 2987 - 2996. [Abstract] [Full Text] [PDF]

				J. Shepshelovich, L. Goldstein-Magal, A. Globerson, P. M. Yen, P. Rotman-Pikielny, and K. Hirschberg Protein synthesis inhibitors and the chemical chaperone TMAO reverse endoplasmic reticulum perturbation induced by overexpression of the iodide transporter pendrin J. Cell Sci., April 15, 2005; 118(8): 1577 - 1586. [Abstract] [Full Text] [PDF]

				S. Kittanakom, E. Cordat, V. Akkarapatumwong, P.-t. Yenchitsomanus, and R. A. F. Reithmeier Trafficking Defects of a Novel Autosomal Recessive Distal Renal Tubular Acidosis Mutant (S773P) of the Human Kidney Anion Exchanger (kAE1) J. Biol. Chem., September 24, 2004; 279(39): 40960 - 40971. [Abstract] [Full Text] [PDF]

				M. P. Gillam, A. R. Sidhaye, E. J. Lee, J. Rutishauser, C. W. Stephan, and P. Kopp Functional Characterization of Pendrin in a Polarized Cell System: EVIDENCE FOR PENDRIN-MEDIATED APICAL IODIDE EFFLUX J. Biol. Chem., March 26, 2004; 279(13): 13004 - 13010. [Abstract] [Full Text] [PDF]

				G. Borck, C. Roth, U. Martine, G. Wildhardt, and J. Pohlenz Mutations in the PDS Gene in German Families with Pendred's Syndrome: V138F Is a Founder Mutation J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2916 - 2921. [Abstract] [Full Text] [PDF]

				P. Rotman-Pikielny, K. Hirschberg, P. Maruvada, K. Suzuki, I. E. Royaux, E. D. Green, L. D. Kohn, J. Lippincott-Schwartz, and P. M. Yen Retention of pendrin in the endoplasmic reticulum is a major mechanism for Pendred syndrome Hum. Mol. Genet., October 2, 2002; 11(21): 2625 - 2633. [Abstract] [Full Text] [PDF]

				M. Bitner-Glindzicz Hereditary deafness and phenotyping in humans Br. Med. Bull., October 1, 2002; 63(1): 73 - 94. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Taylor, J. P. Articles by Trembath, R. C. Search for Related Content PubMed PubMed Citation Articles by Taylor, J. P. Articles by Trembath, R. C.