This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Schild, R. L. Articles by Sadovsky, Y. Search for Related Content PubMed PubMed Citation Articles by Schild, R. L. Articles by Sadovsky, Y.

The Activity of PPAR in Primary Human Trophoblasts Is Enhanced by Oxidized Lipids

Departments of Obstetrics and Gynecology (R.L.S., W.T.S., M.G.C., E.J.C., D.M.N., Y.S.) and Cell Biology and Physiology (Y.S.), Washington University School of Medicine, St. Louis, Missouri 63110

Address all correspondence and requests for reprints to: Yoel Sadovsky, M.D., Washington University School of Medicine, Department of Obstetrics and Gynecology, Campus Box 8064, 4566 Scott Avenue, St. Louis, Missouri 63110. E-mail: . sadovskyy{at}msnotes.wustl.edu

Abstract

The ligand-dependent nuclear receptor PPAR plays an important role in murine and human trophoblast differentiation. Oxidized lipids, which are implicated in the pathophysiology of placental dysfunction, have recently been identified as ligands for PPAR. We therefore hypothesized that oxidized lipids activate PPAR in human trophoblasts and influence placental function. To test our hypothesis, we examined the effect of 9S-hydroxy-10E,12Z-octadecadienoic acid (9-HODE), 13S-hydroxy-9Z,11E-octadecadienoic acid (13-HODE), and 15S-hydroxy-5Z,8Z,11Z,13E-eicosatetraenoic acid (15-HETE) on PPAR activity in cultured term human trophoblasts. Our results demonstrate that these lipids stimulate PPAR activity and that the AF-2 fragment, which harbors the ligand-binding domain of PPAR, mediates this effect. Furthermore, we assessed the consequences of PPAR activation by the oxidized lipids, and we found that these lipids stimulate human CG production, a measure of trophoblast differentiation. In contrast, the expression of syncytin, a marker for syncytium formation as well as the expression of the cell cycle modulators cyclin E and p27 are unchanged by the oxidized lipids. We concluded that 9-HODE, 13-HODE, and 15-HETE activate PPAR in primary human trophoblasts. These PPAR ligands may play a role in placental differentiation, yet they are unlikely to contribute to trophoblast dysfunction.

PPAR IS A MEMBER OF THE NUCLEAR receptor superfamily of proteins. Three PPAR members, PPAR, PPARß/, and PPAR, have been identified, each encoded by a separate gene (1), and each exhibits a distinct tissue distribution. PPAR is expressed predominantly in adipose tissue (2, 3), monocytes, macrophages (4, 5, 6), and the placenta (7, 8, 9, 10, 11, 12). Ligands for PPAR include fatty acids (13), oxidized low-density lipoprotein derivatives (5), the prostaglandin metabolite 15-deoxy-^12,14-prostaglandin J₂ (15PGJ₂) (14, 15) and the antidiabetic thiazolidinedione drugs (16, 17). Ligand-activated PPAR enhances the differentiation of several cell types, including preadipocytes (15, 18, 19), monocytes (4), and myoblasts (20). In addition, PPAR promotes the differentiation of diverse cancer cells (21, 22, 23).

The main functional unit in the human placenta is the villus, in which transport of oxygen, nutrients, and waste products takes place between fetal and maternal blood across a trophoblast bilayer. Trophoblast differentiation is characterized by fusion of the mitotically active, undifferentiated cytotrophoblasts to form the nondividing, terminally differentiated syncytiotrophoblast. PPAR is essential for development of murine placenta, and it regulates differentiation of murine and human trophoblasts (8, 9, 11, 12). Specifically, placentas from PPAR null mouse embryos exhibit a disrupted labyrinthine trilaminar epithelium and retain the immature characteristics of the early parenchyma (9). These defects ultimately result in embryonic lethality at d E10.5. We have recently demonstrated that PPAR is expressed in human trophoblasts and that PPAR ligands influence trophoblast differentiation, with troglitazone enhancing differentiation and 15PGJ₂ hindering this process and promoting trophoblast apoptosis (11).

Several endogenous oxidized lipids, including 9Shydroxy-10E,12S-octadecadienoic acid (9-HODE), 13S-hydroxy-9Z,11E-octadecadienoic acid (13-HODE), and 15S-hydroxy-5Z,8Z,11Z,13E-eicosatetraenoic acid (15-HETE) were recently identified as ligands of PPAR (4, 5). Stimulation of PPAR activity by these ligands enhances the transcription of CD36, leading to further uptake of oxidized low-density lipoprotein and differentiation of monocytes into foam cells (4, 5, 24, 25). Oxidized lipids are particularly relevant to trophoblast biology, in which they are implicated in trophoblast injury (26, 27). For example, preeclampsia has been associated with enhanced lipid peroxidation in trophoblasts (28, 29). In addition, we and others have demonstrated an increase in production of 15-HETE in vitro from trophoblasts derived from preeclamptic women (30, 31). Because PPAR influences trophoblast differentiation, we postulated that oxidized lipids might play a role in this process and contribute to trophoblast dysfunction. We therefore hypothesized that oxidized lipids enhance the activity of PPAR in human trophoblasts. To test this hypothesis, we examined the effect of oxidized lipids on trophoblast differentiation in vitro. We demonstrated that the oxidized lipids 9-HODE, 13-HODE, and 15-HETE activate PPAR in trophoblasts, and this effect requires the ligand-binding domain of PPAR. Importantly, these oxidized lipids enhance trophoblast human CG (hCG) production, but they have no effect on other markers for differentiation of human trophoblasts.

Materials and Methods

Cell culture

Our study was approved by the human studies committee at Washington University School of Medicine. Primary human cytotrophoblasts were prepared from normal, term human placentas using the trypsin-DNase-Dispase/Percoll method as described by Kliman et al. (32) with previously published modifications (33). Cultures were plated at a density of 300,000 cells/cm² and maintained in Earl’s medium 199 (M199) or Ham’s/Waymouth medium (H/W), containing 10% FBS (HyClone Laboratories, Inc., Logan, UT) with antibiotics as described (11). Where indicated, cultures were supplemented with 1 mM 8-Br-cAMP (Sigma, St. Louis, MO), 100 ng/ml epidermal growth factor (EGF, Upstate Biotechnology, Inc., Lake Placid, NY), 1.5% DMSO (Sigma), 250 µM colchicine (Sigma), 10 µM troglitazone (a generous gift from A. Saltiel, Parke-Davis, Ann Arbor, MI), 10 µM 15PGJ₂ (Cayman, Ann Arbor, MI), or 20 µM 9-HODE, 13-HODE, and 15-HETE (all from Cayman). The concentrations of oxidized lipids and PPAR ligands in the culture media were previously optimized to yield maximal responses in vitro and were consistent with published reports (5, 25). Vehicle alone (dimethyl sulfoxide at a final concentration of 0.1%) had no effect on any of the parameters tested (data not shown).

Expression analysis

Cell lysis, sonication, 10% PAGE, and transfer were performed as previously described (11). Membranes were incubated overnight at 4 C with primary antibody (mouse monoclonal anti-p27, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or mouse monoclonal anti-cyclin E (Novacastra Laboratories, Newcastle upon Tyne, UK). The blot was subsequently washed, incubated for 1 h with horseradish peroxidase-conjugated goat-antimouse antibody (Santa Cruz Biotechnology, Inc.), washed, and processed for luminescence using the ECL kit (Amersham Pharmacia Biotech, Arlington Heights, IL). Densitometric analysis was performed using a densitometer and ImageQuant v. 3.3 software (Molecular Dynamics, Inc., Sunnyvale, CA). To control for equal protein loading, the membranes were stripped in 12.7 M ß-mercaptoethanol, 10% SDS, and 0.5 M Tris-HCl pH 6.7 for 30 min; washed in TBS (0.15 M NaCl, 10 mM Tris-HCl, pH 8.0); reblocked with powdered milk in TBS containing 0.2% Tween-20 for 1 h; and reprobed with goat polyclonal antiactin (Santa Cruz Biotechnology, Inc.) for 1 h, followed by incubation with horseradish peroxidase-conjugated donkey antigoat IgG secondary antibody (Santa Cruz Biotechnology, Inc.) and developed as described above.

Total RNA was isolated from primary human trophoblasts using Tri-reagent (MRC, Cincinnati, OH). The experiments were repeated using mRNA isolated from total RNA using Oligotex mRNA purification system (QIAGEN, Valencia, CA). Samples of total RNA (20 µg) or mRNA (2 µg) were resolved by electrophoresis using a 1% agarose/1.5% formaldehyde gel. Specific probes for Northern blot analysis of syncytin were generated by PCR using standard techniques. The forward primer was GCATAAGCTTCCCATGGCCCTCCCTTATCA and reverse primer GCATGGATCCCGCTCTAACTGCTTCCTGCT. The probes were labeled with ³²P-dCTP using a Prime-It II labeling kit (Stratagene, La Jolla, CA). RNA was transferred to nylon membranes (\|[zgr ]\|-Probe, Bio-Rad, Hercules, CA) and hybridized overnight at 42 C. The blots were washed five times in 2–0.1x sodium chloride/sodium citrate buffer (1x buffer is 0.15 M sodium chloride and 0.015 M sodium citrate) with 0.1% SDS at 65 C. Blots were exposed to a PhosphorImager (Molecular Dynamics, Inc.) screen for 2 h. The PhosphorImager’s ImageQuant software was used for quantitative analysis of syncytin expression, corrected to expression of 18S.

hCG concentration determination

Culture supernatants were assayed for hCG in duplicates by ELISA (DRG GmbH, Marburg, Germany). Values represent mean hCG secreted per 24-h interval, normalized to protein.

Transient transfection and PPRE reporter assay

For PPAR expression we used a mouse PPAR cDNA construct (a generous gift from D. Kelly, Washington University, St. Louis, MO). The mouse and human PPAR cDNA possess a 99% similarity and 95% identity at the amino acid level (34). We used PCR to generate PPAR-AF-1 (aa 1–107) and PPAR-AF-2 (aa 163–475) fragments, which were cloned in frame between the BamHI and HindIII polylinker sites downstream from the GAL4 DNA-binding domain (residues 1–147) in the pM2 vector (35). The PPAR response element (PPRE)x3-Luc (11) as well as the GAL4 x 5-tkLuc reporter plasmids (36) were previously described. Trophoblasts were plated 1 d before transfection and transfected according to the calcium-phosphate coprecipitation method, as previously described (11, 37). Transfection efficiency, previously determined using galactosidase detection in primary trophoblasts transiently transfected with ßGal expression vector, was found to be 0.5–1%. For assessment of intact human PPAR activity, we used 2.0 µg PPAR vector or salmon sperm DNA, 0.3 µg PPREx3-Luc plasmid, and 0.1 µg RSV-ß-galactosidase reporter construct (to normalize for cell viability and transfection efficiency). For activity of ligand-independent (AF-1) or ligand-dependent (AF-2) domains of PPAR, we used 1.0 µg either GAL4-AF-1 or GAL4-AF-2 fusion constructs, respectively. These were cotransfected along with 0.5 µg GAL4 x 5-tkLuc reporter plasmid and 0.1 µg RSV-ß-galactosidase reporter construct. Luciferase assay was performed 48 h after the transfection and analyzed using a Lumistar luminometer (BMG Lab Technologies, Durham, NC). The activity of ß-galactosidase was assayed as described (11). All experiments were performed in duplicates and repeated a minimum of three times. Results were expressed as fold increase in relative luciferase units, corrected to ß-galactosidase, and compared with unstimulated cultures.

Statistical analysis

Interval data are expressed as mean plus or minus SE of at least three experiments, each performed in duplicates. Statistical significance (P < 0.05) was determined by ANOVA with Bonferroni post hoc test, and t test where indicated.

Results

PPAR expression diminishes in undifferentiated trophoblasts

We have recently demonstrated that the expression of PPAR in third-trimester human trophoblasts in vitro is maximal at 24 h of culture and is not enhanced by differentiation into syncytium (11). To ensure that PPAR is optimally expressed in our experimental conditions, we first examined whether its expression is altered by conditions known to modulate trophoblast differentiation. As shown in Fig. 1, stimulation of trophoblast differentiation with EGF or 8-Br-cAMP was not associated with enhanced PPAR expression. In contrast, conditions known to hinder trophoblast differentiation, including culture in the presence of colchicine, DMSO, or H/W medium, led to a diminution in PPAR expression (Fig. 1). These data establish the pattern of PPAR expression in undifferentiated trophoblasts, supporting the conditions used in our subsequent experiments.

View larger version (26K): [in this window] [in a new window]   Figure 1. The effect of trophoblast differentiation on PPAR expression, determined by Western immunoblotting. Primary trophoblasts were cultured in either M199 (control), M199 with EGF (100 ng/ml), 8-Br-cAMP (1 mM), colchicine (250 µ M), DMSO (1.5%), or H/W medium. Cells were harvested after 24 h and at 72 h of culture. Data represent experiments from a minimum of two different term placentas.

Oxidized lipids enhance PPAR activity

The oxidized lipids 9-HODE and 13-HODE stimulate PPAR activity in monocytes and macrophages (4, 5). To test whether these oxidized lipids activate intact PPAR in human trophoblasts, we transfected primary trophoblasts with PPAR along with the PPREx3-Luc reporter construct. All lipids tested led to a significant increase in PPAR activity, compared with control (Fig. 2A). Because these oxidized lipids act as ligands for PPAR, we predicted that they would activate PPAR in an AF-2-dependent manner. To confirm this prediction, we transfected primary trophoblasts with either GAL4-PPARAF-1 or GAL4-PPARAF-2, along with the GAL4 x 5-tkLuc reporter construct. Indeed, none of the ligands tested increased the activity of AF-1, which is devoid of a ligand-binding domain (Fig. 2B). In contrast, all three oxidized lipids markedly activated the transfected AF-2, which harbors the ligand-binding domain of PPAR (Fig. 2C). Taken together, these data indicate that oxidized lipids stimulate the activity of PPAR in cultured primary human trophoblasts, and this effect is mediated through the ligand-dependent AF-2 domain.

View larger version (25K): [in this window] [in a new window]   Figure 2. Ligands stimulate the activity of PPAR in cultured human trophoblasts. Primary trophoblasts were transfected with either PPAR and PPREx3-Luc (A) or with GAL4-PPARAF-1 (B) or GAL4-PPARAF-2 (C) fusion proteins along with GAL4 x 5-tkLuc reporter, as described in Materials and Methods. Cells were exposed to 10 µM troglitazone, 10 µM 15PGJ2, 20 µM 9-HODE, 20 µM 13-HODE, or 20 µM 15-HETE during the final 24 h of culture and then assayed for luciferase activity. Activation was normalized to ß-galactosidase activity and represent mean (± SE) of a minimum of three independent experiments, each performed in duplicate. Results are expressed as fold increase in relative luciferase activity over control. The effect of each ligand on the activity of intact PPAR (A) or GAL4-PPARAF-2 (C) was statistically significant (P < 0.01). The effect of PPAR ligands on the activity of GAL4-PPARAF-1 was insignificant (P > 0.05).

Having established that oxidized lipids stimulate PPAR activity in primary term human trophoblasts, we sought to determine their influence on trophoblast differentiation. Primary trophoblasts cultured in the presence of troglitazone exhibited a 4- to 5-fold increase in hCG production, relative to control cultures (Fig. 3), pointing to an enhancement of trophoblast differentiation. Trophoblasts cultured in the presence of 15PGJ₂ exhibited lower hCG production, as expected (11). Importantly, all three oxidized lipids enhanced hCG production from trophoblasts, although the effect of 13-HODE was not significant (Fig. 3). The addition of the PPAR ligands eicosatetraynoic acid (10 µM) or oleic acid (250 µM) did not affect hCG production (not shown). Additionally, the PPAR antagonist BADGE (38) led to a decrease in oxidized lipid-induced hCG production (not shown). These data support the notion that the effect of these ligands is mediated by PPAR.

View larger version (15K): [in this window] [in a new window]   Figure 3. The influence of oxidized lipids on hCG production by trophoblasts. Primary trophoblasts were cultured for 72 h in M199 alone (control) or in M199 containing 10 µM troglitazone, 10 µM 15PGJ2, 20 µM 9-HODE, 20 µM 13-HODE, or 20 µM 15-HETE. Supernatants were then assayed for hCG production as described in Materials and Methods. Data are representative of experiments from five different placentas. Values (mean ± SE) are expressed as fold increase of hCG over control, normalized to total cellular protein. With the exception of 13-HODE, the effect of each ligand, compared with control, was significant (P < 0.05).

View larger version (83K): [in this window] [in a new window]   Figure 4. The effect of PPAR ligands on syncytin expression in trophoblasts, determined by Northern analysis. Primary trophoblasts were cultured for 72 h in M199 alone (control) or M199 containing 10 µM 15PGJ2, 10 µM troglitazone, 20 µM 9-HODE, 20 µM 13-HODE, or 20 µM 15-HETE. All ligands were added 4 h after plating. RNA was isolated as described in Materials and Methods. Data represent three independent experiments. Densitometric analysis and normalization to 18S indicated that only the effect of 15PGJ2 was statistically significant (P < 0.05).

View larger version (49K): [in this window] [in a new window]   Figure 5. The expression of cyclin E and p27 in cultured primary term human trophoblasts. A, Time course. Cells were lysed after 24, 48, or 72 h in culture and total protein isolated for Western analysis. Results represent three independent experiments. B, The effect of oxidized lipids on expression of cyclin E and p27. Trophoblasts were cultured for 72 h in M199 alone (control) or M199 containing 10 µM 15PGJ2, 10 µM troglitazone, 20 µM 9-HODE, 20 µM 13-HODE, or 20 µM 15-HETE. All ligands were added 4 h after plating. Results represent a minimum of three independent experiments. Densitometric analysis and normalization to ß-actin indicated that only the effect of 15PGJ2 on either p27 or cyclin E was statistically significant (P < 0.05).

We have recently demonstrated that PPAR modulates differentiation of third-trimester human trophoblasts in a ligand-dependent manner; whereas the PPAR ligand troglitazone enhances trophoblast differentiation, 15PGJ₂ hinders differentiation and promotes apoptosis (11). The experiments presented here advance these findings. We demonstrated that the oxidized lipids 9-HODE, 13-HODE, and 15-HETE activate PPAR in trophoblasts, and this activation requires AF-2, which harbors the ligand-binding domain of PPAR. Importantly, our results also indicate that the PPAR-activating oxidized lipids enhance hCG production, a measure of functional trophoblast differentiation. In contrast, although the expression of the retroviral protein syncytin is enhanced during trophoblast differentiation in vitro (39), the oxidized lipids 9-HODE, 13-HODE, and 15-HETE exhibit no effect on syncytin expression. We buttressed these findings by assessing the influence of the oxidized lipids on the expression of cyclin E and p27. Cyclins are cell cycle regulators, which bind and activate preexisting cyclin-dependent kinases. These kinases phosphorylate proteins necessary for chromosome condensation, cytoskeletal reorganization, and nuclear envelope breakdown (42). Cyclin E is essential for the G1/S transition (43). In contrast, p27 is a cyclin-dependent kinase inhibitor and therefore a suppressor of tumorigenesis (44). We confirmed that the expression of cyclin E is higher in undifferentiated cytotrophoblasts, whereas p27 expression is higher in the differentiated syncytiotrophoblasts (41). Importantly, none of the oxidized lipids significantly altered cyclin E and p27. Together, these findings suggest that the oxidized lipids do not influence markers of structural differentiation of human trophoblasts.

The process of trophoblast differentiation is critical for placental development and consequently fetal growth. PPAR plays an important part in this process in mice and humans (9, 11, 12). Recent information supports a role for oxidized lipids in endogenous regulation of PPAR activity (4, 5, 45, 46). Intriguingly, the same oxidized lipids have been implicated in the pathogenesis of atherosclerosis (4, 5, 47, 48), acting via PPAR to promote macrophage aggregation (4, 5). In these lesions, oxidized lipids enhance accumulation of lipids, alter endothelial cell function and enhance proliferation of smooth muscle cells (49). Notwithstanding, PPAR activation also leads to LXR activation and cholesterol removal from the cell using the ABCA1 transporter (50, 51), establishing a dual role for PPAR in cellular cholesterol turnover. Acute atherosis has also been described in uterine spiral arteries from pregnancies complicated by preeclampsia (52, 53, 54), implicating oxidized lipids in this process. Moreover, trophoblast dysfunction in preeclampsia has been associated with enhanced lipid peroxidation (26, 28, 29). Our data, however, indicate that oxidized lipids activate PPAR and enhance aspects of trophoblast differentiation. This, in turn, may ameliorate trophoblast injury in these pathological conditions. Whether PPAR ligands, including oxidized lipids, confer a protective role in human trophoblast function remains to be established.

Acknowledgments

We are grateful to Elena Sadovsky, Steve Smith, and Jean-François Mouillet for assistance during these studies and to Lori Rideout for editing. We also thank Dr. Dan Kelly (Washington University School of Medicine) for the PPAR plasmid and Dr. Alan Saltiel (Parke-Davis) for troglitazone.

Footnotes

This work was presented in part at the 48th Annual Meeting of the Society for Gynecologic Investigation, Toronto, Canada, 2001.

This work was supported in part by NIH Grant HD-29190.

Abbreviations: 15PGJ₂, 15-Deoxy-^12,14-prostaglandin J₂; EGF, epidermal growth factor; hCG, human CG; 15-HETE, 15S-hydroxy-5Z,8Z,11Z,13E-eicosatetraenoic acid; 9-HODE, 9S-hydroxy-10E,12Soctadecadienoic acid; 13-HODE, 13S-hydroxy-9Z,11E-octadecadienoic acid; H/W, Ham’s/Waymouth medium; M199, Earl’s medium 199; PPRE, PPAR response element.

Received July 17, 2001.

Accepted November 16, 2001.

References

1. Lemberger T, Desvergne B, Wahli W 1996 Peroxisome proliferator-activated receptors: a nuclear receptor signaling pathway in lipid physiology. Annu Rev Cell Dev Biol 12:335–363[CrossRef][Medline]
2. Chawla A, Schwarz EJ, Dimaculangan DD, Lazar MA 1994 Peroxisome proliferator-activated receptor (PPAR) : adipose-predominant expression and induction early in adipocyte differentiation. Endocrinology 135:798–800[Abstract]
3. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K, Evans RM 1994 Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA 91:7355–7359[Abstract/Free Full Text]
4. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM 1998 PPAR promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93:241–252[CrossRef][Medline]
5. Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM 1998 Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR. Cell 93:229–240[CrossRef][Medline]
6. Chinetti G, Griglio S, Antonucci M, Torra IP, Delerive P, Majd Z, Fruchart JC, Chapman J, Najib J, Staels B 1998 Activation of proliferator-activated receptors and induces apoptosis of human monocyte-derived macrophages. J Biol Chem 273:25573–25580[Abstract/Free Full Text]
7. Lambe KG, Tugwood JD 1996 A human peroxisome-proliferator-activated receptor- is activated by inducers of adipogenesis, including thiazolidinedione drugs. Eur J Biochem 239:1–7[Medline]
8. Kubota N, Terauchi Y, Miki H, Tamemoto H, Yamauchi T, Komeda K, Satoh S, Nakano R, Ishii C, Sugiyama T, Eto K, Tsubamoto Y, Okuno A, Murakami K, Sekihara H, Hasegawa G, Naito M, Toyoshima Y, Tanaka S, Shiota K, Kitamura T, Fujita T, Ezaki O, Aizawa S, Nagai R, Tobe K, Kimura S, Kadowaki T 1999 PPAR mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. Mol Cell 4:597–609[CrossRef][Medline]
9. Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR, Koder A, Evans RM 1999 PPAR is required for placental, cardiac, and adipose tissue development. Mol Cell 4:585–595[CrossRef][Medline]
10. Marvin KW, Eykholt RL, Keelan JA, Sato TA, Mitchell MD 2000 The 15-deoxy-^(12,14)-prostaglandin J₂ receptor, peroxisome proliferator activated receptor- (PPAR) is expressed in human gestational tissues and is functionally active in JEG3 choriocarcinoma cells. Placenta 21:436–440[CrossRef][Medline]
11. Schaiff WT, Carlson MG, Smith SD, Levy R, Nelson DM, Sadovsky Y 2000 Peroxisome proliferator-activated receptor- modulates differentiation of human trophoblast in a ligand-specific manner. J Clin Endocrinol Metab 85:3874–3881[Abstract/Free Full Text]
12. Waite LL, Person EC, Zhou Y, Lim K-H, Scanlan TH, Taylor RN 2000 Placental peroxisome proliferator-activated receptor- is up-regulated by pregnancy serum. J Clin Endocrinol Metab 85:3808–3814[Abstract/Free Full Text]
13. Kliewer SA, Sundseth SS, Jones SA, Brown PJ, Wisely GB, Koble CS, Devchand P, Wahli W, Willson TM, Lenhard JM, Lehmann JM 1997 Fatty acids and eicosanoids regulate gene expression through direct interactions with peroxisome proliferator-activated receptors and . Proc Natl Acad Sci USA 94:4318–4323[Abstract/Free Full Text]
14. Kliewer SA, Lenhard JM, Willson TM, Patel I, Morris DC, Lehmann JM 1995 A prostaglandin J₂ metabolite binds peroxisome proliferator-activated receptor and promotes adipocyte differentiation. Cell 83:813–819[CrossRef][Medline]
15. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM 1995 15-Deoxy-^{12, 14}-prostaglandin J₂ is a ligand for the adipocyte determination factor PPAR. Cell 83:803–812[CrossRef][Medline]
16. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor (PPAR). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
17. Willson TM, Cobb JE, Cowan DJ, Wiethe RW, Correa ID, Prakash SR, Beck KD, Moore LB, Kliewer SA, Lehmann JM 1996 The structure-activity relationship between peroxisome proliferator-activated receptor agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem 39:665–668[CrossRef][Medline]
18. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
19. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR 2, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
20. Hu E, Tontonoz P, Spiegelman BM 1995 Transdifferentiation of myoblasts by the adipogenic transcription factors PPAR and C/EBP. Proc Natl Acad Sci USA 92:9856–9860[Abstract/Free Full Text]
21. Tontonoz P, Singer S, Forman BM, Sarraf P, Fletcher JA, Fletcher CD, Brun RP, Mueller E, Altiok S, Oppenheim H, Evans RM, Spiegelman BM 1997 Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor gamma and the retinoid X receptor. Proc Natl Acad Sci USA 94:237–241[Abstract/Free Full Text]
22. Sarraf P, Mueller E, Smith WM, Wright HM, Kum JB, Aaltonen LA, de la Chapelle A, Spiegelman BM, Eng C 1999 Loss-of-function mutations in PPAR gamma associated with human colon cancer. Mol Cell 3:799–804[CrossRef][Medline]
23. Mueller E, Sarraf P, Tontonoz P, Evans RM, Martin KJ, Zhang M, Fletcher C, Singer S, Spiegelman BM 1998 Terminal differentiation of human breast cancer through PPAR. Mol Cell 1:465–470[CrossRef][Medline]
24. Dussault I, Forman BM 2000 Prostaglandins and fatty acids regulate transcriptional signaling via the peroxisome proliferator activated receptor nuclear receptors. Prostaglandins Other Lipid Mediat 62:1–13[CrossRef][Medline]
25. Huang JT, Welch JS, Ricote M, Binder CJ, Willson TM, Kelly C, Witztum JL, Funk CD, Conrad D, Glass CK 1999 Interleukin-4-dependent production of PPAR- ligands in macrophages by 12/15-lipoxygenase. Nature 400:378–382[CrossRef][Medline]
26. Bonet B, Hauge-Gillenwater H, Zhu XD, Knopp RH 1998 LDL oxidation and human placental trophoblast and macrophage cytotoxicity. Proc Soc Exp Biol Med 217:203–211[Abstract]
27. Hubel CA 1999 Oxidative stress in the pathogenesis of preeclampsia. Proc Soc Exp Biol Med 222:222–235[Abstract/Free Full Text]
28. Hubel CA, Roberts JM, Taylor RN, Musci TJ, Rogers GM, McLaughlin MK 1989 Lipid peroxidation in pregnancy: new perspectives on preeclampsia. Am J Obstet Gynecol 161:1025–1034[Medline]
29. Branch DW, Mitchell MD, Miller E, Palinski W, Witztum JL 1994 Pre-eclampsia and serum antibodies to oxidised low-density lipoprotein. Lancet 343:645–646[CrossRef][Medline]
30. Johnson RD, Polakoski KL, Huang X, Sadovsky Y, Nelson DM 1998 The release of 15-hydroxyeicosatetraenoic acid by human placental trophoblast is increased in preeclampsia. Am J Obstet Gynecol 178:54–58[CrossRef][Medline]
31. Mitchell MD, Koenig JM 1991 Increased production of 15-hydroxyeicosatetraenoic acid by placentae from pregnancies complicated by pregnancyinduced hypertension. Prostaglandins Leukot Essent Fatty Acids 43:61–62[CrossRef][Medline]
32. Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss JM 1986 Purification, characterization and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 118:1567–1582[Abstract]
33. Nelson DM, Johnson RD, Smith SD, Anteby EY, Sadovsky Y 1999 Hypoxia limits differentiation and up-regulates expression and activity of prostaglandin H synthase 2 in cultured trophoblast from term human placenta. Am J Obstet Gynecol 180:896–902[CrossRef][Medline]
34. Fajas L, Auboeuf D, Raspe E, Schoonjans K, Lefebvre AM, Saladin R, Najib J, Laville M, Fruchart JC, Deeb S, Vidal-Puig A, Flier J, Briggs MR, Staels B, Vidal H, Auwerx J 1997 The organization, promoter analysis, and expression of the human PPAR gene. J Biol Chem 272:18779–18789[Abstract/Free Full Text]
35. Sadowski I, Ptashne M 1989 A vector for expressing GAL4(1–147) fusions in mammalian cells. Nucleic Acids Res 17:7539[Free Full Text]
36. Ou Q, Mouillet JF, Yan X, Dorn C, Crawford PA, Sadovsky Y 2001 The DEAD box protein DP103 is a regulator of steroidogenic factor-1. Mol Endocrinol 15:69–79[Abstract/Free Full Text]
37. Chen C, Okayama H 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol 7:2745–2752[Abstract/Free Full Text]
38. Wright HM, Clish CB, Mikami T, Hauser S, Yanagi K, Hiramatsu R, Serhan CN, Spiegelman BM 2000 A synthetic antagonist for the peroxisome proliferator-activated receptor inhibits adipocyte differentiation. J Biol Chem 275:1873–1877[Abstract/Free Full Text]
39. Mi S, Lee X, Li X, Veldman GM, Finnerty H, Racie L, LaVallie E, Tang XY, Edouard P, Howes S, Keith Jr JC, McCoy JM 2000 Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 403:785–789[CrossRef][Medline]
40. Blond JL, Lavillette D, Cheynet V, Bouton O, Oriol G, Chapel-Fernandes S, Mandrand B, Mallet F, Cosset FL 2000 An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. J Virol 74:3321–3329[Abstract/Free Full Text]
41. Bamberger A, Sudahl S, Bamberger CM, Schulte HM, Loning T 1999 Expression patterns of the cell-cycle inhibitor p27 and the cell-cycle promoter cyclin E in the human placenta throughout gestation: implications for the control of proliferation. Placenta 20:401–406[CrossRef][Medline]
42. Nurse P 1990 Universal control mechanism regulating onset of M-phase. Nature 344:503–508[CrossRef][Medline]
43. DeLoia JA, Burlingame JM, Krasnow JS 1997 Differential expression of G1 cyclins during human placentogenesis. Placenta 18:9–16[CrossRef][Medline]
44. Bartek J, Lukas J 2001 p27 destruction: Cks1 pulls the trigger. Nat Cell Biol 3:E95–98
45. Han KH, Chang MK, Boullier A, Green SR, Li A, Glass CK, Quehenberger O 2000 Oxidized LDL reduces monocyte CCR2 expression through pathways involving peroxisome proliferator-activated receptor . J Clin Invest 106:793–802[Medline]
46. Marx N, Bourcier T, Sukhova GK, Libby P, Plutzky J 1999 PPAR activation in human endothelial cells increases plasminogen activator inhibitor type-1 expression: PPAR as a potential mediator in vascular disease. Arterioscler Thromb Vasc Biol 19:546–551[Abstract/Free Full Text]
47. Claudel T, Leibowitz MD, Fievet C, Tailleux A, Wagner B, Repa JJ, Torpier G, Lobaccaro JM, Paterniti JR, Mangelsdorf DJ, Heyman RA, Auwerx J 2001 Reduction of atherosclerosis in apolipoprotein E knockout mice by activation of the retinoid X receptor. Proc Natl Acad Sci USA 98:2610–2615[Abstract/Free Full Text]
48. Marx N, Sukhova G, Murphy C, Libby P, Plutzky J 1998 Macrophages in human atheroma contain PPAR: differentiation-dependent peroxisomal proliferator-activated receptor gamma (PPAR) expression and reduction of MMP-9 activity through PPARgamma activation in mononuclear phagocytes in vitro. Am J Pathol 153:17–23[Abstract/Free Full Text]
49. Meilhac O, Zhou M, Santanam N, Parthasarathy S 2000 Lipid peroxides induce expression of catalase in cultured vascular cells. J Lipid Res 41:1205–1213[Abstract/Free Full Text]
50. Chinetti G, Lestavel S, Bocher V, Remaley AT, Neve B, Torra IP, Teissier E, Minnich A, Jaye M, Duverger N, Brewer HB, Fruchart JC, Clavey V, Staels B 2001 PPAR- and PPAR- activators induce cholesterol removal from human macrophage foam cells through stimulation of the ABCA1 pathway. Nat Med 7:53–58[CrossRef][Medline]
51. Chawla A, Boisvert WA, Lee CH, Laffitte BA, Barak Y, Joseph SB, Liao D, Nagy L, Edwards PA, Curtiss LK, Evans RM, Tontonoz P 2001 A PPAR-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol Cell 7:161–171[CrossRef][Medline]
52. Lorentzen B, Henriksen T 1998 Plasma lipids and vascular dysfunction in preeclampsia. Semin Reprod Endocrinol 16:33–39[Medline]
53. Meekins JW, Pijnenborg R, Hanssens M, McFadyen IR, van Asshe A 1994 A study of placental bed spiral arteries and trophoblast invasion in normal and severe pre-eclamptic pregnancies. Br J Obstet Gynaecol 101:669–674[Medline]
54. Sheppard BL, Bonnar J 1981 An ultrastructural study of utero-placental spiral arteries in hypertensive and normotensive pregnancy and fetal growth retardation. Br J Obstet Gynaecol 88:695–705[Medline]

This article has been cited by other articles:

				L. L. Waite, R. E. Louie, and R. N. Taylor Circulating Activators of Peroxisome Proliferator-Activated Receptors Are Reduced in Preeclamptic Pregnancy J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 620 - 626. [Abstract] [Full Text] [PDF]

				L. Pavan, A. Hermouet, V. Tsatsaris, P. Therond, T. Sawamura, D. Evain-Brion, and T. Fournier Lipids from Oxidized Low-Density Lipoprotein Modulate Human Trophoblast Invasion: Involvement of Nuclear Liver X Receptors Endocrinology, October 1, 2004; 145(10): 4583 - 4591. [Abstract] [Full Text] [PDF]

				O. A. Skorokhod, M. Alessio, B. Mordmuller, P. Arese, and E. Schwarzer Hemozoin (Malarial Pigment) Inhibits Differentiation and Maturation of Human Monocyte-Derived Dendritic Cells: A Peroxisome Proliferator-Activated Receptor-{gamma}-Mediated Effect J. Immunol., September 15, 2004; 173(6): 4066 - 4074. [Abstract] [Full Text] [PDF]

				I. Knerr, B. Huppertz, C. Weigel, J. Dotsch, C. Wich, R.L. Schild, M.W. Beckmann, and W. Rascher Endogenous retroviral syncytin: compilation of experimental research on syncytin and its possible role in normal and disturbed human placentogenesis Mol. Hum. Reprod., August 1, 2004; 10(8): 581 - 588. [Abstract] [Full Text] [PDF]

				S. C Larsson, M. Kumlin, M. Ingelman-Sundberg, and A. Wolk Dietary long-chain n-3 fatty acids for the prevention of cancer: a review of potential mechanisms Am. J. Clinical Nutrition, June 1, 2004; 79(6): 935 - 945. [Abstract] [Full Text] [PDF]

				Q. Li, Y.-P. Cheon, A. Kannan, S. Shanker, I. C. Bagchi, and M. K. Bagchi A Novel Pathway Involving Progesterone Receptor, 12/15-Lipoxygenase-derived Eicosanoids, and Peroxisome Proliferator-activated Receptor {gamma} Regulates Implantation in Mice J. Biol. Chem., March 19, 2004; 279(12): 11570 - 11581. [Abstract] [Full Text] [PDF]

				I. Bildirici, C.-R. Roh, W. T. Schaiff, B. M. Lewkowski, D. M. Nelson, and Y. Sadovsky The Lipid Droplet-Associated Protein Adipophilin Is Expressed in Human Trophoblasts and Is Regulated by Peroxisomal Proliferator-Activated Receptor-{gamma}/Retinoid X Receptor J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6056 - 6062. [Abstract] [Full Text] [PDF]

				A. W. Bull, K. R. Steffensen, J. Leers, and J. J. Rafter Activation of PPAR {gamma} in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR {gamma} Carcinogenesis, November 1, 2003; 24(11): 1717 - 1722. [Abstract] [Full Text] [PDF]

				L. Pavan, A. Tarrade, A. Hermouet, C. Delouis, M. Titeux, M. Vidaud, P. Therond, D. Evain-Brion, and T. Fournier Human invasive trophoblasts transformed with simian virus 40 provide a new tool to study the role of PPAR{gamma} in cell invasion process Carcinogenesis, August 1, 2003; 24(8): 1325 - 1336. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Purchase Article View Shopping Cart Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Schild, R. L. Articles by Sadovsky, Y. Search for Related Content PubMed PubMed Citation Articles by Schild, R. L. Articles by Sadovsky, Y.