| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Istituto di Ricerca sulle Talassemie e Anemie Mediterranee (A.M., V.F., A.C.), Consiglio Nazionale Ricerche, 09121 Cagliari; Unità Operativa di Pediatria (R.P., E.C.), Azienda Ospedaliera Vito Fazzi, 73100 Lecce; and Dipartimento di Scienze Biomediche e Biotecnologie (A.C., M.C.R.) and Dipartimento di Scienze Applicate ai Biosistemi (M.C.R.), Università degli Studi, 09121 Cagliari, Italy
Address all correspondence and requests for reprints to: Maria Cristina Rosatelli, Dipartimento di Scienze Biomediche e Biotecnologie, Via Jenner s/n, 09121 Cagliari, Italy. E-mail: crosatel{at}mcweb.unica.it
Abstract
In this study, we have carried out molecular analysis of the AIRE (autoimmune regulator) gene in 11 patients (from 8 families) affected by autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy, originating from a restricted area of Southern Italy (the Salento peninsula in Puglia). Of the 16 mutant AIRE alleles from the 8 probands studied, 12 carried a missense mutation (W78R in 9, P539L in 2, and P252L in 1), 2 carried the Q358X nonsense mutation, and 2 carried the 1058delT frameshift mutation. All these mutations except the 1058delT are novel. Each of the detected mutations either predicts a premature termination of the protein or results in a nonconservative amino acid change, most likely adversely affecting the function of the protein. The W78R missense mutation is relatively common in these patients, having been detected (in homozygosity or compound heterozygosity) in 6 of the 8 probands tested, indicating the presence of a founder effect. The results of this study contribute to the delineation of the molecular pathology of the AIRE gene and enhance our ability to perform a molecular diagnosis in autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy patients from Southern Italy.
AUTOIMMUNE polyendocrinopathy-candidiasis-ectodermal dystrophy (APECED; OMIM 240300), already known as autoimmune polyglandular syndrome type 1 (APS 1), is a rare autosomal recessive disorder characterized by autoimmune-mediated failure of multiple endocrine glands, chronic or recurrent mucocutaneous candidiasis, and dystrophy of several ectodermal tissues. The most common manifestations, in addition to mucocutaneous candidiasis, are hypoparathyroidism and adrenocortical failure. Candidiasis is usually the first clinical symptom, followed by the development of hypoparathyroidism and/or adrenocortical failure. Diagnosis is based on the presence of at least two of these clinical manifestations. However, presence of only one component is sufficient basis if a sibling is affected (1).
The clinical spectrum of APECED includes gonadal failure, insulin-dependent diabetes mellitus (IDDM), gastric parietal-cell atrophy, hypothyroidism, autoimmune hepatitis (AIH), intestinal malabsorption, keratitis, alopecia, vitiligo, dental enamel hypoplasia, tympanic-membrane calcifications, and nail dystrophy (1, 2). The autoimmune manifestations most likely result from destruction of the target organ by cell- and antibody-mediated attack (1, 2).
APECED is relatively common among Finns (1:25,000) (3), Iranian Jews (1:9,000) (4), and Sardinians (1:14,400) (5). In these populations, APECED is most likely inherited from one or a few founder individuals.
The defective gene in APECED, mapped by linkage analysis to chromosome 21 (21q22.3) (3, 6), has recently been identified by positional cloning and is referred to as AIRE (autoimmune regulator) (7, 8).
The AIRE gene consists of 14 exons spanning approximately 13 kb of genomic DNA. The relative protein product (made up of 545 amino acids) starting from the amino- terminal region, shows an HSR (homogeneously staining region) domain supposed to be a dimerization domain (9, 10), a nuclear localization signal, a putative DNA-binding motif referred to as the SAND (Sp100, AIRE-1, NucP41/75, DEAF-1/suppressin) domain (11), 2 PHD (plant homeo domain) zinc-finger motifs, a proline-rich region, and 4 LXXLL leucine-rich, nuclear receptor-binding motifs, suggesting a role as a transcriptional regulator (7, 8, 12).
AIRE is expressed mostly in the medullary epithelial cells of the thymus (13). The AIRE protein is localized in distinct nuclear structures and colocalizes with cytoskeletal filaments (13, 14, 15).
Mutation analysis of APECED patients of European ancestry, so far, has led to the detection of 34 different mutations, of which 2 (R257X and 10941106del) are relatively common, whereas the others are very rare (5, 7, 8, 16, 17, 18, 19, 20, 21, 22, 23, 24). R257X was originally detected in the Finnish APECED chromosomes, where it accounts for 83% of the mutations, and has been found also in patients from other European regions.
In this study, we have carried out mutation analysis of the AIRE gene in 11 patients affected by APECED, from 8 families, originating from a restricted area of Southern Italy (the Salento peninsula).
Subjects and Methods
Subjects
Eleven patients, affected by APECED, from 8 families living in the Salento area of Southern Italy were investigated. Informed consent was obtained from all subjects.
According to the birthplace of their grandparents (with the exception of paternal grandparents of patient 9, who come from the Naples area), patients 1, 2, and 59 originate from a circular area about 35 km in diameter, with 250,000 inhabitants, situated around the main town of the province, Lecce. No consanguinity was documented in the families of these patients.
Patients 3, 4, 10, and 11 originate from another area of the province. The parents of patient 10 were first cousins. The paternal and maternal great-grandmothers of patient 11 were also first cousins.
Three of the 11 families have 2 affected children, and all the other families have only 1 affected child (Fig. 1
).
|
|
With regard to the classic APECED triad, all patients had chronic mucocutaneous candidiasis and hypoparathyroidism, and nine of them also had adrenocortical failure. Relevant endocrinological evaluations are detailed in Table 2
.
|
-hydroxylase (CYP21), and 17
-hydroxylase (CYP17)] were found, respectively, in nine patients (1/A, 34/B, 6/D, 78/E, 9/F, 10/G, and 11/H), eight patients (1/A, 34/B, 5/C, 6/D, 78/E, and 11/H), and five patients (1/A, 4/B, 5/C, 6/D, and 8/E). Hypothyroid patients had Ab to thyroperoxidase, and two of them (2/A and 7/E) also tested positive for Ab to Tg. Although no patients had subclinical or overt IDDM, four of them (patients 1/A, 3/B, 9/F, and 10/G) showed laboratory signs of pancreatic-ß-cell autoimmunity. Finally, two (6/D and 9/F) of three patients with AIH were tested and resulted positive for liver-kidney microsomal Ab and CYP2A6-Ab (26).
Mutation detection
The 14 exons of the AIRE gene (GENBANK accession no. AB006684) were amplified, by PCR, from genomic DNA; purified, and sequenced using primers and conditions previously described (18). Dye terminator sequencing was carried out, according to the standard protocol, on the ABI 377 semiautomated sequencer (PE Applied Biosystems, Foster City, CA).
The W78R mutation creates a new HpaII (or its isoschizomer MspI) restriction site (CCGG). HpaII digestion of an amplified DNA fragment of 340 bp (sense primer 5' CACCCTCTAGTCATGATGGAGATG 3' and antisense primer 5' CCACTCCGGTTCCAGTCCAGCTGG 3') produces, in the presence of the mutation, two fragments of 180 and 160 bp, in place of the wild-type 340-bp normal fragment.
P539L abolishes a recognition site for the same enzyme. In normal subjects, the enzymatic digestion of a PCR product of 273 bp (sense primer 5' TGACTTCTTGTAACGATGGCCATG 3' and antisense primer 5' CACTGACAAGAGGTGGCGCTGTCC 3') produces two fragments of 142 and 131 bp. Because the mutation abolishes the site for the enzyme, when the mutation is present, only the 273-bp undigested PCR product is shown. PCR was performed with AmpliTaq DNA polymerase (PE Applied Biosystems). PCR conditions for both fragments were: 30 sec at 94 C, 30 sec at 60 C, and 1 min at 72 C for 30 cycles.
Screening for the presence of W78R, P252L, and P539L in the control group was carried out with primer-specific amplification (ARMS, amplification refractory mutation system) (27).
With this methodology, the target DNA fragments are amplified in two different reactions by using a common primer in combination with either of two primers (one complementary to the mutation to be detected and the other complementary to wild-type DNA). As an internal PCR control, a flanking DNA fragment is coamplified in the same tube. Only when the correspondent mutation is present can primer pairs W78Rmutant-R2, P252Lmutant-R6, and P539Lmutant-R14 amplify PCR products of 165 bp, 421 bp, and 172 bp, respectively. Conversely, only in the presence of the normal sequence can primer pairs W78Rwild-type-R2, P252Lwild-type-R6, and P539Lwild-type-R14 amplify the same fragments. Primer pairs F2-R2, F5-R6, and F14-R14 amplify three fragments of 340 bp, 563 bp, and 273 bp respectively, flanking the regions under study. The primers used are listed in Table 3
.
|
Figure 2
shows an example of ARMS used in the detection of the W78R mutation.
|
In each proband, direct sequencing of both strands of all 14 exons and the relative 26 splice junctions of the AIRE gene was carried out, leading to the characterization of the molecular pathology in each case. Five different mutations were detected, of which 4 were novel. Of the novel mutations, 3 are missense (W78R, P252L, and P539L) and 1 a nonsense (Q358X). The frameshift mutation at codon 311 (1058delT) was previously detected in a French patient (22).
The presence of the W78R and P539L mutations was confirmed by HpaII enzymatic digestion.
Family trees of the patients are shown in Fig. 1
.
Figure 3
depicts the gene localization of the mutations detected in this study, as well as those previously described.
|
T (CAG
TAG) (Q358X) lying in the proline-rich region of exon 9 is predicted to produce a truncated AIRE protein lacking the second PHD finger and thereby most likely nonfunctional. This mutation was observed in a compound heterozygous state, with the W78R mutation in two probands belonging to unrelated families. The frameshift at codon 311 in exon 8 (1058delT) led to the production of a downstream stop codon at codon 385 and thus presumably to a shortened and nonfunctional protein lacking both the PHD fingers. This mutation was detected in homozygosity in a single family.
The missense mutation T
C (TGG
CGG) at codon 78 in exon 2 led to the substitution of a tryptophan residue with arginine (W78R). This is a nonconservative amino acid substitution, replacing a nonpolar amino acid with a polar basic residue. Furthermore, the mutation lies in the N-terminal HSR domain where most of the missense mutations have been detected.
The W78R mutation is the most common molecular defect found in our group of patients, having been detected in 9 of 16 chromosomes carrying an AIRE mutant allele. The mutation was found in homozygosity in 3 probands belonging to different unrelated families and in compound heterozygosity with P252L or Q358X in 1 and 2 probands, respectively.
The missense mutation C
T (CCG
CTG) at codon 252 in exon 6 led to the substitution of a proline residue with leucine (P252L). Proline and leucine are both nonpolar amino acids. However, proline-leucine substitution can be considered a nonconservative change, probably resulting in the destruction of the basal coil secondary structure of the gene related to its proline-rich composition. Furthermore, the mutation lies in the amino-terminal SAND domain, which is likely to be a DNA-binding motif. This mutation was found in the compound heterozygous state with the W78R mutation, in a single patient.
The missense mutation C
T at codon 539 in exon 14 led to a proline to leucine change (P539L). The P539L mutation, for the reasons discussed above, can also be considered a nonconservative substitution.
Screening for the presence of W78R, P252L, and P539L was carried out with primer-specific amplification in 100 randomly chosen subjects also from the Salento area, to prove the pathogenicity of these novel mutations. None of the tested subjects resulted positive for the P252L and P539L mutations, whereas 1 person was heterozygous for W78R.
Discussion
In this study, we have delineated the molecular pathology in each of 8 probands affected by APECED, originating from the Salento region. Our findings reconfirm that APECED results from a defect in a single gene coding for the AIRE protein. In the 16 mutant AIRE alleles analyzed, we found 4 novel mutations (W78R, P252L, P539L, and Q358X) and a previously described one (1058delT). Of the novel mutations, 3 were missense and 1 nonsense. This result indicates that, like many other gene systems, APECED is heterogeneous in molecular terms. Each of the detected mutations either predicts a premature truncation of the AIRE protein or results in a nonconservative amino acid change. Furthermore, apart from the W78R mutation, none of the remaining missense mutations were detected in 100 normal chromosomes from people of the same ancestry, further confirming their pathogenic role.
The W78R mutation is relatively common in our subjects, being present either in homozygosity or compound heterozygosity in 6 probands of the 8 examined. Screening of normal individuals from the same area turned up one person who was heterozygous for the W78R mutation of the 100 tested, indicating a carrier rate of 1%. This finding is likely to be related to a founder effect, as has already been found for the AIRE gene in other populations, such as Sardinians (R139X) (5), Finns (R257X) (7, 8), and (at least partially) British people (10941106del) (7, 17, 18). When all the AIRE genotypes in our sample are considered together, the minimum estimate of the prevalence of APECED in the Salento area, from which most of our patients originate, seems to be relatively high (in the order of 1:35,000).
Genotype-phenotype correlation analysis may be attempted only where a large number of cases with the same genotype are available. We have therefore limited our analysis to those subjects who are homozygotes or compound heterozygotes for the common W78R mutation. However, as in previous studies (1, 3, 5, 21, 24), no clear relationship between genotype and phenotype emerged.
It has been suggested that the occurrence of certain manifestations of APECED could be related to the modifying effect of a coinherited specific HLA DR-DQ haplotype. However, two of the patients with hypothyroidism (6D and 9F) carried out, respectively, the DR10-DQ1/DR11-DQ7 and the DR2-DQ1/DR7-DQ2 genotypes, which are not associated with autoimmune hypothyroidism (28). Hence, we can exclude, at least in these individuals, a role for the HLA system in modifying the phenotype resulting from the defective AIRE gene.
Further studies on a large number of patients are necessary to verify the existence of any correlation between genotype and phenotype.
In conclusion, the results presented in this study contribute to the characterization of the molecular pathology of the AIRE gene and may allow preclinical diagnosis in families at risk.
Note Added in Proof
Since this manuscript was submitted, Cihakova et al. (29) have described independently the W78R mutation in one patient of Czech origin.
Acknowledgments
We are grateful to the staff at the Centro Disendocrini, Azienda Ospedaliera Vito Fazzi, Lecce. The authors thank Mr. George Metcalf, M.A., for his help in translating the manuscript.
Footnotes
This work was supported by Assessorato Igiene e Sanità Regione Sardegna L. R. no. 11 30.04.1990; L. R. no. 8 Programma di Educazione Sanitaria: Studio delle Malattie Genetiche in Sardegna. DGR no. 745 del 24.05.2001; finanziamento Università degli Studi di Cagliari per la ricerca scientifica: quota 60% (to M.C.R.).
Abbreviations: Ab, Antibodies; AIH, autoimmune hepatitis; AIRE, autoimmune regulator; APECED, autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy; APS, autoimmune polyglandular syndrome; ARMS, amplification refractory mutation system; CYP, cytochrome P450; HSR, homogeneously staining region; IDDM, insulin-dependent diabetes mellitus; PHD, plant homeo domain; SAND, Sp100, AIRE-1, NucP41/75, DEAF-1/suppressin.
Received March 28, 2001.
Accepted October 18, 2001.
References
This article has been cited by other articles:
![]() |
A. Meloni, M. Furcas, F. Cetani, C. Marcocci, A. Falorni, R. Perniola, M. Pura, A. S. Boe Wolff, E. S. Husebye, D. Lilic, et al. Autoantibodies against Type I Interferons as an Additional Diagnostic Criterion for Autoimmune Polyendocrine Syndrome Type I J. Clin. Endocrinol. Metab., November 1, 2008; 93(11): 4389 - 4397. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Perry, O. Kecha, J. Paquette, C. Huot, G. Van Vliet, and C. Deal Primary Adrenal Insufficiency in Children: Twenty Years Experience at the Sainte-Justine Hospital, Montreal J. Clin. Endocrinol. Metab., June 1, 2005; 90(6): 3243 - 3250. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dittmar and G. J. Kahaly Polyglandular Autoimmune Syndromes: Immunogenetics and Long-Term Follow-Up J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2983 - 2992. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |