| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Article |
Perinatal Center, Department of Physiology and Pharmacology (M.J., T.J., T.L.P.), Göteborg University, S-405 30 Göteborg, Sweden; and Academic Unit (J.D.G., C.P.S.), Child Health and School of Biological Sciences, University of Manchester, Manchester M13 0JH, United Kingdom
Address all correspondence and requests for reprints to: Theresa Powell, Ph.D., Perinatal Center, Department of Physiology and Pharmacology, Göteborg University, Box 432, S-405 30 Göteborg, Sweden. E-mail: theresa.powell{at}fysiologi.gu.se.
Abstract
Regulation of syncytiotrophoblast intracellular pH is critical to optimum enzymatic and transport functions of the placenta. Previous studies of Na+/H+ exchanger (NHE) activity in the placenta from pregnancies complicated by intrauterine growth restriction (IUGR) have produced conflicting results. The possible role of altered placental pH regulation in the development of acidosis in some fetuses subjected to IUGR remains to be fully established. We investigated the activity and protein expression of the NHE in syncytiotrophoblast microvillous (MVM) plasma membranes isolated from preterm and term placentas obtained from uncomplicated and IUGR pregnancies. Western blotting showed that the expression of NHE isoforms 1, 2, and 3 was approximately 10-fold greater in MVM than in basal plasma membrane (BM). Immunohistochemistry localized NHE-1 and NHE-2 to MVM and BM and NHE-3 to the MVM, BM, and cytoplasm of the syncytiotrophoblast. NHE-1 expression in MVM from preterm IUGR placentas was reduced by 55%, compared with gestational age-matched controls (P < 0.05, n = 6 and n = 16, respectively), whereas NHE-1 expression was unaltered in term IUGR placentas (n = 8). The activity (amiloride-sensitive Na+ uptake) of NHE in MVM from IUGR preterm placentas was reduced by 48% (P < 0.05, n = 6). In contrast, MVM NHE activity was unchanged in term IUGR (n = 7). Using Northern blotting, no difference could be demonstrated in NHE-1 mRNA expression between IUGR and control groups. The reduced activity and expression of NHE in MVM of preterm IUGR placentas may compromise placental function and may contribute to the development of fetal acidosis in preterm IUGR fetuses.
INTRAUTERINE GROWTH RESTRICTION (IUGR) is associated with a heterogenous group of conditions ranging from fetal chromosomal aberrations to maternal malnutrition. IUGR is the second most important cause of perinatal morbidity and mortality (1). Adverse effects, however, are not limited to the perinatal period because IUGR is associated with sequelae such as permanent neurological damage (2). Furthermore, during recent years, a pathophysiological concept has emerged linking IUGR to increased susceptibility to diseases in adult age such as hypertension, type 2 diabetes, and atherosclerosis (3).
The causes of IUGR are multifactorial and largely unknown; however, altered placental transport has been implicated (4). The placental transporting epithelium, the syncytiotrophoblast, is polarized with an apical microvillous (MVM) and basal plasma membrane (BM). These two plasma membranes constitute the major barrier between mother and fetus, and most nutrients and metabolites are actively or passively transferred across them to and/or from the fetus. Evidence for disturbed placental transport across these membranes linked to IUGR is accumulating. For example, IUGR is associated with reduced activity of the system A amino acid transporter (5) and taurine transporter in MVM (6).
The placenta is also primarily responsible for elimination of fetal acid equivalents of respiratory and metabolic origin. Intrauterine sampling of fetal cord blood has shown that growth-restricted fetuses are more prone to develop acidosis in utero than normally grown fetuses (7). This most probably contributes to the adverse outcome associated with IUGR. Several major acid/base-regulating proteins have been demonstrated in the placental syncytiotrophoblast. Two key transporting proteins, the Na+/H+ exchanger (NHE) (8) and the Cl-/HCO3- exchanger (9) are localized to the microvillous plasma membrane.
The main functions of the NHE are maintenance of intracellular pH, vectorial Na+ transport, and cell volume regulation. This family of proteins consists of at least six isoforms, NHE 16, and catalyzes the extrusion of one H+ per Na+ ion entering the cell down its electrochemical gradient. Although NHE-1 is ubiquitously distributed (10), NHE 26 have a more restricted pattern of expression (11, 12). NHE-1 serves housekeeping functions in most cell types, whereas NHE-2 and -3 are epithelial isoforms, implicated in vectorial Na+ transport. By using Western blotting (13, 14), immunohistochemistry (14), and molecular biology techniques (12, 15), NHE isoforms have been shown to be present in the syncytiotrophoblast plasma membranes of the human placenta. Studies on freshly obtained placental villous fragments loaded with a pH-sensitive dye demonstrated that inhibition of NHE severely impaired recovery from an intracellular acid load both in first trimester and at term (16). Furthermore, amiloride-dependent Na+ uptake in the presence of a pH gradient has also been demonstrated in isolated MVM vesicles (8, 17). These data suggest a role for NHE in regulating intracellular pH, which is critical for proper functioning of the enzymatic and transport functions in the placenta. These observations also raise the possibility that syncytiotrophoblast NHEs are involved in removal of acid equivalents from the fetal compartment.
The activity of NHE in MVM from IUGR and control placentas has been investigated previously, in term as well as preterm preparations, and found to be either unaltered (5, 13) or reduced (18). In a study by Hughes et al. (13), it was suggested that the discrepancy in these studies might be attributed to the differing definitions for IUGR in each study. The authors speculated that a reduction in NHE activity in the MVM might be related to the severity of growth restriction. The present study was designed to test this hypothesis. We purified MVM and BM from placentas of uncomplicated appropriately grown for gestational age (AGA) and IUGR preterm and term pregnancies. We compared the expression of NHE in MVM with that in BM isolated from the same placenta. Protein expression of NHE 13 was analyzed by Western blotting and immunohistochemistry. The activity of NHE was measured using rapid filtration techniques, and steady-state mRNA levels of NHE-1 were determined by Northern blotting.
Materials and Methods
Tissue collection
Human placentas were obtained immediately after cesarean section or vaginal delivery. The collection of placental tissue was approved by the Committee for Research Ethics at Göteborg University. Gestational age was determined by ultrasound evaluation at 1618 wk gestation. Potential IUGR cases were identified after ultrasound assessment of fetal size. Following delivery, IUGR was defined as a birth weight 2 SD below the mean birth weight for that gestational age using intrauterine growth curves based on ultrasonographically estimated fetal weight (19). A prerequisite for inclusion of IUGR samples was no other concurrent disease of the mother, e.g. diabetes or preeclampsia, or known abuse of drugs. Furthermore, most IUGR fetuses showed signs of fetal compromise such as abnormal Doppler blood flow patterns in the umbilical artery, acute delivery because of fetal distress, decreased CTG variability, tachycardia, and oligohydramnios. Control placentas were matched for gestational age, with no complications other than prematurity.
Preparation of membrane vesicles
MVM and BM vesicles were prepared as described previously (20). All preparative steps were conducted on ice and the centrifugation steps at 4 C. Briefly, placentas were immediately placed on ice after delivery and vesicle preparation was started within 30 min. Placentas were dissected and the chorionic plate, amniotic sac, and decidua were removed. Approximately 100 g villous tissue was cut into small pieces and rinsed with ice-cold physiological saline. Tissue was placed in buffer D [250 mM sucrose, 0.7 µM pepstatin A, 1.1 µM leupeptin, 0.8 µM antipain, 80 nM aprotinin, 10 mM HEPES-Tris (pH 7.4), at 4 C] and homogenized using a polytron (Kinematika AG, Lucerne, Switzerland). The homogenate was centrifuged twice at 10,000 x g for 15 min and the resulting supernatant was centrifuged at 125,000 x g for 30 min. The pelleted crude membrane fraction (postnuclear membrane fraction-P2), was resuspended in buffer D and 12 mM MgCl2 was added. The resulting suspension was subjected to slow stirring on ice. Subsequently, the suspension was centrifuged for 10 min at 2,500 x g. The supernatant, which contained the MVM, was centrifuged for 30 min at 125,000 x g and the pellet, containing the BM, was further purified by means of a sucrose step gradient centrifugation. Finally, BM and MVM were centrifuged at 125,000 x g for 30 min and resuspended in an appropriate volume of buffer D to give a final protein concentration of 510 mg/ml. Vesicles were aliquoted, snap frozen in liquid nitrogen, and stored at -80 C until use. Experiments were also conducted on vesicles stored at +4 C overnight after preparation.
Assessment of vesicle purity
Alkaline phosphatase, used here as an MVM marker, is highly abundant in the syncytiotrophoblast microvillous membrane, whereas the activity of this enzyme is low or absent in other cell membranes in the human placenta (21). Alkaline phosphatase activity was measured according to standard methods (22), and enzyme enrichments were calculated as the activity in the MVM and BM fractions relative to homogenate activity. Adenylate cyclase is almost exclusively polarized to the basal membrane surface of the syncytiotrophoblast cell (23). Therefore, adenylate cyclase activity was used in this study as a BM marker, by measuring forskolin-stimulated cAMP production (24). The cAMP was measured using RIA (NEN Life Science Products, Boston, MA). Tissue homogenates contain various factors of cytosolic origin that activate adenylate cyclase (20). Therefore, the adenylate cyclase activity of the postnuclear membrane fraction was used as the denominator in BM enrichment calculations.
Isoform-specific antibodies
The polyclonal sera against NHE isoforms 13 used in this study were kind gifts from Prof. M. Donovitz, Johns Hopkins University School of Medicine, Baltimore, Maryland (NHE-2 and 3), and Prof. Jacques Pouysségur, Institute of Signaling, Developmental Biology and Cancer Research CNRS, Nice, France (NHE-1). The monoclonal antibody against NHE-1 used for immunohistochemistry was purchased from Becton Dickinson-Transduction Laboratories (Stockholm, Sweden). Antibodies were carefully screened for specificity when developed (10, 25), and we also tested the antibodies using rat kidney homogenates as a positive control and elimination of primary for control of nonspecific binding of the secondary antibody.
Western blotting for NHE 13
Membrane proteins from MVM and BM were separated by SDS-PAGE as follows. Vesicle suspension was thawed on ice and diluted with buffer D to a protein concentration of 1.5 mg/ml. One volume of 3x sample buffer [8 M urea, 170 mM SDS, 0.5 mM bromphenol blue, 455 mM dithiotreitol, 50 mM Tris (pH 6.8), adjusted with HCl] was then added to two volumes of this diluted vesicle suspension and mixed thoroughly. Using the mini-Protean II electrophoresis system (Bio-Rad Laboratories, Inc., Hemel Hempstead, Herts, UK), 10 µg vesicle protein were loaded on a 7.5% polyacrylamide SDS gel, which was mounted into a holding cassette surrounded and filled by electrophoresis buffer (25 mM Tris-base, 192 mM glycine, and 3.5 mM SDS). Appropriate molecular weight markers were also loaded. Electrophoresis was performed for 40 min at 200 V. Gels were thereafter equilibrated with transfer buffer [25 mM Tris-base, 192 mM glycine, and 20% (vol/vol) methanol in deionized water] by gentle agitation for 30 min. The gel was covered with a nitrocellulose membrane (Hybond-ECL, Amersham International plc, Buckinghamshire, UK) and was placed in a minitransblot electrophoresis transfer cell (Bio-Rad Laboratories, Inc.), covered with buffer, and transferred overnight at 30 V. The membrane was then blocked for 1 h in 5% Blotto buffer (0.1 M PBS, 0.1% Tween 20 vol/vol, and 5% nonfat dry milk w/vol). After washing the membrane in PBS/Tween (0.1 M PBS and 0.1% Tween 20) the primary antibody (diluted in PBS/Tween with 1.2 mM Thimerosal) was added at a dilution of 1:1000 and incubated for 1 h at room temperature. After washing in PBS/Tween, the secondary antibody diluted 1:1000 and labeled with horseradish peroxidase was added and allowed to incubate for 1 h, followed by rinsing in PBS/Tween. The final detection was done using the ECL Western blot detection system (Amersham International plc, Imaging Processing). Relative density of the bands was evaluated by densitometry, using Imaging Processing lab gel (Signal Analytics Corp., Vienna, VA). Control gels were run during identical conditions but with the primary antibody omitted. No signal was detected from these blots. Three representative control samples were repeatedly run on every gel prepared for analysis. The density measurements of these samples was averaged and used as an equalization factor between gels. Once all densitometry values were corrected, the mean of all term control (AGA) samples was determined; this mean value was arbitrarily assigned a value of 1.0 to facilitate comparisons between groups.
Immunohistochemistry for NHE 13
Tissue samples (
0.3 cm3) were rinsed in ice-cold physiological saline and placed in a fixation solution containing zinc salts for 10 h (26). The fixative consisted of a 0.1 M Tris buffer (pH 6.8), with 2.8 mM calcium acetate, 23 mM zinc acetate, and 37 mM zinc chloride. Subsequently the tissue was rinsed three times in ice-cold PBS and dehydrated through a graded series of ethanol to xylene, embedded in paraffin, and sectioned 4 µm thick. Sections were floated on distilled water and mounted on positively charged slides (SuperFrost plus, Menzel-Gläser, Braunschweig, Germany). Before experiment, slides were heated to 60 C for 20 min and allowed to cool. Subsequently paraffin was removed in xylene, followed by rehydration using a passage through graded ethanol and finally deionized water. The slides were placed in a 10-mM citrate buffer, pH 6.0, and allowed to reach boiling temperature. Boiling was continued for 15 min, and thereafter the slides were allowed to cool for 60 min and subsequently placed in 0.1 M PBS. The slides were blocked in 3.0% normal horse serum and 2.5% nonfat dry milk in 0.1 M PBS (NHS-blotto) for 30 min at room temperature. Endogenous peroxidases were inhibited by placing slides in 0.3% hydrogen peroxide in PBS for 30 min. Tissues were then incubated overnight at 4 C in a humidified chamber with a monoclonal serum against NHE-1 diluted 1:400 and polyclonal antibodies raised against NHE 23, diluted 1:100 in NHS-blotto. Mouse ascites fluid and preimmune rabbit serum were used at similar dilution as controls to determine the degree of nonspecific staining. A Vectastain Elite ABC kit (Vector Laboratories, Inc., Burlingame, CA) was used to detect the primary antibodies. In short, before addition of secondary biotinylated antibody, slides were rinsed with three changes of PBS. Secondary antibody was diluted in 0.1 M PBS and incubated for 60 min. The secondary was rinsed off with three changes of PBS and ABC reagent was added. Incubation time was 30 min at RT. Slides were finally treated with 3,5-diaminobenzidine according to the glucose oxidase method described by Shu et al. (27). After the appearance of black reaction product, slides were washed in PBS, dehydrated in graded ethanol, cleared in xylene, and mounted. Before the dehydration, slides were counterstained using hematoxylin according to Gills formulation (Vector Laboratories, Inc.)
NHE activity assay
The activity of the NHE in syncytiotrophoblast plasma membrane vesicles was measured using a published protocol (17) with some modifications. The method is a rapid filtration technique performed at room temperature. Briefly, the vesicles were allowed to thaw on ice. Using a glass homogenizer, they were resuspended in acid-loading buffer, pH 5.6 (25 mM MES, 5 mM Tris, and 150 mM KCl) and allowed to equilibrate over night at 4 C in centrifuge tubes. Vesicles were subsequently spun down for 20 min at 50,000 x g. Thereafter they were resuspended in acid loading buffer to a concentration of 6 mg protein/ml. Until further use the vesicles were kept on ice. Immediately before assay, the vesicles were allowed to reach room temperature. After mixing the vesicles, a volume of 20 µl was withdrawn and mixed with 80 µl uptake buffer [18 mM HEPES, 12 mM Tris, 150 mM KCl, 1.25 mM NaCl, and trace 22NaCl (pH 7.4)]. The initial extravesicular pH under these conditions was 7.2 and uptake was allowed to continue for 45 sec at room temperature. Thereafter total uptake was terminated by adding 2 ml ice-cold stop buffer [18 mM HEPES, 12 mM Tris, 150 mM KCl (pH 7.5)]. The vesicles were filtered over nitrocellulose filters mesh size 0.45 mm (Millipore Corp., Bedford, MA), using a vacuum manifold from the same manufacturer. The filter was washed further with 3x 2 ml of stop solution. The filter was finally transferred to a counting vial and counted in a gamma counter (Packard Cobra Autogamma, Meriden, CT; model 5003). Uptake measurements were performed in the presence and absence of 0.5 mM amiloride, an inhibitor of NHE. Initial experiments were performed to determine an incubation time that was on the linear phase of the uptake time course. To correct for the degree of nonspecific binding of isotope to the filter, vesicles were replaced by uptake buffer and filtered, and these values were subtracted from the incubation values. The sodium uptake in the presence of amiloride subtracted from the uptake without amiloride was used as activity measurement for NHE.
RNA extraction and mRNA isolation
Following delivery, placental tissue was randomly sampled from the trophoblast tissue and immediately placed in extraction solution RNA stat 60 (Tel-Test, Friendswood, OH) and snap frozen in liquid nitrogen. RNA was subsequently extracted according to the manufacturers instructions and dissolved in Rnase free water. The RNA was quantified by absorbance measurement at 260 nm, and its integrity was assessed by electrophoresis through a 1.2% agarose-formaldehyde gel. To extract mRNA, poly-T labeled magnetic Dynabeads were used (DynAl AS, Oslo, Norway). The extraction was performed according to the manufacturers instructions and the resulting mRNA was dissolved in 2 mM EDTA buffer (pH 8).
NHE-1 cDNA probe development using RT-PCR
Total RNA from human kidney was obtained from CLONTECH Laboratories, Inc. (Basingstoke, UK). Reverse transcription was carried out using the Superscript II kit according to the instructions of the manufacturer (BRl-Life Technologies, Inc., Täby, Sweden). The resulting cDNA was used to generate an 818-nucleotide PCR product using primers specific for human NHE-1 GenBank accession no. S68616. The sequence for the forward primer was 5'ATCAAGGGTGTAGGCGAGAC and the sequence for the reverse primer was 5'AGGGTGCTGATGACGAAGGT. PCR of 30 cycles was performed at an annealing temperature of 60 C and a Mg2+ concentration of 1.5 mM. Taq-polymerase and 10x PCR buffer was purchased from Sigma (St. Louis, MO). The resulting product was electrophoresed on a 1.5% agarose-0.5 M Tris-borate EDTA gel containing 0.5 mg/ml ethidium bromide. The bands were excised and the DNA was extracted by use of a Qiaex II gel extraction kit (QIAGEN, Chatsworth, CA) in accordance with the manufacturers instructions. The identity of the PCR product was confirmed by restriction enzyme analysis and sequence analysis. The resulting DNA was quantified and stored at -80 C in RNase-free water until further use.
Northern blotting for NHE-1
Two milligrams of mRNA per lane were suspended in 50% formamide and 15% formaldehyde and separated by electrophoresis through a 1.2% agarose-formaldehyde gel. The RNA was blotted onto a nylon membrane (Hybond XL, Amersham Pharmacia, Uppsala, Sweden) by capillary transfer. Following transfer the RNA was cross-linked to the membrane using an UV Stratalinker 1800 (Stratagene, La Jolla, CA). The DNA probe for NHE-1 was generated by PCR as described above and the 18 S DNA probe used for detection of a housekeeping RNA species was purchased from Ambion, Inc. Prehybridization in 7 ml hybridization buffer was performed for 60 min at 65 C (Rapid hyb buffer, Amersham Pharmacia). The probes for NHE-1 and 18 S rRNA were labeled with 32P-labeled dCTP using the ready prime II system (Amersham Pharmacia) and added to the prehybridization solution according to the manufacturers instructions. Hybridization was performed for 12 h. Finally the blot was washed as follows: one wash using 2x saline sodium citrate (SSC), 0.1% SDS at 65 C for 5 min, two washes using 0.3x SSC, 0.1% SDS at 65 C for 10 min each, and finally two washes using 0.1x SSC, 0.1% SDS at 65 C for 10 min each. The membrane was wrapped in plastic film and exposed to Hyperfilm (Amersham Pharmacia) using an intensifying screen. Exposure was allowed for 20 h at -80 C. Signal was quantified using densitometry. Data are expressed as the ratio of NHE-1 signal to 18S signal for each sample loaded.
Data and statistical presentation
Data are given as mean and SEM unless otherwise indicated. To evaluate data statistically, t test and ANOVA were used and statistical significance was at the P less than 0.05 level.
Results
Clinical data
Table 1
shows selected clinical characteristics of the patients included in this study. Birth weights and placental weights were significantly lower in the IUGR samples, compared with AGA samples in both the term and preterm groups.
|
Alkaline phosphatase, the marker for MVM, activities for placental homogenate and MVM are shown in Table 2
. Alkaline phosphatase activity was enriched 15-fold and 18-fold in the MVM fractions from preterm AGA and IUGR placentas, respectively, and 13-fold and 14-fold in the MVM fractions from term AGA and IUGR placentas, respectively. The enrichment of alkaline phosphatase was not significantly different between groups. For analysis of NHE isoform distribution in MVM and BM, a BM fraction was used that has been characterized previously. Adenylate cyclase activity in BM was enriched 29-fold, compared with the activity in the P2 fraction.
|
Western blot analysis of term syncytiotrophoblast MVM and BM demonstrated the presence of NHE isoforms 13 in both MVM and BM. Representative Western blots are shown in Fig. 1A
. The relative expression of the NHE-1, NHE-2, and NHE-3 isoforms in the BM was 11 ± 3% (n = 4, P < 0.02), 6 ± 1% (n = 4, P < 0.03), and 13 ± 1% (n = 4, P < 0.01), respectively, of that in MVM (Fig. 1B
). Multiple bands for NHE have been previously reported and appear to reflect deglycosylated or partially glycosylated forms of the mature protein (28). In our analysis we included all bands between 90 and 110 kDa. Figure 2A
shows a representative blot used for determining the expression of NHE-1 in MVM from AGA and IUGR preterm and term placentas, and these experiments are summarized in Fig. 2B
. The NHE-1 expression in MVM from IUGR preterm placentas was reduced by 55%, compared with gestational age-matched AGA controls (P < 0.05, n = 6 for IUGR, n = 16 for AGA). In contrast, NHE-1 protein expression was unaltered in MVM from term IUGR placentas, compared with AGA controls (n = 8). No relationship was found between mode of delivery and NHE-1 expression in either the AGA or IUGR groups. The expression of NHE-2 and NHE-3 protein was not significantly different in IUGR groups, compared with controls (data not shown).
|
|
Using immunohistochemistry, NHE-1 and NHE-2 isoforms were identified in the MVM and BM of term syncytiotrophoblast (Fig. 3
, A and B). NHE-3 staining was detected through the full thickness of the syncytiotrophoblast cytoplasm (Fig. 3C
). No staining could be detected in the control sections, (Fig. 3D
).
|
In BM, no NHE activity could be demonstrated because amiloride inhibitable uptake of Na+ was not significantly different from zero (data not shown). NHE activity in MVM is shown in Fig. 4
. The activity of preterm control and IUGR vesicles were 1.55 ± 0.16 nmol/mg protein per 45s (n = 6) and 0.81 ± 0.26 nmol/mg protein per 45s (n = 6), respectively. This difference was statistically significant (P < 0.05, ANOVA). In term placentas the activity of control MVM (1.1 ± 0.08 nmol/mg protein per 45s, n = 7) was similar to that in IUGR MVM (1.02 ± 0.15 nmol/mg protein per 45s, n = 7). No significant difference was detected between the preterm and term AGA groups using ANOVA. There was no significant difference in NHE activity between cesarean (n = 8) and vaginal (n = 5) deliveries when the IUGR and AGA term samples were pooled.
|
The results of northern blotting using a PCR-generated DNA probe against NHE-1 mRNA and 18S RNA are shown in Fig. 5
. The size of the NHE-1 mRNA detected was 4.5 kb, agreeing well with that predicted from sequence data (15). The results of hybridization with a probe against 18S RNA gave the predicted size of 1.9 kb. Figure 5B
shows the NHE-1/18S densitometry ratio (mean ± SEM) obtained for IUGR and AGA samples from preterm and term pregnancies. No significant differences were found between groups by ANOVA.
|
In the present study, we demonstrate by Western blotting that isoforms 13 of NHE are distributed primarily to the MVM in placental syncytiotrophoblast and also to the BM at lower abundance. We provide immunocytochemical evidence for the distribution of NHE-1 and -2 to the MVM and BM of the syncytiotrophoblast and of isoform 3 to the MVM, BM, and cytoplasmic compartment. These findings are consistent with our demonstration of functional NHE in MVM. We further demonstrated that in MVM obtained from preterm IUGR pregnancies, the activity of the NHE is reduced, compared with gestational age-matched AGA controls. This corresponds to a reduced NHE-1 protein expression in preterm IUGR MVM samples, compared with preterm AGA controls. In a small number of samples, Northern blotting showed no significant difference between IUGR and AGA with regard to NHE-1 mRNA levels in term or preterm groups. The lack of correlation between protein expression and mRNA in this study might be due to the small sample size in the Northern analysis. Other explanations for this discrepancy include a posttranscriptional regulatory level of control for NHE in the placenta. A recent study of NHE-1 in the developing murine heart also found a discrepancy between RNA and protein expression with NHE-1 protein expression reaching a peak at 14 d after birth, but no significant increase in NHE-1 promoter activity using a green fluorescent protein reporter could be detected (29). Mechanisms behind these results are unclear at present.
To the best of our knowledge, this is the first study using immunohistochemistry to describe the distribution of NHE-2 in placental tissue. Recently Pepe et al. (14) showed the distribution of NHE-1 and NHE-3 in primate placental tissue, and our results are consistent with their findings. All three isoforms are located in the MVM and BM of the placental syncytiotrophoblast. NHE-3, however, also shows intense staining in the cytoplasm. This is in agreement with studies of other epithelia showing storage of this isoform in plasma membrane vesicles called recycling endosomes (30, 31). These endosomes are incorporated into the apical membranes on demand and represent a dynamic and mobile pool of NHE-3 in e.g. renal epithelium (30, 31). This also appears to be the case in the human syncytiotrophoblast. The results from immunocytochemistry were supported by Western blotting of MVM and BM, where the presence of NHE 13 was detected not only in MVM but also in the BM, albeit at approximately 10-fold lower expression than in MVM. However, we were unable to measure any NHE activity in the BM. This is at odds with the NHE activity in BM described by Kulanthievel et al. (8). Also, in Fig. 3A
using immunohistochemistry, we showed that NHE-1 is clearly located at both the MVM and BM. Immunohistochemistry, however, is not a quantitative method but rather a qualitative technique, and the staining density therefore can not be used to compare the expression of NHE-1 in MVM and BM. The low abundance of NHE in our BM preparations, as detected by Western blotting is probably the primary reason for not detecting NHE activity in the BM fraction.
In other polarized transporting epithelia, such as the renal and intestinal, a consistent pattern is observed with regard to NHE isoform distribution. NHE-2 and NHE-3 are inserted into the apical membranes, and NHE-1 is distributed to the basolateral membrane (32). This asymmetrical distribution dictates the function of NHE isoforms in these epithelia. The basal localization of NHE-1 is thought to mainly regulate intracellular pH, and the apical NHE-2 and -3 aid in vectorial Na+ transport (33). The placental syncytiotrophoblast displays a different pattern of polarization, with the greatest abundance of all three isoforms localized to the MVM. The significance of this unique polarization remains to be fully determined. The high abundance of NHE isoforms in MVM is consistent with protons being transported from the syncytiotrophoblast into the maternal circulation for subsequent elimination by the maternal kidney. Besides pH regulation of the syncytiotrophoblast, placental NHE is likely to be involved in vectorial Na+ transport (34). The anion exchanger is also more abundant in the MVM than in the BM (35) and possibly acts in conjunction with NHE to perform vectorial NaCl transport. Furthermore, these exchangers could be important for creating an acidic microenvironment in the vicinity of the MVM. This is the case in the small intestine in which the increased extracellular proton concentration enhances the uphill transport of oligopeptides (36, 37). The presence of cotransporters coupling the uptake of protons to import of lactate (38), organic cations (39), and peptides (40) have been described in placental MVM. The expression of NHE in BM implies that the syncytiotrophoblast has the capability to transport protons into the fetal compartment. However, our data suggest that NHE activity in BM, if present, is likely to be low. It is possible that NHE localized in the fetal facing plasma membrane may be important for optimal function of other transporters by establishing an acidic microenvironment.
Having established the normal distribution of the NHE isoforms in placental tissue, we compared MVM isolated from AGA and IUGR pregnancies, both term and preterm samples. Earlier studies have produced potentially divergent results on this matter. In a study by Mahendran et al. (5), NHE activity was not altered in MVM from term IUGR, compared with term AGA. In a subsequent study by Glazier et al. (18) in which IUGR samples were obtained primarily from preterm deliveries, a significant reduction in MVM NHE activity in IUGR was found in comparison with gestational age-matched AGA. In a more recent study by Hughes et al. (13) in which term small-for-gestational-age and AGA samples were studied, no differences in NHE activity or protein expression could be detected. These investigators suggested that the conflicting results concerning NHE activity and expression in IUGR might stem from differences related to the severity of growth restriction. The study of Glazier et al. (18) used a stricter definition of IUGR, and the majority of their samples were delivered preterm because of indications of deteriorating fetal health and viability. We have examined both preterm and term IUGR and found MVM NHE activity and NHE-1 expression were down-regulated in the preterm IUGR group, compared with age-matched controls. The fact that preterm IUGR MVM, but not term IUGR MVM, show a significant reduction in NHE might indicate that the two groups are associated with different pathophysiological conditions. In this study five of six preterm IUGR fetuses were delivered by cesarean section because of overt signs of fetal distress and compromise. The IUGR fetus delivered preterm therefore appears to have a decreased capacity to maintain basic homeostatic parameters. The term IUGR fetuses might represent a subgroup of growth-restricted fetuses with less severe growth restriction and/or better compensatory mechanisms that allow those pregnancies to progress to term. We suggest that the current study using strict criteria in defining IUGR combined with a spectrum of gestational ages is crucial in assessing NHE activity and expression in IUGR. The earlier studies of MVM NHE in IUGR can be rationalized by defining two IUGR populations, one that is associated with severe fetal compromise, reduction of placental pH regulatory capacity, and preterm delivery, and the other having less pronounced complications, normal pH regulatory capacity, and delivery at term.
At present, little is known about the function of NHE isoforms 13 in the human placenta. Data in primary villous samples (16), a choriocarcinoma cell line (41), and isolated membrane vesicles (8, 17) suggest that NHE represents one of the key mechanisms for intracellular pH regulation in the syncytiotrophoblast. This study shows that NHE activity and NHE-1 expression are reduced in MVM from preterm IUGR placentas. A decreased capacity to clear the syncytiotrophoblast of protons might adversely affect placental enzymatic and transport functions. For example, the activity of the amino acid transporter system A is highly sensitive to pH (42, 43). A reduction in NHE activity could lead to lower intracellular pH, which may impair nutrient transport and other placental functions. IUGR fetuses are prone to develop chronic acidosis in utero (44). It is likely that several factors contribute to this acidosis such as impaired placental blood flow resulting in hypoxemia (7) and reduced fetal kidney function (45). It is ultimately the placenta that is responsible for removing acid equivalents from the fetal compartment, either by transporting protons to the mother or bicarbonate to the fetus. Although the mechanism involved remains to be fully established, it is likely that transcellular transport of protons across the syncytiotrophoblast plays a role in the regulation of fetal pH. In such a transcellular transport route for protons NHE in the microvillous plasma membrane of the syncytiotrophoblast represents a key mechanism. We therefore speculate that the decreased MVM NHE protein expression and activity in preterm IUGR contributes to the development of fetal acidosis.
Acknowledgments
We thank Elisabet Pollak for the isolation of plasma membranes and excellent technical assistance.
Footnotes
This work was supported by grants from the Swedish Medical Research Council (10838), Wellcome Trust, Knut and Alice Wallenberg Foundation, General Maternity Hospital Foundation, Sven Jerring Foundation, Samaritan Foundation, Åhléns Foundation, Magnus Bergvall Foundation, Craaford Foundation, Wilhelm & Martina Lundgrens Foundation, Sigurd and Elsa Goljes Memorial Foundation, Göteborg Medical Society, Adlerbergska Research Fund, and Swedish Society for Medical Research.
Abbreviations: AGA, Appropriately grown for gestational age; BM, basal membrane; MVM, microvillous membrane; NHE, sodium hydrogen exchanger; RT, reverse transcription; SSC, saline sodium citrate; IUGR, intrauterine growth restriction.
Received February 12, 2002.
Accepted September 10, 2002.
References
This article has been cited by other articles:
![]() |
E. D. Johnstone, P. F. Speake, and C. P. Sibley Epidermal growth factor and sphingosine-1-phosphate stimulate Na+/H+ exchanger activity in the human placental syncytiotrophoblast Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2007; 293(6): R2290 - R2294. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Magnusson-Olsson, S. Lager, B. Jacobsson, T. Jansson, and T. L. Powell Effect of maternal triglycerides and free fatty acids on placental LPL in cultured primary trophoblast cells and in a case of maternal LPL deficiency Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E24 - E30. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Jansson, J. Pettersson, A. Haafiz, A. Ericsson, I. Palmberg, M. Tranberg, V. Ganapathy, T. L. Powell, and T. Jansson Down-regulation of placental transport of amino acids precedes the development of intrauterine growth restriction in rats fed a low protein diet J. Physiol., November 1, 2006; 576(3): 935 - 946. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Settle, C. P. Sibley, I. M. Doughty, T. Johnston, J. D. Glazier, T. L. Powell, T. Jansson, and S. W. D'Souza Placental Lactate Transporter Activity and Expression in Intrauterine Growth Restriction Reproductive Sciences, July 1, 2006; 13(5): 357 - 363. [Abstract] [PDF] |
||||
![]() |
A. L. Magnusson, I. J. Waterman, M. Wennergren, T. Jansson, and T. L. Powell Triglyceride Hydrolase Activities and Expression of Fatty Acid Binding Proteins in the Human Placenta in Pregnancies Complicated by Intrauterine Growth Restriction and Diabetes J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4607 - 4614. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Johansson, L. Karlsson, M. Wennergren, T. Jansson, and T. L. Powell Activity and Protein Expression of Na+/K+ ATPase Are Reduced in Microvillous Syncytiotrophoblast Plasma Membranes Isolated from Pregnancies Complicated by Intrauterine Growth Restriction J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2831 - 2837. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |