help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomlinson, J. W.
Right arrow Articles by Stewart, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomlinson, J. W.
Right arrow Articles by Stewart, P. M.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 12 5630-5635
Copyright © 2002 by The Endocrine Society


Original Article

Expression of 11ß-Hydroxysteroid Dehydrogenase Type 1 in Adipose Tissue Is Not Increased in Human Obesity

J. W. Tomlinson, B. Sinha, I. Bujalska, M. Hewison and P. M. Stewart

Division of Medical Sciences, University of Birmingham, Queen Elizabeth Hospital, Edgbaston, Birmingham, United Kingdom B15 2TH

Address all correspondence and requests for reprints to: Prof. P. M. Stewart, Division of Medical Sciences, University of Birmingham, Queen Elizabeth Hospital, Birmingham, United Kingdom B15 2TH. E-mail: p.m.stewart{at}bham.ac.uk.

Abstract

Central obesity is associated with increased morbidity and mortality. Preadipocyte proliferation and differentiation contribute to increases in adipose tissue mass, yet the mechanisms that underlie these processes remain unclear. Patients with glucocorticoid excess develop a reversible form of central obesity, but circulating cortisol levels in idiopathic obesity are invariably normal. We have hypothesized that the enzyme 11ß-hydroxysteroid dehydrogenase type 1 (11ß-HSD1), by converting inactive cortisone to active cortisol in adipose tissue, might be an important autocrine regulator of fat mass.

Paired omental and sc fat biopsies were obtained from 32 women (median age, 43 yr; range, 28–65; median body mass index, 27.5 kg/m2; range, 19.7–39.2) undergoing elective abdominal surgery. 11ß-HSD1 activity and mRNA levels were assessed in whole tissue and in isolated preadipocytes and adipocytes using specific enzyme assays and real-time PCR. Preadipocyte proliferation was measured using tritiated thymidine incorporation.

Whole adipose tissue 11ß-HSD1 mRNA levels did not differ between omental and sc samples (P = 0.73). In addition, mRNA levels did not correlate with body mass index (omental: r = 0.1; P = 0.6; sc: r = 0.15; P = 0.4). In keeping with earlier studies, 11ß-HSD1 mRNA levels were higher in omental compared with sc preadipocytes. However, in cultured omental preadipocytes, 11ß-HSD1 activity inversely correlated with body mass index (r = -0.47; P = 0.03). In omental preadipocytes, both cortisol and cortisone decreased proliferation (P < 0.05). Inhibition of 11ß-HSD1 with glycyrrhetinic acid partially reversed the cortisone-induced decrease in preadipocyte proliferation (P < 0.05).

Enhanced preadipocyte proliferation within omental adipose tissue as a consequence of decreased 11ß-HSD1 mRNA levels and activity may contribute to increases in visceral adipose tissue mass in obese patients.

THE GLOBAL EPIDEMIC of obesity (1) has focused attention on the mechanisms that underlie its pathogenesis. As the incidence of obesity continues to escalate, so do its major complications, namely type 2 diabetes, hypertension, and ischemic heart disease. Although obesity per se is clearly linked to excess morbidity and mortality (1, 2), fat distribution is highly relevant. Central or visceral adiposity carries a more severe adverse metabolic profile and increased morbidity than peripheral adiposity (3), highlighting the need to identify factors regulating fat distribution.

Patients with glucocorticoid excess, Cushing’s syndrome, develop florid, but reversible, central obesity. However, circulating cortisol (F) levels in simple obesity are normal or slightly reduced compared with those in lean controls (4). Two isoforms of the enzyme 11ß-hydroxysteroid dehydrogenase (11ß-HSD) play a crucial role in the prereceptor metabolism of F (5). Type 1 (11ß-HSD1) is widely expressed in many tissues, including liver, adipose tissue, gonad, and bone (6, 7), where it activates F from cortisone (E). 11ß-HSD1 is a bidirectional enzyme, and although in vivo the reductase activity predominates, in tissue homogenates only dehydrogenase activity is observed. The underlying mechanism remains unclear, but cofactor availability may be crucial (7A ). The type 2 isozyme (11ß-HSD2) is a high affinity dehydrogenase inactivating F to E, located principally in mineralocorticoid target tissues, including kidney and placenta. It serves to protect the mineralocorticoid receptor from illicit occupation by F (for which it has the same affinity as aldosterone). Defects in this enzyme explain the rare, life-threatening form of hypertension and hypokalemia, apparent mineralocorticoid excess (8), and also explain the hypertension induced by liquorice (9). 11ß-HSD2 is not expressed in human adipose tissue (10).

The role of 11ß-HSD1 in adipose tissue has been investigated. Within isolated preadipocytes we have previously demonstrated enhanced activity in omental (om) compared with sc cells (10) together with further induction of activity by F itself. At this site, the enzyme appears to facilitate adipocyte differentiation (11), and this is supported by the recent report of transgenic mice overexpressing 11ß-HSD1 within adipocytes (12). Therefore, it has been postulated that central obesity reflects local F excess specifically within adipose tissue (10, 11, 13). However, clinical studies suggest inhibition of 11ß-HSD1, at least in the liver, in obese subjects (14, 15). The concept has therefore evolved that the centrally obese phenotype results as a consequence of differential regulation of 11ß-HSD1 inhibition within the liver and up-regulation within adipose tissue.

To date, there are only limited data on the expression of 11ß-HSD1 in adipose tissue in human obesity and no data at all on om 11ß-HSD1 expression as a function of the body mass index (BMI). We have therefore determined the depot-specific activity and expression of 11ß-HSD1 in whole adipose tissue and in isolated adipocytes and preadipocytes in human obesity.

The roles of F and 11ß-HSD1 in adipocyte differentiation are well established (11, 12). However, increases in adipose tissue mass arise as a result of adipocyte differentiation and lipid accumulation as well as preadipocyte proliferation and recruitment. However, glucocorticoids generally inhibit cellular proliferation (16, 17), and in recent studies we have demonstrated the impact of 11ß-HSD-mediated F/E metabolism on cell proliferation in transfected cell lines (18). Overexpression of 11ß-HSD2 enhanced proliferation, but overexpression of 11ß-HSD1 had the opposite effect. In addition, we have investigated the role of 11ß-HSD1 in om preadipocyte proliferation.

Subjects and Methods

The study had the approval of the local research ethics committee. Thirty-two consecutive women (median age, 43 yr; range, 28–65; median BMI, 27.5 kg/m2; range, 19.7–39.2) undergoing elective abdominal surgery were recruited for the study, and all gave written consent. Patients with diabetes mellitus and those who had received glucocorticoid therapy within the last 12 months were excluded from the study. The clinical characteristics of the patients, divided into obese and nonobese by BMI according to WHO criteria (19), are presented in Table 1Go. Importantly, because of the well described actions of cytokines on the activity and expression of 11ß-HSD1 (20), all operations were for noninflammatory and nonmalignant conditions. Paired sc and om fat biopsies were obtained from each patient. Samples were processed within 30 min of removal from the patient. Each sample was divided; one part was snap-frozen in liquid nitrogen and stored at -70 C for total RNA extraction at a later date, and the remainder was used for adipocyte isolation and preadipocyte culture when sufficient tissue was available (n = 20). Subgroup analysis of the clinical characteristics of this cohort was not different from that of the whole cohort.


View this table:
[in this window]
[in a new window]
 
Table 1. Baseline characteristics of 32 patients undergoing elective abdominal surgery

 
Isolation of adipocytes and primary cultures of human preadipocytes

Adipocytes and preadipocytes were isolated as previously reported (10, 21). Briefly, om or sc adipose tissue was washed in PBS containing 50,000 U penicillin and 50,000 µg streptomycin (Life Technologies, Inc., Paisley, UK). The tissue was then prepared and digested with collagenase class 1 (2 mg/ml; Worthington Biochemical Corp., Reading, UK) in 1x Hanks’ balanced salt solution (Life Technologies, Inc.) for 45 min at 37 C. Samples were centrifuged at 90 x g for 1 min, the intact adipocyte layer was removed, and RNA was extracted as described below. Samples were then centrifuged at 90 x g for 5 min, the pellet containing preadipocytes was removed, and cells were washed with DMEM/Nutrient Mixture F-12 (Life Technologies, Inc.) containing 15% fetal calf serum (Life Technologies, Inc.) and seeded on 12-well plates (Costar, Cambridge, MA). Cells were left overnight, washed the following day with 1x Hanks’ balanced salt solution, and then cultured to confluence in DMEM/Ham’s F-12 medium containing 15% fetal calf serum with or without 100 nM F (Sigma, Poole, UK).

11ß-HSD assay

Assays for 11ß-HSD1 activity were performed by incubating intact cells with 100 nM E and tritiated tracer for 16 h to ensure first order kinetics. After incubation, steroids were extracted using dichloromethane, separated using a mobile phase consisting of ethanol and chloroform (8:92) by thin layer chromatography, and scanned using a Bioscan 3000 image analyzer (Lablogic, Sheffield, UK). Protein levels were assayed using a commercially available kit (Bio-Rad Laboratories, Inc., Hercules, CA), and activity was expressed as picomoles of product per milligrams of protein per hour. All experiments were carried out in triplicate.

RNA extraction and RT

Total RNA was extracted using a single step extraction method [Tri-Reagent, Sigma (preadipocytes and adipocytes), or Genelute total mammalian RNA extraction kit, Sigma (adipose tissue)]. RNA integrity was assessed by electrophoresis on 1% agarose gels, and quantity was determined spectrophotometrically at OD260. One microgram of total RNA was initially denatured by heating to 70 C for 5 min. Thirty units of avian myeloblastosis virus, 200 ng random primers, 20 U ribonuclease inhibitor, and 40 nmol deoxy-NTPs with 5x reaction buffer were added to the RNA, and the reverse transcriptase reaction was carried out at 37 C for 1 h. The reaction was terminated by heating the cDNA to 95 C for 5 min.

Real-time PCR

11ß-HSD1 mRNA levels were analyzed using an ABI 7700 sequence detection system (Perkin-Elmer, Warrington, UK) that employs TaqMan chemistry for highly accurate quantification of mRNA levels as previously described (22). Real-time PCR was performed in 25-µl volumes on 96-well plates in reaction buffer containing TaqMan Universal PCR Master Mix, 3 mM Mn(Oac)2, 200 µM deoxy-NTPs, 1.25 U AmpliTaq Gold polymerase, 1.25 U AmpErase UNG (Perkin-Elmer, Warrington, UK), 100–200 nmol TaqMan probe, 900 nmol primers, and 25–50 ng cDNA. All reactions were multiplexed with the housekeeping gene (18S), provided as a preoptimized control probe (Perkin-Elmer), enabling data to be expressed in relation to an internal reference to allow for differences in RT efficiency. Data were obtained as ct values according to the manufacturer’s guidelines (the cycle number at which logarithmic PCR plots cross a calculated threshold line) and were used to determine {Delta}ct values ({Delta}ct = ct of the target gene minus ct of the housekeeping gene). Fold changes in expression were calculated according to the transformation: fold increase = 2- difference in {Delta}ct. All target gene probes were labeled with the fluorescent label FAM, and the housekeeping gene was labeled with the fluorescent label VIC. Reactions were as follows: 50 C for 2 min, 95 C for 10 min, and then 44 cycles of 95 C for 15 sec and 60 C for 1 min.

To exclude potential bias owing to averaging data that had been transformed through the equation 2-ct, all statistics were performed at the ct stage. Statistical analysis of comparisons among groups was undertaken using paired and unpaired t tests where appropriate.

Oligonucleotide primers and a TaqMan probe for 11ß-HSD1 were as follows: forward, AGGAAAGCTCATGGGAGGACTAG; reverse, ATGGTGAATATCATCATGAAAAAGATTC; and probe, CATGCTCATTCTCAACCACATCACCAACA.

Preadipocyte proliferation

In a subset of the patients described above (n = 7; median BMI, 30.1 kg/m2; range, 22.9–33.5; median age, 45 yr; range, 30–65), preadipocyte proliferation was assessed using tritiated thymidine incorporation as described previously (18). Preadipocytes were cultured and incubated with either 1 µM E, 100 nM F, and 5 µM 18ß-glycyrrhetininc acid (GE; Sigma), or 1 µM E plus 5 µM GE. Cells were grown until they were 80–85% confluent. DNA synthesis was measured by incubating cells with 0.2 µCi [3H]thymidine (specific activity, 80 Ci/mmol; Amersham International, Little Chalfont, UK) for 16 h. Cells were then washed twice in PBS and once in 1 ml cold 5% trichloroacetic acid to precipitate proteins, then were left on ice for 20 min. The liquid layer was removed and drained. An aliquot (250 µl) of 0.1 M sodium hydroxide was added to the cells and left at room temperature for 30 min on a shaker. The resulting solubilized nuclear material was then transferred to 4 ml scintillant, and radioactive counts were determined by liquid scintillation counting.

Statistical analysis

Data are expressed as the mean ± SE unless otherwise stated. Initial linear regression analysis was performed using Pearson’s correlation coefficient. Subsequent analysis used unpaired t test to compare obese and nonobese groups and single treatments to controls. Paired t tests were used to compare matched samples from the same subject. Where multiple treatments are compared, one-way ANOVA of ranks was used. Statistical analysis of real-time PCR data was performed on mean {Delta}ct values and not fold changes.

Results

Obese vs. nonobese

In whole adipose tissue, 11ß-HSD1 mRNA levels did not correlate with body mass index (om: r = 0.1; P = 0.6; sc: r = 0.15; P = 0.4). When divided into obese and nonobese groups, there was no significant difference in mRNA levels in whole tissue or adipocytes in either sc or om depots (Table 2Go).


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of the characterization of 11ß-HSD1 activity and mRNA levels in human adipose tissue and its cellular subfractions

 
11ß-HSD1 activity in om preadipocytes inversely correlated with BMI (r = -0.47; P = 0.03; Fig. 1Go). Furthermore, when divided by BMI, 11ß-HSD1 activity in om preadipocytes cultured with F was lower in obese patients (P = 0.04, obese vs. nonobese; Fig. 2AGo). In sc samples cultured with F, there was no difference in activity between obese and nonobese patients. Cells cultured without F demonstrated the same pattern, although results failed to reach statistical significance (Table 2Go).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Significant negative correlation between BMI and 11ß-HSD1 activity in cultured om preadipocytes.

 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. 11ß-HSD1 activity in isolated cultured sc and om preadipocytes from obese and nonobese women. Cells were cultured with and without 100 nM F. Activity is significantly higher in om preadipocytes from nonobese patients (A). Regulation of enzyme activity is at the transcriptional level. mRNA levels are 4.9-fold higher in om compared with sc preadipocytes and higher in om preadipocytes from nonobese patients, mirroring activity data (B).

 
Regulation appeared to be at a transcriptional level; 11ß-HSD1 mRNA levels were 1.9-fold higher in om preadipocytes from nonobese subjects than in those from obese subjects. Levels of 11ß-HSD1 mRNA were similar in sc preadipocytes from obese and nonobese subjects (Table 2Go and Fig. 2BGo).

Omental vs. sc depots

In whole adipose tissue 11ß-HSD1 mRNA levels did not differ between om and sc samples (P = 0.73). As previously reported by our group, 11ß-HSD1 activity was significantly higher in cultured om than in sc preadipocytes (P = 0.002). F induced activity in both sc and om preadipocytes (Table 2Go). Differences in enzyme activity between om and sc depots were reflected in levels of 11ß-HSD1 mRNA. Using real-time PCR, 11ß-HSD1 mRNA levels were 4.8-fold higher in om compared with sc preadipocytes cultured with F (Table 2Go).

Adipocytes vs. preadipocytes

In the om depot, 11ß-HSD1 mRNA levels were higher in preadipocytes than in adipocytes (P = 0.04), whereas in the sc depot, mRNA levels were similar in both cell types (P = 0.62; Table 2Go and Fig. 3Go).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 3. 11ß-HSD1 mRNA levels in the om depot are greater in preadipocytes than in adipocytes. Conversely, in the sc depot expression is greatest within mature adipocytes (*, P < 0.05 vs. om preadipocytes). All data are presented relative to the mRNA levels in om whole tissue.

 
Omental preadipocyte proliferation

In om preadipocytes, both F and E decreased proliferation [F, 35.6 ± 3.6%; E, 59.3 ± 4.4%; P < 0.05, vs. control (100%)]. Inhibition of 11ß-HSD1 with GE partially reversed the E-induced decrease in om preadipocyte proliferation (E, 59.3 ± 4.4%; E plus GE, 76.8 ± 4.6%; P < 0.05; Fig. 4Go).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 4. F (100 nM) and E (1 µM) decrease the proliferation of om preadipocytes, as demonstrated by [3H]thymidine incorporation. GE (5 µM) partially reverses the inhibition induced by E by inhibiting 11ß-HSD1 activity and thus preventing local regeneration of F (*, P < 0.05 vs. GE treated; {dagger}, P < 0.05 vs. E treated).

 
Discussion

We have characterized the expression of 11ß-HSD1 in adipose tissue in human obesity. Within adipose tissue and isolated adipocytes, 11ß-HSD1 mRNA levels did not differ between sc and om depots and did not correlate with BMI. There were, however, decreased 11ß-HSD1 mRNA levels and activity within the om preadipocyte pool of obese patients. Furthermore, inhibition of 11ß-HSD1 within om preadipocytes partially relieved the E-induced inhibition of preadipocyte proliferation.

Patients with glucocorticoid excess, Cushing’s syndrome, develop florid, but reversible, central obesity, but in simple obesity, circulating F levels are normal or slightly reduced (4). However, the metabolic clearance rate of F is increased in obesity, and as a consequence, there is increased F secretion driven by ACTH (4, 23, 24). Global inhibition of 11ß-HSD1 in obesity (14, 15) with impaired E to F conversion probably accounts for the observed enhanced metabolic clearance rate of F.

At a prereceptor level, we have previously shown 11ß-HSD1 expression to be higher in om compared with sc preadipocytes (10), an observation that was endorsed by this study. This has lead to the speculation that 11ß-HSD1 may have a crucial role to play in the pathogenesis of central obesity. Accumulation of adipose tissue mass may occur in several ways: adipocyte differentiation, increased lipid accumulation within already differentiated cells, and preadipocyte proliferation, increasing the pool of cells available to undergo differentiation. F is an essential requirement for adipocyte differentiation (25), and 11ß-HSD1 has been shown to be an important modulator of this process. Thus, inhibition of 11ß-HSD1 prevented E-induced adipocyte differentiation in om preadipocytes (11). Transgenic mice overexpressing 11ß-HSD1 under the aP2 promoter develop an obese phenotype as a consequence of elevated adipose tissue corticosteroid concentrations (12). In this model, because the transgene was directed to the adipocyte-specific aP2 promoter, increases in adipose tissue mass were solely a consequence of increased lipid accumulation within preexisting adipocytes.

A fundamental action of glucocorticoids is to inhibit cellular proliferation by inducing cell cycle arrest at the G1 phase (17, 26). Prereceptor modulation of F metabolism has been shown to have a dramatic effect on the cell proliferation rate (18). Overexpression of 11ß-HSD2 enhances proliferation, whereas 11ß-HSD1 inhibits proliferation, an effect that relies on the paracrine/autocrine inactivation (11ß-HSD2) or generation (11ß-HSD1) of F within the cell system. In rat preadipocytes glucocorticoids exert an antiproliferative effect (16). Similarly, we have now demonstrated inhibition of human om preadipocyte proliferation with F. This effect was also modulated by 11ß-HSD1; inhibition of 11ß-HSD1 activity with GE limited the antiproliferative effect of E. The prereceptor hormone metabolism of F therefore has an important impact not only on adipocyte differentiation, but also on preadipocyte proliferation. In whole adipose tissue, 11ß-HSD1 would act to increase adipocyte differentiation, but simultaneously inhibit preadipocyte proliferation, and the overall impact of this upon adipose tissue mass needs to be considered.

Interestingly, in this context the 11ß-HSD1 knockout mouse does not appear to have an obvious adipose tissue phenotype (27). Histological data are not available, but we would speculate that enhanced fat cell number will occur at the expense of fat cell size, the exact converse of the aP2 11ß-HSD1-overexpressing mouse. The human correlate of this model is a patient with the putative 11ß-HSD1-deficient state, the syndrome of apparent cortisone reductase deficiency (28, 29, 30, 31, 32, 33). Although there have been no detailed studies of fat distribution in these patients, these patients are not invariably lean (28, 29). Enhanced preadipocyte proliferation within the om depot in these patients may offset any potential benefits on adipocyte differentiation and predispose them to central fat accumulation.

Although we (14) and others (15) have reported reduced hepatic expression of 11ß-HSD1 in obese subjects, it has been hypothesized from rodent studies that increased 11ß-HSD1 expression within adipose tissue might explain an obese phenotype (13, 15). However, within this area there are pitfalls in extrapolating from rodents to humans. Efforts have been made to examine 11ß-HSD1 activity in sc adipose tissue of obese patients (15, 34), but only inappropriate dehydrogenase assays on tissue homogenates have been performed (15). Furthermore, sc and om depots are not identical, as this study highlights, there are marked depot-specific differences in the expression of 11ß-HSD1, and the propensity for proliferation and differentiation is well documented (10, 35, 36).

In this study there was no evidence for overexpression of 11ß-HSD1 in obesity in whole adipose tissue, adipocytes, or preadipocytes; indeed, 11ß-HSD1 activity and mRNA levels were decreased in preadipocytes from obese patients. These data therefore indicate that increased expression of 11ß-HSD1 within om adipose tissue is not a primary cause of obesity. Unfortunately, although we had access to om adipose tissue biopsies, comparisons were only possible with BMI. A detailed assessment of 11ß-HSD1 expression in the context of rigorous adipose tissue distribution is now warranted.

These data add a new layer of complexity to the role of prereceptor F metabolism in the pathogenesis of central obesity. 11ß-HSD1 expression within adipose tissue regulates both adipocyte differentiation and preadipocyte proliferation. Although central obesity may not simply be "Cushing’s disease of the omentum," reflecting increased expression of 11ß-HSD1, the challenge for the future will be to determine the relative contributions of 11ß-HSD1 to differentiation and proliferation in the regulation of adipose tissue mass.

Acknowledgments

We thank Mrs. M. Vigus, Mr. J. Jordan, Mr. J. Pogmoore, Mr. R. Sawers, Mr. M. Afnan, and Mrs. S. Blunt for their help in obtaining the samples used in this study.

Footnotes

J.W.T. is a Medical Research Council Training Fellow. P.M.S. is a Medical Research Council Senior Fellow.

Abbreviations: BMI, Body mass index; E, cortisone; F, cortisol; GE, 18ß-glycyrrhetininc acid; 11ß-HSD1, 11ß-hydroxysteroid dehydrogenase type 1; om, omental.

Received May 3, 2002.

Accepted August 29, 2002.

References

  1. Willett WC, Dietz WH, Colditz GA 1999 Guidelines for healthy weight. N Engl J Med 341:427–434[Free Full Text]
  2. Bender R, Jockel KH, Trautner C, Spraul M, Berger M 1999 Effect of age on excess mortality in obesity. JAMA 281:1498–1504[Abstract/Free Full Text]
  3. Fontbonne A, Thibult N, Eschwege E, Ducimetiere P 1992 Body fat distribution and coronary heart disease mortality in subjects with impaired glucose tolerance or diabetes mellitus: the Paris Prospective Study, 15-year follow-up. Diabetologia 35:464–468[CrossRef][Medline]
  4. Fraser R, Ingram MC, Anderson NH, Morrison C, Davies E, Connell JM 1999 Cortisol effects on body mass, blood pressure, and cholesterol in the general population. Hypertension 33:1364–1368[Abstract/Free Full Text]
  5. Stewart PM, Krozowski ZS 1999 11ß-Hydroxysteroid dehydrogenase. Vitam Horm 57:249–324[Medline]
  6. Ricketts ML, Verhaeg JM, Bujalska I, Howie AJ, Rainey WE, Stewart PM 1998 Immunohistochemical localization of type 1 11ß-hydroxysteroid dehydrogenase in human tissues. J Clin Endocrinol Metab 83:1325–1335[Abstract/Free Full Text]
  7. Cooper MS, Walker EA, Bland R, Fraser WD, Hewison M, Stewart PM 2000 Expression and functional consequences of 11ß-hydroxysteroid dehydrogenase activity in human bone. Bone 27:375–381[Medline]
  8. Agarawal AK, Tusie-Luna MT, Monder C, White PC 1990 Expression of 11ß-hydroxysteroid dehydrogenase using recombinant vaccinia virus. Mol Endocrinol 4:1827–1832[Abstract]
  9. Stewart PM, Krozowski ZS, Gupta A, Milford DV, Howie AJ, Sheppard MC, Whorwood CB 1996 Hypertension in the syndrome of apparent mineralocorticoid excess due to mutation of the 11ß-hydroxysteroid dehydrogenase type 2 gene. Lancet 347:88–91[CrossRef][Medline]
  10. Stewart PM, Wallace AM, Valentino R, Burt D, Shackleton CH, Edwards CR 1987 Mineralocorticoid activity of liquorice: 11ß-hydroxysteroid dehydrogenase deficiency comes of age. Lancet 2:821–824[Medline]
  11. Bujalska IJ, Kumar S, Stewart PM 1997 Does central obesity reflect "Cushing’s disease of the omentum"? Lancet 349:1210–1213[CrossRef][Medline]
  12. Bujalska IJ, Kumar S, Hewison M, Stewart PM 1999 Differentiation of adipose stromal cells: the roles of glucocorticoids and 11ß-hydroxysteroid dehydrogenase. Endocrinology 140:3188–3196[Abstract/Free Full Text]
  13. Masuzaki H, Paterson J, Shinyama H, Morton NM, Mullins JJ, Seckl JR, Flier JS 2001 A transgenic model of visceral obesity and the metabolic syndrome. Science 294:2166–2170[Abstract/Free Full Text]
  14. Livingstone DE, Jones GC, Smith K, Jamieson PM, Andrew R, Kenyon CJ, Walker BR 2000 Understanding the role of glucocorticoids in obesity: tissue-specific alterations of corticosterone metabolism in obese Zucker rats. Endocrinology 141:560–563[Abstract/Free Full Text]
  15. Stewart PM, Boulton A, Kumar S, Clark PM, Shackleton CH 1999 Cortisol metabolism in human obesity: impaired cortisone->cortisol conversion in subjects with central adiposity. J Clin Endocrinol Metab 84:1022–1027[Abstract/Free Full Text]
  16. Rask E, Olsson T, Soderberg S, Andrew R, Livingstone DE, Johnson O, Walker BR 2001 Tissue-specific dysregulation of cortisol metabolism in human obesity. J Clin Endocrinol Metab 86:1418–1421[Abstract/Free Full Text]
  17. Gregoire F, Genart C, Hauser N, Remacle C 1991 Glucocorticoids induce a drastic inhibition of proliferation and stimulate differentiation of adult rat fat cell precursors. Exp Cell Res 196:270–278[CrossRef][Medline]
  18. Sanchez I, Goya L, Vallerga AK, Firestone GL 1993 Glucocorticoids reversibly arrest rat hepatoma cell growth by inducing an early G1 block in cell cycle progression. Cell Growth Differ 4:215–225[Abstract]
  19. Rabbitt EH, Lavery GG, Walker EA, Cooper MS, Stewart PM, Hewison M 2002 Prereceptor regulation of glucocorticoid action by 11ß-hydroxysteroid dehydrogenase: a novel determinant of cell proliferation. FASEB J 16:36–44[Abstract/Free Full Text]
  20. WHO 1997 Obesity: preventing and managing the global epidemic: report of a WHO consultation on obesity. Geneva: WHO
  21. Tomlinson JW, Moore J, Cooper MS, Bujalska I, Shatimanesh M, Burt C, Strain A, Hewison M, Stewart PM 2001 Regulation of expression of 11ß-hydroxysteroid dehydrogenase type 1 in adipose tissue: tissue-specific induction by cytokines. Endocrinology 142:1982–1989[Abstract/Free Full Text]
  22. Zhang HH, Kumar S, Barnett AH, Eggo MC 2000 Ceiling culture of mature human adipocytes: use in studies of adipocyte functions. J Endocrinol 164:119–128[Abstract]
  23. McTernan CL, Draper N, Nicholson H, Chalder SM, Driver P, Hewison M, Kilby MD, Stewart PM 2001 Reduced placental 11ß-hydroxysteroid dehydrogenase type 2 mRNA levels in human pregnancies complicated by intrauterine growth restriction: an analysis of possible mechanisms. J Clin Endocrinol Metab 86:4979–4983[Abstract/Free Full Text]
  24. Dunkleman SS, Fairhurst B, Plager J, Waterhouse C 1964 Cortisol metabolism in obesity. J Clin Endocrinol Metab 24:832–841
  25. Marin P, Darin N, Amemiya T, Andersson B, Jern S, Bjorntorp P 1992 Cortisol secretion in relation to body fat distribution in obese premenopausal women. Metabolism 41:882–886[CrossRef][Medline]
  26. Hauner H, Schmid P, Pfeiffer EF 1987 Glucocorticoids and insulin promote the differentiation of human adipocyte precursor cells into fat cells. J Clin Endocrinol Metab 64:832–835[Abstract]
  27. Rogatsky I, Trowbridge JM, Garabedian MJ 1997 Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms. Mol Cell Biol 17:3181–3193[Abstract]
  28. Kotelevtsev Y, Holmes MC, Burchell A, et al 1997 11ß-Hydroxysteroid dehydrogenase type 1 knockout mice show attenuated glucocorticoid-inducible responses and resist hyperglycemia on obesity or stress. Proc Natl Acad Sci USA 94:14924–14929[Abstract/Free Full Text]
  29. Jamieson A, Wallace AM, Andrew R, Nunez BS, Walker BR, Fraser R, White PC, Connell JM 1999 Apparent cortisone reductase deficiency: a functional defect in 11ß-hydroxysteroid dehydrogenase type 1. J Clin Endocrinol Metab 84:3570–3574[Abstract/Free Full Text]
  30. Laing I, Adams JE, Wood PJ, Taylor NF, Ray DW, Cortisone reductase deficiency (11ß-hydroxysteroid dehydrogenase type 1) deficiency presenting with features of late onset congenital adrenal hyperplasia [Abstract P264]. 21st Joint Meeting of the British Endocrine Societies, Harrogate, UK, 2002
  31. Phillipov G, Palermo M, Shackleton CH 1996 Apparent cortisone reductase deficiency: a unique form of hypercortisolism. J Clin Endocrinol Metab 81:3855–3860[Abstract/Free Full Text]
  32. Biason-Lauber A, Suter SL, Shackleton CH, Zachmann M 2000 Apparent cortisone reductase deficiency: a rare cause of hyperandrogenemia and hypercortisolism. Horm Res 53:260–266[CrossRef][Medline]
  33. Taylor N, Bartlett WA, Dawson DJ 1984 Cortisone reductase deficiency: evidence for a new inborn error in metabolism of adrenal steroids. J Endocrinol 102S:89
  34. Savage MW, Barton RN, Doman TL, Horan MA, Robins AK, Taylor N 1991 Increased metabolic clearance of cortisol in corticosteroid 11-reductase deficiency. J Endocrinol 129S:219
  35. Katz JR, Mohamed-Ali V, Wood PJ, Yudkin JS, Coppack SW 1999 An in vivo study of the cortisol-cortisone shuttle in subcutaneous abdominal adipose tissue. Clin Endocrinol (Oxf) 50:63–68[CrossRef][Medline]
  36. Hauner H, Entenmann G 1991 Regional variation of adipose differentiation in cultured stromal-vascular cells from the abdominal and femoral adipose tissue of obese women. Int J Obes 15:121–126[Medline]
  37. Hauner H, Wabitsch M, Pfeiffer EF 1988 Differentiation of adipocyte precursor cells from obese and non-obese adult women and from different adipose tissue sites. Horm Metab Res 19(Suppl):35–39



This article has been cited by other articles:


Home page
FASEB J.Home page
K. Yang, H. Guan, E. Arany, D. J. Hill, and X. Cao
Neuropeptide Y is produced in visceral adipose tissue and promotes proliferation of adipocyte precursor cells via the Y1 receptor
FASEB J, July 1, 2008; 22(7): 2452 - 2464.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
D. P Macfarlane, S. Forbes, and B. R Walker
Glucocorticoids and fatty acid metabolism in humans: fuelling fat redistribution in the metabolic syndrome
J. Endocrinol., May 1, 2008; 197(2): 189 - 204.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
I J Bujalska, L L Gathercole, J W Tomlinson, C Darimont, J Ermolieff, A N Fanjul, P A Rejto, and P M Stewart
A novel selective 11{beta}-hydroxysteroid dehydrogenase type 1 inhibitor prevents human adipogenesis
J. Endocrinol., May 1, 2008; 197(2): 297 - 307.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
I. J. Bujalska, K. N. Hewitt, D. Hauton, G. G. Lavery, J. W. Tomlinson, E. A. Walker, and P. M. Stewart
Lack of Hexose-6-Phosphate Dehydrogenase Impairs Lipid Mobilization from Mouse Adipose Tissue
Endocrinology, May 1, 2008; 149(5): 2584 - 2591.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. Chan, E. H Rabbitt, B. A Innes, J. N Bulmer, P. M Stewart, M. D Kilby, and M. Hewison
Glucocorticoid-induced apoptosis in human decidua: a novel role for 11{beta}-hydroxysteroid dehydrogenase in late gestation
J. Endocrinol., October 1, 2007; 195(1): 7 - 15.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S. Wiegand, A. Richardt, T. Remer, S. A Wudy, J. W Tomlinson, B. Hughes, A. Gruters, P. M Stewart, C. J Strasburger, and M. Quinkler
Reduced 11{beta}-hydroxysteroid dehydrogenase type 1 activity in obese boys
Eur. J. Endocrinol., September 1, 2007; 157(3): 319 - 324.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. W. Tomlinson, M. Sherlock, B. Hughes, S. V. Hughes, F. Kilvington, W. Bartlett, R. Courtney, P. Rejto, W. Carley, and P. M. Stewart
Inhibition of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Activity in Vivo Limits Glucocorticoid Exposure to Human Adipose Tissue and Decreases Lipolysis
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 857 - 864.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
D. Qi and B. Rodrigues
Glucocorticoids produce whole body insulin resistance with changes in cardiac metabolism
Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E654 - E667.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
I. J Bujalska, O. M Durrani, J. Abbott, C. U Onyimba, P. Khosla, A. H Moosavi, T. T Q Reuser, P. M Stewart, J. W Tomlinson, E. A Walker, et al.
Characterisation of 11{beta}-hydroxysteroid dehydrogenase 1 in human orbital adipose tissue: a comparison with subcutaneous and omental fat
J. Endocrinol., February 1, 2007; 192(2): 279 - 288.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
V. Achard, S. Boullu-Ciocca, R. Desbriere, G. Nguyen, and M. Grino
Renin receptor expression in human adipose tissue
Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2007; 292(1): R274 - R282.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
B. R WALKER and R. ANDREW
Tissue Production of Cortisol by 11beta-Hydroxysteroid Dehydrogenase Type 1 and Metabolic Disease
Ann. N.Y. Acad. Sci., November 1, 2006; 1083(1): 165 - 184.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
R. Basu, D. S. Edgerton, R. J. Singh, A. Cherrington, and R. A. Rizza
Splanchnic Cortisol Production in Dogs Occurs Primarily in the Liver: Evidence for Substantial Hepatic Specific 11{beta} Hydroxysteroid Dehydrogenase Type 1 Activity
Diabetes, November 1, 2006; 55(11): 3013 - 3019.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
B. Mariniello, V. Ronconi, S. Rilli, P. Bernante, M. Boscaro, F. Mantero, and G. Giacchetti
Adipose tissue 11{beta}-hydroxysteroid dehydrogenase type 1 expression in obesity and Cushing's syndrome
Eur. J. Endocrinol., September 1, 2006; 155(3): 435 - 441.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. K. Paulsen, S. B. Pedersen, J. O. L. Jorgensen, S. Fisker, J. S. Christiansen, A. Flyvbjerg, and B. Richelsen
Growth Hormone (GH) Substitution in GH-Deficient Patients Inhibits 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Messenger Ribonucleic Acid Expression in Adipose Tissue
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1093 - 1098.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
H. A Sigurjonsdottir, J. Koranyi, M. Axelson, B.-A. Bengtsson, and G. Johannsson
GH effect on enzyme activity of 11{beta}HSD in abdominal obesity is dependent on treatment duration
Eur. J. Endocrinol., January 1, 2006; 154(1): 69 - 74.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
N. M. Morton, V. Densmore, M. Wamil, L. Ramage, K. Nichol, L. Bunger, J. R. Seckl, and C. J. Kenyon
A Polygenic Model of the Metabolic Syndrome With Reduced Circulating and Intra-Adipose Glucocorticoid Action
Diabetes, December 1, 2005; 54(12): 3371 - 3378.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
A. Hermanowski-Vosatka, J. M. Balkovec, K. Cheng, H. Y. Chen, M. Hernandez, G. C. Koo, C. B. Le Grand, Z. Li, J. M. Metzger, S. S. Mundt, et al.
11{beta}-HSD1 inhibition ameliorates metabolic syndrome and prevents progression of atherosclerosis in mice
J. Exp. Med., August 15, 2005; 202(4): 517 - 527.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
N. Draper and P. M Stewart
11{beta}-Hydroxysteroid dehydrogenase and the pre-receptor regulation of corticosteroid hormone action
J. Endocrinol., August 1, 2005; 186(2): 251 - 271.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Basu, R. J. Singh, A. Basu, E. G. Chittilapilly, M. C. Johnson, G. Toffolo, C. Cobelli, and R. A. Rizza
Obesity and Type 2 Diabetes Do Not Alter Splanchnic Cortisol Production in Humans
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 3919 - 3926.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
I. J Bujalska, N. Draper, Z. Michailidou, J. W Tomlinson, P. C White, K. E Chapman, E. A Walker, and P. M Stewart
Hexose-6-phosphate dehydrogenase confers oxo-reductase activity upon 11{beta}-hydroxysteroid dehydrogenase type 1
J. Mol. Endocrinol., June 1, 2005; 34(3): 675 - 684.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. C. Sandeep, R. Andrew, N. Z.M. Homer, R. C. Andrews, K. Smith, and B. R. Walker
Increased In Vivo Regeneration of Cortisol in Adipose Tissue in Human Obesity and Effects of the 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Inhibitor Carbenoxolone
Diabetes, March 1, 2005; 54(3): 872 - 879.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. J. Drake, D. E. W. Livingstone, R. Andrew, J. R. Seckl, N. M. Morton, and B. R. Walker
Reduced Adipose Glucocorticoid Reactivation and Increased Hepatic Glucocorticoid Clearance as an Early Adaptation to High-Fat Feeding in Wistar Rats
Endocrinology, February 1, 2005; 146(2): 913 - 919.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. W. Tomlinson, E. A. Walker, I. J. Bujalska, N. Draper, G. G. Lavery, M. S. Cooper, M. Hewison, and P. M. Stewart
11{beta}-Hydroxysteroid Dehydrogenase Type 1: A Tissue-Specific Regulator of Glucocorticoid Response
Endocr. Rev., October 1, 2004; 25(5): 831 - 866.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Kannisto, K. H. Pietilainen, E. Ehrenborg, A. Rissanen, J. Kaprio, A. Hamsten, and H. Yki-Jarvinen
Overexpression of 11{beta}-Hydroxysteroid Dehydrogenase-1 in Adipose Tissue Is Associated with Acquired Obesity and Features of Insulin Resistance: Studies in Young Adult Monozygotic Twins
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4414 - 4421.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Valsamakis, A. Anwar, J. W. Tomlinson, C. H. L. Shackleton, P. G. McTernan, R. Chetty, P. J. Wood, A. K. Banerjee, G. Holder, A. H. Barnett, et al.
11{beta}-Hydroxysteroid Dehydrogenase Type 1 Activity in Lean and Obese Males with Type 2 Diabetes Mellitus
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4755 - 4761.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. W. Tomlinson, J. S. Moore, P. M. S. Clark, G. Holder, L. Shakespeare, and P. M. Stewart
Weight Loss Increases 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Expression in Human Adipose Tissue
J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2711 - 2716.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
N. M. Morton, L. Ramage, and J. R. Seckl
Down-Regulation of Adipose 11{beta}-Hydroxysteroid Dehydrogenase Type 1 by High-Fat Feeding in Mice: A Potential Adaptive Mechanism Counteracting Metabolic Disease
Endocrinology, June 1, 2004; 145(6): 2707 - 2712.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. M. Paterson, N. M. Morton, C. Fievet, C. J. Kenyon, M. C. Holmes, B. Staels, J. R. Seckl, and J. J. Mullins
Metabolic syndrome without obesity: Hepatic overexpression of 11{beta}-hydroxysteroid dehydrogenase type 1 in transgenic mice
PNAS, May 4, 2004; 101(18): 7088 - 7093.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
N. M. Morton, J. M. Paterson, H. Masuzaki, M. C. Holmes, B. Staels, C. Fievet, B. R. Walker, J. S. Flier, J. J. Mullins, and J. R. Seckl
Novel Adipose Tissue-Mediated Resistance to Diet-Induced Visceral Obesity in 11{beta}-Hydroxysteroid Dehydrogenase Type 1-Deficient Mice
Diabetes, April 1, 2004; 53(4): 931 - 938.
[Abstract] [Full Text] [PDF]


Home page
Recent Prog Horm ResHome page
J. R. Seckl, N. M. Morton, K. E. Chapman, and B. R. Walker
Glucocorticoids and 11beta-Hydroxysteroid Dehydrogenase in Adipose Tissue
Recent Prog. Horm. Res., January 1, 2004; 59(1): 359 - 393.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Westerbacka, H. Yki-Jarvinen, S. Vehkavaara, A.-M. Hakkinen, R. Andrew, D. J. Wake, J. R. Seckl, and B. R. Walker
Body Fat Distribution and Cortisol Metabolism in Healthy Men: Enhanced 5{beta}-Reductase and Lower Cortisol/Cortisone Metabolite Ratios in Men with Fatty Liver
J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 4924 - 4931.
[Abstract] [Full Text]