| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Article |
Departments of Obstetrics and Gynecology (M.Z., F.H., S.K.-S., K.M., U.L.) and Biochemistry (K.T.P.), Justus Liebig University, D-35385 Giessen, Germany; Institute for Lasertechnologies, University of Ulm (K.K.-R.), D-89081 Ulm, Germany; and Department of Obstetrics and Gynecology, University of Louisville (C.V.R.), Louisville, Kentucky 40292
Address all correspondence and requests for reprints to: Dr. Marek Zygmunt, Department of Obstetrics and Gynecology, Justus Liebig University, Klinikstrasse 32, D-35385 Giessen, Germany. E-mail: marek.t. zygmunt{at}gyn.med.uni-giessen.de.
Abstract
Angiogenesis and vascular remodeling are crucial processes in tumor invasion and metastasis as well as in embryo implantation and normal development of the placenta. We have previously shown that hCG expressed in trophoblast and various malignant tumors promotes cellular motility and that uterine endothelium expresses hCG/LH receptor in vivo. In this study hCG was proposed to promote angiogenesis. A three-dimensional in vitro angiogenesis system consisting of uterine microvascular endothelial cells seeded on microcarriers and entrapped in a fibrin matrix was used to study the influence of hCG on neovascularization. Physiological concentrations of hCG (5–50,000 mU/ml) significantly increased in vitro capillary formation (up to 2.5-fold) and migration of endothelial cells in a Boyden chamber assay (up to 3.6-fold) in a dose-dependent manner, whereas hCG had no effect on cell proliferation. In vivo, hCG induced neovascularization in the chicken chorioallantoic membrane assay comparable to the activity of vascular endothelial growth factor. hCG-secreting tumors (choriocarcinoma, endometrium, and ovarian carcinoma) promoted in vitro neovascularization (up to 3-fold), whereas hCG-neutralizing antibody, pertussis toxin (G protein inhibitor), or GRGDTP peptide (integrin antagonist), respectively, abolished both tumor- and hCG-induced capillary sprout formation. Our data indicate a novel function for hCG in uterine adaptation to early pregnancy as well as in tumor development and underline the importance of hCG as an as yet unrecognized angiogenic factor.
AN ADEQUATE NUTRIENT and substrate supply is essential for normal intrauterine development of the fetus. Disturbances in uterine blood supply are associated with higher perinatal morbidity and mortality caused by preterm delivery, preeclampsia, or intrauterine growth restriction. Adaptation of the uterine vasculature to the rising needs of the fetus occurs through both vasodilation and development of new vessels. Angiogenesis is the process of neovascularization from preexisting blood vessels in response to hypoxia or substrate demands of tissues and plays an important role in pregnancy-associated changes in the reproductive tract. The endometrium, decidua, and placenta are rich sources of angiogenic growth factors (1, 2, 3, 4).
In general, the angiogenic process is initiated by growth factors such as basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF), or placental growth factor. Through a complex signal transduction machinery mediated by respective receptor-tyrosine kinases, an increase in the permeability of the maternal vessels is achieved to permit growth and invasion of endothelial cells. Their chemotactic migration, formation of a vessel lumen, and functional maturation of new capillaries complete the angiogenic process that involves the expression of specific adhesion receptors and extracellular matrix-degrading proteases (collagenases and plasminogen activators) (2, 3, 5). As the angiogenic phenotype of proliferating and migrating endothelial cells is characterized (among others) by the expression of these components together with tissue factor or endoglin, these molecules could be useful as diagnostic markers. Moreover, functional blockage of, for instance, 
v-integrins or matrix metalloproteinases by high affinity antagonists resulted in effective inhibition of neovascularization as a potential therapeutic regimen (6, 7).
Our recent studies indicated that hCG secreted by trophoblast as well as by several malignant tumors (e.g. testicular, breast and ovarian cancer, adenocarcinoma of endometrium, and some pancreatic and gastric tumors), in addition to its function in the regulation of steroidogenesis during early gestation, promotes trophoblast cell motility (8). We also demonstrated previously that hCG/LH receptors are abundantly expressed in uterine endothelial cells (9, 10), implicating a possible functional responsiveness of these cells to hCG. These observations prompted us to investigate the possible role of hCG as angiogenic factor. Our results indicate for the first time that this hormonal factor of trophoblastic origin as well as derived from tumor cells promotes angiogenesis by stimulating the migration and capillary sprout formation of uterine endothelial cells.
Materials and Methods
In vitro angiogenesis assay
Human uterine microvascular endothelial cells (UMVEC; BioWhittaker, Inc., Verviers, Belgium) were isolated using mechanical and enzymatic methods and grown on the selection medium as indicated by the provider (11, 12, 13). They displayed cobblestone morphology and were characterized using anti-CD31, anti-von Willebrand factor, Ulex europaeus antigen-1, and integrin 6 antibodies (DAKO Corp., Hamburg, Germany). In cultures of UMVEC the expression of hCG/LH receptor was documented both by immunostaining using polyclonal antibody as well as by demonstrating hCG/LH receptor mRNA transcripts using RT-PCR. Microcarriers (MC; Sigma, Deisenhofen, Germany) were washed three times with DMEM (Life Technologies, Inc., Karlsruhe, Germany) and coated with UMVEC to a final concentration of about 30 cells/MC. The coated MCs were cultivated in endothelial cell growth medium (BioWhittaker, Inc.) at 37 C in 5% CO2 for 1–2 d before they were imbedded into a fibrin gel according to a recent protocol (14). Fibrinogen (Sigma) was dissolved in PBS (pH 7.1; 1.5–2.5 mg/ml) and filled into a 12-well plate (0.6 ml/well). Cell-coated MCs (
100 MC/well) and thrombin (0.65 U/ml; Sigma) were added to initiate fibrin polymerization. Gels were equilibrated for 1 h at 37 C in 5% CO2 and covered with 1 ml/well MCDB 131 medium (C.C. Pro, Neustadt/W, Germany). In comparison with other matrexes composed of collagen type I and type IV or Matrigel, capillary formation in fibrin gel was found to be the optimal support for the sprouting angiogenesis assay. Each of the following test substances (final concentrations) was added to the medium: recombinant hCG (5–50,000 mU/ml, 10,000 mU/µg; Sigma), recombinant human bFGF (5–100 ng/ml; Promo Cell, Heidelberg, Germany), VEGF (10–100 ng/ml; R\|[amp ]\|D Systems, Inc., Wiesbaden, Germany), dibuturyl cAMP (db cAMP; 0.1–1 µmol/liter), forskolin (1–10 µmol/liter), phorbol ester (1–10 nmol/liter), pertussis toxin (G protein inhibitor, 0.1–100 ng/ml; all purchased from Sigma), protein kinase A (PKA) and protein kinase C (PKC) inhibitory peptides (0–200 nM; Calbiochem, San Diego, CA), and GRGDTP peptide (0–10 µg/ml; Sigma). The peptide GRGDTP (Gly-Arg-Gly-Asp-Thr-Pro) is a broad specificity antiadhesive peptide that inhibits attachment to type I collagen, fibronectin, and vitronectin (15). Neutralizing polyclonal goat anti-hCG antibodies (diluted 1:25 to 1:500; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and heat-inactivated recombinant hCG were used as controls in this assay. Test substances were shown to diffuse easily into the gel, reaching uniform concentrations as established in preliminary tests.
After 1–4 d of incubation, overnight fixation in 3% paraformaldehyde, and staining with 0.5% crystal violet (Merck \|[amp ]\| Co., Inc., Darmstadt, Germany) for 30 min, the number of sprouts migrating into the fibrin gel was quantified in eight separate microscopic fields. All assays were repeated at least three times, and four wells were used for every treatment condition. Sprout formation was quantified in eight microscopic fields per well. The numbers of microcarriers and sprouts were counted, and results were expressed as the number of sprouts per MC. To be counted as a sprout the minimal length of the tubular structures had to be at least as long as the MC diameter. Only capillary-like structures composed of at least three connected endothelial cells were included in the quantification.
Tumor-induced angiogenesis
Endothelial cell-coated MCs imbedded into fibrin (as described above) were cocultured with either choriocarcinoma (JEG-3, HTB-36, American Type Culture Collection, Manassas, VA), ovarian (Ovcar-3, HTB-161, American Type Culture Collection), or endometrium carcinoma cells (from tumor explants) on top of the fibrin gel. Tumor cells were cultivated in RPMI 1640 or MEM supplemented with 10% fetal calf serum and 2 mM-glutamine (Life Technologies, Inc.) at 37 C in 5% CO2 before they were used in the coculture system. All cells from these three tumors were shown to secret significant amounts of hCG in preliminary experiments (concentrations ranging from 5–250 mU/ml in conditioned medium). After equilibration of the coculture system in serum-free medium for 12 h, either buffer alone or different concentrations of polyclonal hCG-neutralizing antibodies (dilution, 1:25–1:500) or irrelevant anti-CD45 antiserum (dilution, 1:25–1:500; DAKO Corp.) were added to the culture. In addition, serum-free tumor-conditioned medium (48 h) were tested to induce capillary sprouting. The angiogenic response was quantified as described above.
Chicken chorioallantoic membrane (CAM) assay
The CAM assay (16) was used to determine the effect of hCG on angiogenesis in vivo according to a previously published protocol (17). Fertilized chicken eggs were incubated at 37.8 C in a humidified incubator (60% relative humidity) and were prepared for implantation on d 4 of incubation. Eggs were fumigated and washed with warm ethanol, and a hole was drilled through the pointed pole of each egg shell. On the following day part of the CAM was exposed by peeling a round window (2 cm in diameter) and covered with a tape. On d 8 of incubation up to three silicone rings with a thickness of 0.5 mm and an inner diameter of 6 mm were placed on each membrane. On d 9 20 µl of each of the following samples was administered into the rings: hCG solution (50, 200, and 500 IU), VEGF (100 ng/ml), and polyclonal goat anti-hCG antibody (dilution, 1:2–1:10; DAKO Corp.), alone and together with hCG as well as buffer alone. The shell windows were covered again, and the eggs were incubated for another 3 d. Vascular growth in the ring fields and viability of the embryo were documented daily by video microscopy at different magnifications (x10 and x25). Five CAMs were studied for each test group, and the experiments were repeated at least three times. The form and number of branching blood vessels growing within the ring fields were documented. Quantification was performed using MetaMorph Imaging and Analysis System (Universal Imaging Corp., Downingtown, PA). Equal sized quarters (four per ring) were subject to color recognition and integral analysis. The proportion of the area occupied by blood vessels (red) was assessed, and the vascularity index (VI; defined as B - A/A, where A is vascular density before stimulation, and B is vascular density after incubation with test substances) was compared between treatment groups.
Migration assay
Uncoated porous filters (8 µm in diameter) in a 24-well Boyden chamber (BD Biosciences, Heidelberg, Germany) were used to test the migration of UMVEC. A total of 5 x 104 cells in MCDB 131 medium were added to the upper chamber of each insert and equilibrated in the absence of serum for 12 h. Different hCG concentrations (50–50,000 mU/ml) were added to the lower compartment, and the system was incubated for 24–36 h at 37 C in 5% CO2, followed by fixation. Nonmigrating cells on the upper side were removed with a cotton swab. The filters were stained with hematoxylin and eosin and examined microscopically for the presence of migrated cells on the lower side of the membrane. The number of cells in eight microscopic fields was counted, and the mean of three wells was determined (18).
Cell proliferation assay
A colorimetric nonradioactive assay was used for the quantification of cell proliferation and viability, based on the cleavage of tetrazolium salt 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate by mitochondrial dehydrogenases (Roche Molecular Biochemicals, Mannheim, Germany). After incubation of cultured UMVEC in 96-well microtiter plates together with different hCG concentrations (5–50,000 mU/ml), db cAMP (0.1–1 µmol/liter), phorbol ester (1–10 µmol/liter), VEGF (10–100 ng/ml), or bFGF (10–30 ng/ml), respectively, 10 µl/well cell proliferation reagent 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate were added to each well and incubated for 2 h. Absorbance was measured using a microtiter plate reader at wavelengths of 450 and 650 nm and was compared with a standard curve (18).
RT-PCR for hCG/LH receptor
RNA from UMVEC was extracted using the guanidine thiocyanate/cesium chloride method (19). One microgram of total RNA was reverse transcribed at 43 C for 1 h using SuperScript II reverse transcriptase. hCG/LH receptor DNA was amplified using 2 µl of the RT solution, 2 µl each of 3' (GGAATTCGGGGCAACATAGCAATTAGAGAAG) and 5' (CGCGGATCCACCCC GATGTGCTCCTGAACC) primers corresponding to the published sequence of the hCG/LH receptor cDNA (1028–1512 bp) (20), and 2 µl deoxy-NTP mixture, 5 µl 10x PCR buffer, 2.5 µl MgCl2, and 0.5 µl Taq DNA polymerase (total reaction volume, 50 µl; all chemicals purchased from Life Technologies, Inc.). PCR was performed for 35 cycles at 94 C for 3 min (denaturation), at 61 C for 30 sec (annealing), and at 72 C for 1 min (extension) using a GeneAmp PCR System (Perkin-Elmer, Palo Alto, CA). Analysis of the 484-bp product was performed by electrophoresis in 2% agarose gel. Human placental total RNA served as a positive control. We used water as a negative control for the RT-PCR.
Immunocytochemistry
Immunocytochemistry was performed by the avidin immunoperoxidase method using a 1:500 dilution of polyclonal LH/hCG receptor antibody raised against a synthetic N-terminal amino acid sequence 15–38 (10, 21). For the control, receptor antibody was preabsorbed with excess receptor peptide, or unabsorbed receptor antibody was replaced with nonspecific IgG. The controls showed no immunostaining.
Statistical analysis
All values are shown as the mean ± SEM. Statistical significance (P < 0.05) was determined by ANOVA, followed by assessment of differences using Dunnett’s two-sided test or Tukey’s test (Department of Medical Statistics and Biomathematics, Justus Liebig University, Giessen, Germany).
Results
Angiogenic response of UMVEC to hCG
A three-dimensional in vitro angiogenesis system with MC-coated UMVEC was used to study the role of hCG in capillary sprout formation. Incubation of UMVEC with physiological concentrations of hCG (5–50,000 mU/ml) resulted in a biphasic concentration-dependent mode of capillary formation. Although low concentrations of hCG (5–50 mU/ml) mediated a reproducible, but nonsignificant (P > 0.05), decrease in the number of capillaries, the addition of higher hCG concentrations (500–50,000 mU/ml) caused a significant (up to 2.5-fold; P < 0.01) increase in the number of induced sprouts compared with nontreated cells (Figs. 1
and 2). When denatured hCG was added to the system no increase in the number of capillary-like structures was seen (not shown), whereas anti-hCG antibody, pertussis toxin (0.1–10 ng/ml), or GRGDTP peptide abolished hCG-induced capillary formation (Fig. 3). The increase in the number of capillary-like structures after treatment with 50,000 mU/ml hCG was comparable to the response to 10 ng/ml bFGF or 10 ng/ml VEGF, respectively (Fig. 2). Treatment of UMVEC with 10 nmol/liter of the PKC activator phorbol ester, but not with db cAMP (1–10 mmol/liter; PKA inducer), mimicked the effects of hCG on capillary formation, whereas addition of the PKC inhibitory, but not the PKA inhibitory, peptide abolished hCG-induced sprout formation (Fig. 3).
|
|
|
The angiogenic activity of hCG in vivo was investigated using a modified assay in which the substance to be analyzed was placed into the inner volume of a silicone ring on the top of the CAM. Different concentrations of hCG as well as VEGF promoted a higher number and branching of new vessels within the ring fields compared with buffer alone (Fig. 4). There was a significant (P < 0.05) increase in the VI after incubation with hCG (VI = 0.67; SD = 0.018) or VEGF (VI = 0.71; SD = 0.017) compared with controls (VI = 0.48; SD = 0.05).
|
To study the mechanism by which hCG caused capillary sprout formation, migration of UMVEC in response to hCG was analyzed in a modified Boyden chamber assay. As shown in Fig. 5, physiological concentrations of hCG significantly increased UMVEC migration (up to 3.6-fold) in vitro. In comparison, VEGF increased the migration of UMVEC by 6-fold during the same incubation period.
|
As the proliferation of endothelial cells is an important event in neovascularization, the proliferative response of UMVEC to hCG was tested. Even at very high doses (50,000 mU/ml) hCG had no effect on the proliferation of these endothelial cells, whereas UMVEC responded to VEGF and bFGF with increased cell proliferation (up to 125% and 140% compared with the control).
Contribution of hCG to tumor-induced angiogenesis
To evaluate the possibility that the paracrine action of hCG-secreting tumor cells contributes to capillary sprout formation in the in vitro angiogenesis model, choriocarcinoma cells (JEG-3) or ovarian (Ovcar) or endometrium carcinoma explants were cocultured on top of the MC-containing fibrin gel. There was a significant increase in the number of capillary sprouts induced by these tumor cells (Fig. 6): The strongest induction was seen in response to coculture with ovarian carcinoma cells (up to 3.4-fold increase), followed by choriocarcinoma (up to 1.8-fold increase) and endometrium carcinoma cells (up to 1.5-fold increase). This strong angiogenic response was inhibited by hCG-neutralizing antibody in endometrium carcinoma explants and the JEG-3 cell line, but not by a control antibody (anti-CD45 polyclonal antibody). Also, tumor-conditioned medium induced capillary formation in vitro (data not shown).
|
Due to a high demand for increased blood supply during pregnancy, the vasculature of the uterus and the surrounding tissue undergoes three main adaptive changes: vasodilation, increased permeability, and development and maturation of new vessels (2, 3, 22, 23). Based on the comparison of nulliparae and nonpregnant multiparae as well as multiparae in the first month of pregnancy, a permanent angiogenic change in the uterine vasculature during pregnancy was proposed (22, 23, 24) that appeared to be related to a specific factor of trophoblast origin (25). To identify respective angiogenic factors within the feto-maternal interface, we focused in the present study on hCG, a major trophoblastic peptide hormone that is responsible for numerous pregnancy-related and pregnancy-maintaining processes and that exhibits a dramatically increasing plasma concentration during the first trimester (ranging from 1,000 mU/ml at 5 wk gestation to 150,000 mU/ml at 12 wk gestation) (23, 26, 27). Previous studies from our laboratories, using in situ hybridization and immunocytochemistry techniques, revealed that hCG/LH receptors are present in endothelium and smooth muscle of uterine blood vessels in vivo and that their expression level is significantly increased in the intramyometrial segment (9, 10). In addition, the fact that hCG/LH receptors are up-regulated by progesterone in the second phase of the menstrual cycle strongly indicated a role for the hCG-hCG/LH receptor complex in uterine adaptation during implantation and placentation (21).
Here we demonstrated for the first time that hCG has a direct angiogenic function on hCG/LH receptor-expressing uterine endothelial cells that responded with increased capillary formation in vitro and on neovascularization in the CAM assay. These findings not only support the hypothesis that hCG may have an important regulatory role in angiogenesis and vascular function in the female reproductive tract, but also indicate that hCG could be involved in the placental vasculogenesis and angiogenesis in early stages of placental development, as high hCG concentrations were detected in fetal tissue of early pregnancy (28). In particular, capillary sprouts from authentic uterine microvascular endothelial cells were obtained upon induction by physiological doses of hCG, and bovine retinal endothelial cells responded equally well to hCG stimulation with increased capillary formation, whereas macrovascular endothelial cells derived from human umbilical vein expressing the hCG/LH receptor hardly reacted (Zygmunt, M., F. Herr, S. Keller-Schoenwetter, and K. T. Preissner, manuscript in preparation). These observations are indicative of important features that determine the spatio-temporal control of hCG-induced angiogenesis. 1) Despite the presence of hCG/LH receptor on different types of endothelial cells, microvascular cells of uterine origin appear to be a prominent target. 2) Besides the lack of expression of the hCG/LH receptor in, for instance, parametrial vessels, omentum, carotis, or aorta (9, 10), the failure of hCG to induce a response in receptor-positive cells such as HUVEC may be related to a selective down-regulation of the hCG/LH receptor by hCG, as shown for several other tissues outside the reproductive tract (29). 3) hCG/LH receptor expression might be also regulated by different cell adhesion molecules (e.g. cadherins), as was shown in corpus luteum (30), and thus depends on the adhesive contacts of the particular cells.
The responsiveness of uterine endothelial cells in vitro to hCG was confirmed in vivo, as hCG induced neovascularization in the CAM assay to a similar extent, comparable to VEGF or bFGF, and anti-hCG antibody significantly prevented angiogenesis. The absence of an additive effect of hCG together with VEGF or bFGF, respectively, indicated that these growth factors may operate through different, but converging, signaling pathways. In particular, based on the interaction of hCG with its G protein-coupled receptor (31), inhibitors of trimeric G protein complexes as well as a PKC inhibitory peptide abolished hCG-induced angiogenesis. These observations are in accordance with previously described activities of this signaling pathway with respect to rearrangement of the actin cytoskeleton (32) or the formation of focal adhesion assembly as part of the cellular adhesion machinery (33).
As expected from previous studies in our laboratory (7), integrin antagonists such as a cyclic GRGDTP peptide blocked hCG-induced sprout formation. These data are supported by the findings that phorbol ester, as a direct PKC activator, but not db cAMP or forskolin (PKA activator), mimicked the action of hCG in the in vitro angiogenesis model. The fact that only higher hCG concentrations increased sprouting of the UMVEC also supports the proposed PKC-dependent pathway, because activation of PKC requires 100-fold higher ligand concentrations than activation of the adenylate cyclase/PKA pathway (31). Other investigators recently demonstrated that PKC plays an important role in neovascularization and survival of in vitro angiogenesis in different systems (34, 35, 36) and that PKC inhibitors decrease the angiogenic response in endothelial cells (37).
Although hCG was unable to directly induce the proliferation of UMVEC in vitro, the migration of these cells was significantly elevated by hCG, indicating a major contribution of the angiogenic factor to cellular motility. These data strongly argue in favor of an important influence of hCG in mediating the induction of uterine angiogenesis during the first trimester in pregnancy, where levels of hCG are reached that were found to be effective in this study. Besides this direct angiogenic activity, hCG can induce the expression of other angiogenic factors, such as VEGF, in macrophages, thereby indirectly contributing to neovascularization as well (Zygmunt, M., et al., unpublished observations). There is also evidence that hCG has strong vasodilatory actions on uterine arteries in pregnant and nonpregnant rats (38) as well as on the human ovarian vasculature (39), that hCG administration to induce ovulation resulted in an increase in uterine blood flow (10), and that hCG leads to an increase in vascular permeability, as seen in cases of ovarian hyperstimulation in the course of assisted reproduction (40). Together, these activities of hCG may very well add to its overall here- described function as a potent angiogenic stimulus in the feto-maternal unit.
Based on the fact that hCG is secreted by a broad spectrum of genital and nongenital solid tumors (e.g. testicular, ovarian, and endometrial cancer, and gastric and pancreatic carcinoma) (41, 42), tumor cell-derived hCG was found to be similar, if not identical, in its activity to promote in vitro sprouting angiogenesis, and anti-hCG antibodies inhibited this function to an appreciable degree. Although hCG concentrations in tumor-conditioned medium were lower than those of exogenously added hCG, additional angio-regulatory factors may be responsible for the differences in the angiogenic response between isolated and tumor cell- derived hCG. Due to the striking similarities in the molecular mechanism of physiological angiogenesis as related to blastocyst implantation/placental development and tumor- associated angiogenesis, further studies need to define the involved molecules and to differentiate signaling pathways. In particular, recent studies have shown that hCG may be involved in tumor development via suppression of apoptosis, because Fas, Fas ligand, Bax, and p53 were found to be down-regulated in response to hCG (43, 44). The angiogenic function of hCG could very well be associated with a suppression of apoptosis in endothelial cells. Indeed, clinical studies showed a strong correlation between high expression levels of hCG and microvessel density in distinct cancers as well as a stimulatory action of hCG on the invasiveness of several cell lines (8, 45), indicating that the described angiogenic effect may also facilitate dissemination of hCG- expressing tumor cells (46). As anti-hCG antibodies inhibited the angiogenic activity of hCG-secreting tumor cells as shown here, and injection of anti-hCG antibodies induced tumor necrosis in nude mice (47), our current results not only underline the specificity of this novel function of hCG, but hCG antagonists could serve as a potential approach for angiostatic therapy.
Acknowledgments
We thank Bettina Gill, Delfina Mazzuca, and Uwe Schubert for their skillful technical assistance.
Footnotes
This work was supported by grants from the German Research Council (to M.Z.), the Wilhelm Sander Foundation (to K.T.P.), and the NIH (to C.V.R.).
F.H. and S.K.-S. contributed equally to this article.
Abbreviations: bFGF, Basic fibroblast growth factor; CAM, chicken chorioallantoic membrane; db cAMP, dibuturyl cAMP; HUVEC, human umbilical vein endothelial cells; MC, microcarrier; PKA, protein kinase A; PKC, protein kinase C; GRGDTP, synthetic peptide Gly-Arg-Gly-Asp-Thr-Pro; UMVEC, uterine microvascular endothelial cells; VEGF, vascular endothelial growth factor; VI, vascularity index.
Received April 25, 2002.
Accepted August 7, 2002.
References
vß3 for angiogenesis. Science 264:569–571This article has been cited by other articles:
 |
|
 |
|
  S. Berndt, S. Blacher, S. Perrier d'Hauterive, M. Thiry, M. Tsampalas, A. Cruz, C. Pequeux, S. Lorquet, C. Munaut, A. Noel, et al. Chorionic Gonadotropin Stimulation of Angiogenesis and Pericyte Recruitment J. Clin. Endocrinol. Metab., November 1, 2009; 94(11): 4567 - 4574. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Zimmermann, W. Ackermann, and H. Alexander Epithelial Human Chorionic Gonadotropin Is Expressed and Produced in Human Secretory Endometrium During the Normal Menstrual Cycle Biol Reprod, May 1, 2009; 80(5): 1053 - 1065. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Plaisier, I. Dennert, E. Rost, P. Koolwijk, V.W.M. van Hinsbergh, and F.M. Helmerhorst Decidual vascularization and the expression of angiogenic growth factors and proteases in first trimester spontaneous abortions Hum. Reprod., January 1, 2009; 24(1): 185 - 197. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. W. Warrenfeltz, S. A. Lott, T. M. Palmer, J. C. Gray, and D. Puett Luteinizing Hormone-Induced Up-Regulation of ErbB-2 Is Insufficient Stimulant of Growth and Invasion in Ovarian Cancer Cells Mol. Cancer Res., November 1, 2008; 6(11): 1775 - 1785. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L Ranganath, W Taylor, L John, and Z Alfirevic Biochemical diagnosis of placental infarction/damage: acutely rising alkaline phosphatase Ann Clin Biochem, May 1, 2008; 45(3): 335 - 338. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Prast, L. Saleh, H. Husslein, S. Sonderegger, H. Helmer, and M. Knofler Human Chorionic Gonadotropin Stimulates Trophoblast Invasion through Extracellularly Regulated Kinase and AKT Signaling Endocrinology, March 1, 2008; 149(3): 979 - 987. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Rull, P. Hallast, L. Uuskula, J. Jackson, M. Punab, A. Salumets, R.K. Campbell, and M. Laan Fine-scale quantification of HCG beta gene transcription in human trophoblastic and non-malignant non-trophoblastic tissues Mol. Hum. Reprod., January 1, 2008; 14(1): 23 - 31. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Fluhr, S. Krenzer, G. M. Stein, B. Stork, M. Deperschmidt, D. Wallwiener, S. Wesselborg, M. Zygmunt, and P. Licht Interferon-{gamma} and tumor necrosis factor-{alpha} sensitize primarily resistant human endometrial stromal cells to Fas-mediated apoptosis J. Cell Sci., December 1, 2007; 120(23): 4126 - 4133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Herrmann-Lavoie, C. V. Rao, and A. Akoum Chorionic Gonadotropin Down-Regulates the Expression of the Decoy Inhibitory Interleukin 1 Receptor Type II in Human Endometrial Epithelial Cells Endocrinology, November 1, 2007; 148(11): 5377 - 5384. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Dos Santos, M.-N. Dieudonne, M.-C. Leneveu, R. Pecquery, V. Serazin, and Y. Giudicelli In vitro effects of chorionic gonadotropin hormone on human adipose development J. Endocrinol., August 1, 2007; 194(2): 313 - 325. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-H. Choi, A. S. T. Wong, H.-F. Huang, and P. C. K. Leung Gonadotropins and Ovarian Cancer Endocr. Rev., June 1, 2007; 28(4): 440 - 461. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C.K. Leung and J.-H. Choi Endocrine signaling in ovarian surface epithelium and cancer Hum. Reprod. Update, March 1, 2007; 13(2): 143 - 162. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Berndt, S. P. d'Hauterive, S. Blacher, C. Pequeux, S. Lorquet, C. Munaut, M. Applanat, M. A. Herve, N. Lamande, P. Corvol, et al. Angiogenic activity of human chorionic gonadotropin through LH receptor activation on endothelial and epithelial cells of the endometrium FASEB J, December 1, 2006; 20(14): 2630 - 2632. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Cameo, M. Szmidt, Z. Strakova, P. Mavrogianis, K. L. Sharpe-Timms, and A. T. Fazleabas Decidualization Regulates the Expression of the Endometrial Chorionic Gonadotropin Receptor in the Primate Biol Reprod, November 1, 2006; 75(5): 681 - 689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-H. Choi, K.-C. Choi, N. Auersperg, and P. C.K. Leung Gonadotropins Activate Proteolysis and Increase Invasion through Protein Kinase A and Phosphatidylinositol 3-Kinase Pathways in Human Epithelial Ovarian Cancer Cells. Cancer Res., April 1, 2006; 66(7): 3912 - 3920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. E. Murphy, R. Smith, W. B. Giles, and V. L. Clifton Endocrine Regulation of Human Fetal Growth: The Role of the Mother, Placenta, and Fetus Endocr. Rev., April 1, 2006; 27(2): 141 - 169. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Baird, J. S. Kesner, and D. B. Dunson Luteinizing Hormone in Premenopausal Women May Stimulate Uterine Leiomyomata Development Reproductive Sciences, February 1, 2006; 13(2): 130 - 135. [Abstract] [PDF]
|
|
|
|
|
|
K. Rull and M. Laan Expression of {beta}-subunit of HCG genes during normal and failed pregnancy Hum. Reprod., December 1, 2005; 20(12): 3360 - 3368. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T R. Kumar What have we learned about gonadotropin function from gonadotropin subunit and receptor knockout mice? Reproduction, September 1, 2005; 130(3): 293 - 302. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-H. Choi, K.-C. Choi, N. Auersperg, and P. C K Leung Gonadotropins upregulate the epidermal growth factor receptor through activation of mitogen-activated protein kinases and phosphatidyl-inositol-3-kinase in human ovarian surface epithelial cells Endocr. Relat. Cancer, June 1, 2005; 12(2): 407 - 421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Akoum, C. N. Metz, and M. Morin Marked Increase in Macrophage Migration Inhibitory Factor Synthesis and Secretion in Human Endometrial Cells in Response to Human Chorionic Gonadotropin Hormone J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 2904 - 2910. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zygmunt, T. McKinnon, F. Herr, P.K. Lala, and V.K. M. Han HCG increases trophoblast migration in vitro via the insulin-like growth factor-II/mannose-6 phosphate receptor Mol. Hum. Reprod., April 1, 2005; 11(4): 261 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Fields and M. Shemesh Extragonadal Luteinizing Hormone Receptors in the Reproductive Tract of Domestic Animals Biol Reprod, November 1, 2004; 71(5): 1412 - 1418. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Knofler, L. Saleh, S. Bauer, B. Galos, H. Rotheneder, P. Husslein, and H. Helmer Transcriptional Regulation of the Human Chorionic Gonadotropin {beta} Gene during Villous Trophoblast Differentiation Endocrinology, April 1, 2004; 145(4): 1685 - 1694. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. D. Liang, T. Korff, J. Eckhardt, J. Rifaat, N. Baal, F. Herr, K. T. Preissner, and M. Zygmunt Oncodevelopmental {alpha}-Fetoprotein Acts as a Selective Proangiogenic Factor on Endothelial Cell from the Fetomaternal Unit J. Clin. Endocrinol. Metab., March 1, 2004; 89(3): 1415 - 1422. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Herr, O. D. Liang, J. Herrero, U. Lang, K. T. Preissner, V. K. M. Han, and M. Zygmunt Possible Angiogenic Roles of Insulin-Like Growth Factor II and Its Receptors in Uterine Vascular Adaptation to Pregnancy J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 4811 - 4817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Dabizzi, I. Noci, P. Borri, E. Borrani, M. Giachi, M. Balzi, G. L. Taddei, M. Marchionni, G. F. Scarselli, and A. Arcangeli Luteinizing Hormone Increases Human Endometrial Cancer Cells Invasiveness through Activation of Protein Kinase A Cancer Res., July 15, 2003; 63(14): 4281 - 4286. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. C. Lin, X. Li, Z. M. Lei, and Ch. V. Rao Human Cervix Contains Functional Luteinizing Hormone/Human Chorionic Gonadotropin Receptors J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3409 - 3414. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Y. Liu, A. K. Death, and D. J. Handelsman Androgens and Cardiovascular Disease Endocr. Rev., June 1, 2003; 24(3): 313 - 340. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
