| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
COMMENT |
Department of Histology and Embryology, Institute of Biomedical Sciences, Universidade de São Paulo, São Paulo 05508-900, SP, Brazil
Abstract
Galectin-3 is a protein of the lectin family that has been associated with neoplastic processes in various tissues. In the thyroid, expression of this protein has been described in differentiated follicular cancer, suggesting that the immunohistochemical study of galectin-3 may be a potential marker of malignancy in thyroid neoplasms. The confirmation of these results may represent an extremely useful tool for presurgical diagnosis and medical conduct. In this study, galectin-3 protein and mRNA expression were analyzed in the thyroid tissues from 87 patients with histomorphological diagnosis of multinodular goiter (MNG) (n = 24), follicular adenoma (n = 31), follicular carcinoma (n = 20), papillary carcinoma (n = 12), and five normal tissues. Galectin-3 protein expression was detected by immunohistochemical method in light, fluorescence, and confocal microscopy, using monoclonal antibody. Galectin-3 mRNA expression was detected by the RT-PCR method. Our results showed that the majority of carcinomas expressed galectin-3 protein (follicular, 90%; papillary, 100%). However, in contrast to the previously published data, benign lesions also expressed galectin-3 (adenoma, 45%; MNG, 17%). We further demonstrated by RT-PCR that thyroid tissues with diagnosis of adenoma and MNG-expressed galectin-3 mRNA. Although the galectin-3 immunostaining demonstrated a sensitivity of 93.8% in the identification of cancer, the accuracy in the distinction between benign and malignant tissues was 77.0%. This accuracy was even lower (68.6%) when the galectin-3 expression in follicular adenoma was compared with follicular carcinoma. Thus, the use of galectin-3 immunodetection as a molecular marker for thyroid carcinoma must be interpreted with caution, particularly in the differentiation between thyroid follicular carcinoma and follicular adenoma.
GALECTIN-3 IS A 30-kDa monomeric protein that has been associated to important biological processes, including malignant transformation, progression, and metastasis of tumors in different tissues (1, 2). In the latest years, the diagnostic value of the galectin-3 immunodetection in thyroid neoplasms has been widely discussed because several authors have demonstrated a correlation between galectin-3 expression and thyroid cancer (3, 4, 5, 6, 7, 8, 9, 10).
Although advances have been made in the understanding of thyroid tumorigenesis, biochemical, cytological, or molecular markers have not been effective in the clinical diagnosis of follicular lesions (11, 12). The microscopic analysis of cells obtained by the fine-needle aspiration biopsy has also proved difficult (13). Thus, the immunohistochemical analysis of galectin-3 might be an important tool for diagnostic definition, as stated by several authors (3, 7, 8, 9, 14). The confirmation that galectin-3 expression is restricted to thyroid cancer is extremely relevant because great difficulty exists in the differential diagnosis between follicular adenoma (benign) and follicular carcinoma (malignant), which would lead to distinct therapeutic conducts. However, Cvejic et al. (4) observed galectin-3 immunostaining in 5 of 14 follicular adenomas and lack of expression in 4 of 15 follicular carcinomas. These results show that although most studies have associated the galectin-3 expression and thyroid cancer, some authors reported a less significant expression in follicular adenomas, and such findings have hardly been investigated (Table 1
) (3, 4, 5, 7, 8, 9, 10). This study aimed to evaluate the efficiency of galectin-3 protein expression as a molecular marker of malignancy in the thyroid gland for the differentiation between benign and malignant tumors.
|
Thyroid tissue
The patients included in this study were assigned from the Department of Head and Neck Surgery, University of Santo Amaro, São Paulo, Brazil. The histopathological diagnosis of 92 specimens of thyroid tissues was performed according to the revised World Health Organization classification (15, 16, 17). Samples of multinodular goiter (MNG) (n = 24), follicular adenoma (n = 31), follicular carcinoma (n = 20), papillary carcinoma (n = 12), and normal tissue (n = 5) were used for immunohistochemical study and tissues from MNG (n = 10), follicular adenoma (n = 5), follicular carcinoma (n = 1), papillary carcinoma (n = 6), and normal thyroid (n = 1) were evaluated for RNA expression by RT-PCR. This study was approved by the Ethical Committee of the Biomedical Sciences Institute, University of São Paulo, Brazil.
Immunohistochemistry
Immunohistochemistry was performed in paraffin sections by an indirect three-stage immunoenzymatic method, as previously described (18). Briefly, 4-µm sections were placed on 0.1% poly-lysine-coated slides (Sigma, St. Louis, MO), and the endogenous alkaline phosphatase activity was blocked by 15% glacial acetic acid. Tissue sections were then incubated overnight with 4 µg/ml mouse antihuman galectin-3 monoclonal antibody (IgG1, Clone A3A12; Affinity BioReagents, Inc., Golden CO) (19) in PBS (pH 7.4) with 0.05% BSA and Tris-buffered saline. Subsequently, the slides were incubated with biotinylated antimouse secondary antibody for 2 h (Amersham Pharmacia Biotech, Piscataway, NJ), followed by incubation with extrAvidin alkaline phosphatase conjugate (Sigma) for light microscopy visualization or with extrAvidin-Cy3 conjugate (Sigma) for fluorescence microscopy. To display alkaline phosphatase activity, the sections were incubated with a mixture of naphthol AS-MX phosphate, levamisole, and fast-red TR salt (Sigma) as substrate, diluted in veronal acetate buffer (pH 8.3). The slides were then washed in tap water overnight and counterstained with Gills hematoxylin or 1 µg/ml Hoechst solution. The negative control was performed with an irrelevant mouse monoclonal antibody (IgG1 k, MOPC-21; Sigma). The positivity of the reaction was observed by red staining under light microscopy or fluorescent red by fluorescence microscopy (Eclipse E600; Nikon, Shinagawa-ku, Japan). The fluorescent reaction was also analyzed under a laser scanning microscope (LSM510; Carl Zeiss, Oberkochen, Germany), fitted with an inverted Axiovert 100M microscope (Carl Zeiss) and a 40X C-Apochromat objective (Carl Zeiss). Excitation on the laser scanning confocal microscope was with a 1.0-mW helium/neon laser emitting at 543 nm. Optical sections of 0.5 µm were collected using a 560-nm long-pass filter emission to collect Cy3. The fluorescence-staining intensity was analyzed by laser scanning microscopy internal LSM510 software.
Galectin-3 immunostaining was assessed by two independent and impartial observers and scored using a semiquantitative scale for intensity: negative (-), weak (+), moderate (++), or strong (+++) and extension: focal positivity (*), more than 40% of the tissue (**), or more than 60% of the tissue (***).
Sensitivity, specificity, predictive value, and diagnostic accuracy were assessed to determine the value of galectin-3 immunodetection as a malignant marker in thyroid neoplasm. Histomorphological diagnosis was used as the gold standard. Sensitivity was defined as the ability of galectin-3 immunohistochemical assay in thyroid cancer detection [true positive/(true positive + false negative)] and specificity was defined as the assay ability in benign thyroid lesion detection [true negative/(true negative + false positive)]. To measure accuracy, both aspects sensitivity and specificity were considered [true positive + true negative/(true positive + true negative + false positive + false negative)]. Positive and negative predictive values were, respectively, computed as [true positive/(true positive + false positive)] and [true negative/(true negative + false negative)] (20).
RNA isolation and semiquantitative RT-PCR assays
The total RNA was extracted from each thyroid tissue sample using Trizol (Life Technologies, Inc., Frederick, MD) according to the manufacturers instructions and was precipitated with 95% ethanol. Complementary DNA synthesis was carried out at 21 C for 10 min, 42 C for 30 min, and 99 C for 10 min in a final volume of 20 µl with 3 µg total RNA, 400 U M-MLV reverse transcriptase, 10 mM dithiothreitol, 200 ng random hexamer primer, 10 U RNase inhibitor, and 1 mM 2'deoxynucleoside 5'triphosphates mix (Life Technologies, Inc.) (21). The primers 388GGCCACTGATTGTGCCTTAT407 forward (exon 3 and 4) and 689TGCAACCTTGAAGTGGTCAG670 reverse (exon 6) were made on the basis of the human galectin-3 gene (GenBank accession no. AB006780), yielding a 302-bp product (22). The PCR was optimized at 32 cycles (94 C for 35 sec, 60 C for 1 min, and 72 C for 1 min) to ensure exponential phase amplification. The ribosomal protein L19 (RPL19) gene (GenBank accession no. NM 000981) 248AGGCACATGGGCATAGGTAA267 forward, 446CCATGAGAATCCGCTTGTTT427 reverse, yielding a product of 199 bp (22), was coamplified at 24 cycles as an internal reaction control.
The cDNA amplification was performed in a final volume of 50 µl in the presence of the reverse transcription product, 30 pmol of each galectin-3 primer, 1.5 mM MgCl2, 0.2 mM 2'deoxynucleoside 5'triphosphates mix, and 2.5 U Taq DNA polymerase in the thermal cycler (GeneAmp PCR system 9700, PE Applied Biosystems, Foster City, CA) (21). Aliquots of PCR products were resolved by 1.2% agarose/ethidium bromide gel electrophoresis. The amplified products were observed under an ethidium bromide sensitive detection system, Typhoon 8600 (Molecular Dynamics, Inc., Sunnyvale, CA), and densitometric values, in arbitrary units, were obtained for each amplified band using ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). Semiquantitative gene expression data were determined using the ratio of galectin-3/coamplified RPL19 density. Results of the galectin-3 mRNA level were reported as mean ± SD.
RT-PCR amplified products of 302 bp were purified from agarose gel with GFX PCR (Amersham Pharmacia Biotech), according to the manufacturers instructions. Then the product was cloned into the pUC18 SmaI/BAP plasmid (Amersham Pharmacia Biotech) and amplified into XL-1Blue Escherichia coli, which was transformed by electroporation and further plated on agar LB/IPTG (Life Technologies, Inc., Grand Island, NY)/Xgal (USB, Cleveland, OH). Isolated white colonies were chosen for growth in terrific broth medium and 1 µL terrific broth medium was then subjected to PCR reaction, using M13 forward and reverse primers. Subsequently, templates from 12 clones of galectin-3 were made with M13 forward or reverse primers, using the DYEnamic ET dye terminator kit (MegaBACE, Amersham Pharmacia Biotech), containing fluorescein-labeled dideoxynucleotides. A total of 24 templates were then subjected to automated sequencing using MegaBACE 1000 (Molecular Dynamics, Inc.), and sequence similarity search was carried out with BLASTN 2.2.1 (http://www.ncbi.nlm.nih.gov/blast) (22), which confirmed the fragment of human galectin-3 cDNA (GenBank accession no. AB006780).
Results
Galectin-3 immunohistochemical expression
Table 2
summarizes the results obtained for galectin-3 immunostaining in thyroid tissues from 87 patients with MNG, follicular adenoma, follicular carcinoma, and papillary carcinoma diagnosis, and five normal tissues.
|
|
The sensitivity and specificity of galectin-3 in malignant vs. benign thyroid lesions were 93.8% and 67.3%, respectively, whereas the sensitivity and specificity for follicular carcinoma vs. follicular adenoma were 90.0% and 54.8%, respectively, with 45.2% false-positive galectin-3 expression in follicular adenomas. Positive and negative predictive values were assessed as 62.5% and 94.9%, respectively, for malignant vs. benign lesions and 56.3% and 89.5% for follicular carcinoma vs. follicular adenoma (Table 3
).
|
Galectin-3 mRNA expression in the thyroid tissue of 23 patients was estimated by RT-PCR as stated above. Galectin-3 mRNA expression was observed in 100% of follicular (4.30 ± 0.00) and papillary carcinoma (4.02 ± 2.33) samples. Furthermore, galectin-3 mRNA expression was also observed in 80% of MNG (2.31 ± 1.01) and 60% of follicular adenoma (1.30 ± 0.64) samples. A similar expression pattern to normal tissue (0.18 ± 0.00) was observed in 40% of adenomas (0.18 ± 0.02) and 20% of MNG (0.25 ± 0.05) (Fig. 2
).
|
In the present study, we observed that the majority of the tissues from patients diagnosed with follicular and papillary carcinomas expressed galectin-3; however, benign lesions such as MNG and follicular adenoma also expressed the protein. Although galectin-3 immunostaining is highly sensitive to identify cancer, in accordance with other authors (3, 8), it is not specific to make a diagnosis of benign lesions. Furthermore, the accuracy of galectin-3 as a molecular marker to distinguish malignant vs. benign lesions was 77.0% and to follicular carcinoma vs. follicular adenoma 68.6%. We also observed that benign lesions expressed galectin-3 mRNA.
Some studies have demonstrated that in the tissues diagnosed as follicular adenoma or as suspicious lesions for malignancy, the expression of galectin-3 is restricted to follicular cells bordering the connective capsule, suggesting it might be related to malignant progression (3, 9). Although the molecular mechanisms of tumorigenesis are not completely established, the observation that benign lesions such as multinodular goiters present foci of clonal expansion, suggests a stage in the multistep evolution of goiters and adenomas to carcinoma (23, 24). Thus, it is tempting to postulate that adenomas with positive expression for galectin-3 could be considered potential early cancer, and then a therapeutic surgical conduct should be recommendable. Nevertheless, in the present study, we observed focal and diffuse patterns of galectin-3 immunostaining in follicular adenomas and MNG. In addition, recently Coli et al. (25) showed galectin-3 immunostaining in 17 of 27 follicular adenomas and 7 of 25 MNGs.
Elevated galectin-3 immunostaining has been associated with tumoral progression and/or metastasis in pancreatic cancer (26, 27, 28) and hepatocellular carcinoma (29). On the other hand, in breast, ovary, and prostate cancer, a decreased galectin-3 immunoexpression is associated with malignant transformation (30, 31, 32). Changes in the intracellular pattern of galectin-3 expression such as a decrease in the nuclear positivity and increase in the cytoplasmic expression were associated with malignant neoplastic transformation in the tongue (33). Discrepancies regarding the galectin-3 expression have also been observed in colon studies. Some authors found that increased expression may be related to tumoral progression of colon cell lines (34, 35), and studies on surgical samples demonstrated that the decrease of galectin-3 might be associated with the progression of colon cancer (36).
In the latest years, alterations in the expression of growth factors, their receptors, and intracellular markers have been studied extensively in an attempt to characterize tumoral evolution in the thyroid (12, 18). RET/PTC gene rearrangements have been associated with papillary carcinoma (37, 38, 39), and although the PAX8-PPAR
1 gene fusion has been identified in follicular carcinoma, it has not yet been used as a potential marker to distinguish follicular adenoma from follicular carcinoma (39, 40, 41). Thus, the immunohistochemical detection of galectin-3 could be helpful for the presurgical diagnosis of cancer if its expression were really restricted to malignant processes. However, because galectin-3 was expressed in benign as well as malignant lesions, its efficiency in aiding diagnosis of follicular adenoma and follicular carcinoma seems questionable. These findings highlight the importance of caution to use galectin-3 immunohistochemical evaluation as a marker for malignancy in the thyroid gland.
Acknowledgments
Footnotes
Address all correspondence and requests for reprints to: Edna T. Kimura, M.D., Ph.D., Department of Histology and Embryology, Institute of Biomedical Sciences, Universidade de São Paulo, Av. Prof. Lineu Prestes 1524, São Paulo 05508-900, SP, Brazil. E-mail: etkimura{at}usp.br.
This work was supported by research grants from the São Paulo State Research Foundation (FAPESP) 00/04297-8, Bunka Foundation, Research Grant 2001, and fellowship grants from the Brazilian Research Council (CNPq) 109559/00-2 (to L.M.) and FAPESP 98/15269-3, 01/08044-0 (to S.E.M.) and FAPESP 98/14692-0 (to K.N.E.).
Abbreviation: MNG, Multinodular goiter.
Received January 24, 2002.
Accepted July 3, 2002.
References
the Holy Grail of follicular thyroid cancer? Eur J Endocrinol 144:453456[CrossRef][Medline]
1 fusion oncogene in human thyroid carcinoma [corrected]. Science 289:13571360This article has been cited by other articles:
![]() |
Y. Y Liu, H. Morreau, J. Kievit, J. A Romijn, N. Carrasco, and J. W Smit Combined immunostaining with galectin-3, fibronectin-1, CITED-1, Hector Battifora mesothelial-1, cytokeratin-19, peroxisome proliferator-activated receptor-{gamma}, and sodium/iodide symporter antibodies for the differential diagnosis of non-medullary thyroid carcinoma Eur. J. Endocrinol., March 1, 2008; 158(3): 375 - 384. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Sapio, A. Guerra, D. Posca, P. P. Limone, M. Deandrea, M. Motta, G. Troncone, A. Caleo, P. Vallefuoco, G. Rossi, et al. Combined analysis of galectin-3 and BRAFV600E improves the accuracy of fine-needle aspiration biopsy with cytological findings suspicious for papillary thyroid carcinoma Endocr. Relat. Cancer, December 1, 2007; 14(4): 1089 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Lubitz, S. K. Ugras, J. J. Kazam, B. Zhu, T. Scognamiglio, Y.-T. Chen, and T. J. Fahey III Microarray Analysis of Thyroid Nodule Fine-Needle Aspirates Accurately Classifies Benign and Malignant Lesions J. Mol. Diagn., September 1, 2006; 8(4): 490 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Matsuo, S. G. Leoni, A. Colquhoun, and E. T. Kimura Transforming growth factor-{beta}1 and activin A generate antiproliferative signaling in thyroid cancer cells. J. Endocrinol., July 1, 2006; 190(1): 141 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Velez, E. Costamagna, E. T. Kimura, L. Fozzatti, C. G. Pellizas, M. M. Montesinos, A. M. Lucero, A. H. Coleoni, P. Santisteban, and A. M. Masini-Repiso Bacterial Lipopolysaccharide Stimulates the Thyrotropin-Dependent Thyroglobulin Gene Expression at the Transcriptional Level by Involving the Transcription Factors Thyroid Transcription Factor-1 and Paired Box Domain Transcription Factor 8 Endocrinology, July 1, 2006; 147(7): 3260 - 3275. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Saggiorato, R De Pompa, M Volante, S Cappia, F Arecco, A P Dei Tos, F Orlandi, and M Papotti Characterization of thyroid 'follicular neoplasms' in fine-needle aspiration cytological specimens using a panel of immunohistochemical markers: a proposal for clinical application Endocr. Relat. Cancer, June 1, 2005; 12(2): 305 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wagner, R. Arciaga, A. Siperstein, M. Milas, I. Warshawsky, S. Sethu, K. Reddy, and M. K. Gupta Thyrotropin Receptor/Thyroglobulin Messenger Ribonucleic Acid in Peripheral Blood and Fine-Needle Aspiration Cytology: Diagnostic Synergy for Detecting Thyroid Cancer J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 1921 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chinnappa, L. Taguba, R. Arciaga, C. Faiman, A. Siperstein, A. E. Mehta, S. K. Reddy, C. Nasr, and M. K. Gupta Detection of Thyrotropin-Receptor Messenger Ribonucleic Acid (mRNA) and Thyroglobulin mRNA Transcripts in Peripheral Blood of Patients with Thyroid Disease: Sensitive and Specific Markers for Thyroid Cancer J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3705 - 3709. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Torres-Cabala, A. Panizo-Santos, H. C. Krutzsch, H. Barazi, M. Namba, M. Sakaguchi, D. D. Roberts, and M. J. Merino Differential Expression of S100C in Thyroid Lesions International Journal of Surgical Pathology, April 1, 2004; 12(2): 107 - 115. [Abstract] [PDF] |
||||
![]() |
M. Niedziela, E. Korman, and J. Maceluch Authors' Response: Methodological Considerations Regarding the Use of Galectin-3 Expression Analysis in Preoperative Evaluation of Thyroid Nodules J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 950 - 951. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |