help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martins, L.
Right arrow Articles by Kimura, E. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martins, L.
Right arrow Articles by Kimura, E. T.
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 10 4806-4810
Copyright © 2002 by The Endocrine Society


COMMENT

Galectin-3 Messenger Ribonucleic Acid and Protein Are Expressed in Benign Thyroid Tumors

Luciane Martins, Sílvia E. Matsuo, Kátia N. Ebina, Marco Aurélio V. Kulcsar, Celso U. M. Friguglietti and Edna T. Kimura

Department of Histology and Embryology, Institute of Biomedical Sciences, Universidade de São Paulo, São Paulo 05508-900, SP, Brazil

Abstract

Galectin-3 is a protein of the lectin family that has been associated with neoplastic processes in various tissues. In the thyroid, expression of this protein has been described in differentiated follicular cancer, suggesting that the immunohistochemical study of galectin-3 may be a potential marker of malignancy in thyroid neoplasms. The confirmation of these results may represent an extremely useful tool for presurgical diagnosis and medical conduct. In this study, galectin-3 protein and mRNA expression were analyzed in the thyroid tissues from 87 patients with histomorphological diagnosis of multinodular goiter (MNG) (n = 24), follicular adenoma (n = 31), follicular carcinoma (n = 20), papillary carcinoma (n = 12), and five normal tissues. Galectin-3 protein expression was detected by immunohistochemical method in light, fluorescence, and confocal microscopy, using monoclonal antibody. Galectin-3 mRNA expression was detected by the RT-PCR method. Our results showed that the majority of carcinomas expressed galectin-3 protein (follicular, 90%; papillary, 100%). However, in contrast to the previously published data, benign lesions also expressed galectin-3 (adenoma, 45%; MNG, 17%). We further demonstrated by RT-PCR that thyroid tissues with diagnosis of adenoma and MNG-expressed galectin-3 mRNA. Although the galectin-3 immunostaining demonstrated a sensitivity of 93.8% in the identification of cancer, the accuracy in the distinction between benign and malignant tissues was 77.0%. This accuracy was even lower (68.6%) when the galectin-3 expression in follicular adenoma was compared with follicular carcinoma. Thus, the use of galectin-3 immunodetection as a molecular marker for thyroid carcinoma must be interpreted with caution, particularly in the differentiation between thyroid follicular carcinoma and follicular adenoma.

GALECTIN-3 IS A 30-kDa monomeric protein that has been associated to important biological processes, including malignant transformation, progression, and metastasis of tumors in different tissues (1, 2). In the latest years, the diagnostic value of the galectin-3 immunodetection in thyroid neoplasms has been widely discussed because several authors have demonstrated a correlation between galectin-3 expression and thyroid cancer (3, 4, 5, 6, 7, 8, 9, 10).

Although advances have been made in the understanding of thyroid tumorigenesis, biochemical, cytological, or molecular markers have not been effective in the clinical diagnosis of follicular lesions (11, 12). The microscopic analysis of cells obtained by the fine-needle aspiration biopsy has also proved difficult (13). Thus, the immunohistochemical analysis of galectin-3 might be an important tool for diagnostic definition, as stated by several authors (3, 7, 8, 9, 14). The confirmation that galectin-3 expression is restricted to thyroid cancer is extremely relevant because great difficulty exists in the differential diagnosis between follicular adenoma (benign) and follicular carcinoma (malignant), which would lead to distinct therapeutic conducts. However, Cvejic et al. (4) observed galectin-3 immunostaining in 5 of 14 follicular adenomas and lack of expression in 4 of 15 follicular carcinomas. These results show that although most studies have associated the galectin-3 expression and thyroid cancer, some authors reported a less significant expression in follicular adenomas, and such findings have hardly been investigated (Table 1Go) (3, 4, 5, 7, 8, 9, 10). This study aimed to evaluate the efficiency of galectin-3 protein expression as a molecular marker of malignancy in the thyroid gland for the differentiation between benign and malignant tumors.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of immunohistochemical findings for galectin-3 expression in thyroid tumors observed by other authors

 
Materials and Methods

Thyroid tissue

The patients included in this study were assigned from the Department of Head and Neck Surgery, University of Santo Amaro, São Paulo, Brazil. The histopathological diagnosis of 92 specimens of thyroid tissues was performed according to the revised World Health Organization classification (15, 16, 17). Samples of multinodular goiter (MNG) (n = 24), follicular adenoma (n = 31), follicular carcinoma (n = 20), papillary carcinoma (n = 12), and normal tissue (n = 5) were used for immunohistochemical study and tissues from MNG (n = 10), follicular adenoma (n = 5), follicular carcinoma (n = 1), papillary carcinoma (n = 6), and normal thyroid (n = 1) were evaluated for RNA expression by RT-PCR. This study was approved by the Ethical Committee of the Biomedical Sciences Institute, University of São Paulo, Brazil.

Immunohistochemistry

Immunohistochemistry was performed in paraffin sections by an indirect three-stage immunoenzymatic method, as previously described (18). Briefly, 4-µm sections were placed on 0.1% poly-lysine-coated slides (Sigma, St. Louis, MO), and the endogenous alkaline phosphatase activity was blocked by 15% glacial acetic acid. Tissue sections were then incubated overnight with 4 µg/ml mouse antihuman galectin-3 monoclonal antibody (IgG1, Clone A3A12; Affinity BioReagents, Inc., Golden CO) (19) in PBS (pH 7.4) with 0.05% BSA and Tris-buffered saline. Subsequently, the slides were incubated with biotinylated antimouse secondary antibody for 2 h (Amersham Pharmacia Biotech, Piscataway, NJ), followed by incubation with extrAvidin alkaline phosphatase conjugate (Sigma) for light microscopy visualization or with extrAvidin-Cy3 conjugate (Sigma) for fluorescence microscopy. To display alkaline phosphatase activity, the sections were incubated with a mixture of naphthol AS-MX phosphate, levamisole, and fast-red TR salt (Sigma) as substrate, diluted in veronal acetate buffer (pH 8.3). The slides were then washed in tap water overnight and counterstained with Gill’s hematoxylin or 1 µg/ml Hoechst solution. The negative control was performed with an irrelevant mouse monoclonal antibody (IgG1 k, MOPC-21; Sigma). The positivity of the reaction was observed by red staining under light microscopy or fluorescent red by fluorescence microscopy (Eclipse E600; Nikon, Shinagawa-ku, Japan). The fluorescent reaction was also analyzed under a laser scanning microscope (LSM510; Carl Zeiss, Oberkochen, Germany), fitted with an inverted Axiovert 100M microscope (Carl Zeiss) and a 40X C-Apochromat objective (Carl Zeiss). Excitation on the laser scanning confocal microscope was with a 1.0-mW helium/neon laser emitting at 543 nm. Optical sections of 0.5 µm were collected using a 560-nm long-pass filter emission to collect Cy3. The fluorescence-staining intensity was analyzed by laser scanning microscopy internal LSM510 software.

Galectin-3 immunostaining was assessed by two independent and impartial observers and scored using a semiquantitative scale for intensity: negative (-), weak (+), moderate (++), or strong (+++) and extension: focal positivity (*), more than 40% of the tissue (**), or more than 60% of the tissue (***).

Sensitivity, specificity, predictive value, and diagnostic accuracy were assessed to determine the value of galectin-3 immunodetection as a malignant marker in thyroid neoplasm. Histomorphological diagnosis was used as the gold standard. Sensitivity was defined as the ability of galectin-3 immunohistochemical assay in thyroid cancer detection [true positive/(true positive + false negative)] and specificity was defined as the assay ability in benign thyroid lesion detection [true negative/(true negative + false positive)]. To measure accuracy, both aspects sensitivity and specificity were considered [true positive + true negative/(true positive + true negative + false positive + false negative)]. Positive and negative predictive values were, respectively, computed as [true positive/(true positive + false positive)] and [true negative/(true negative + false negative)] (20).

RNA isolation and semiquantitative RT-PCR assays

The total RNA was extracted from each thyroid tissue sample using Trizol (Life Technologies, Inc., Frederick, MD) according to the manufacturer’s instructions and was precipitated with 95% ethanol. Complementary DNA synthesis was carried out at 21 C for 10 min, 42 C for 30 min, and 99 C for 10 min in a final volume of 20 µl with 3 µg total RNA, 400 U M-MLV reverse transcriptase, 10 mM dithiothreitol, 200 ng random hexamer primer, 10 U RNase inhibitor, and 1 mM 2'deoxynucleoside 5'triphosphates mix (Life Technologies, Inc.) (21). The primers 388GGCCACTGATTGTGCCTTAT407 forward (exon 3 and 4) and 689TGCAACCTTGAAGTGGTCAG670 reverse (exon 6) were made on the basis of the human galectin-3 gene (GenBank accession no. AB006780), yielding a 302-bp product (22). The PCR was optimized at 32 cycles (94 C for 35 sec, 60 C for 1 min, and 72 C for 1 min) to ensure exponential phase amplification. The ribosomal protein L19 (RPL19) gene (GenBank accession no. NM 000981) 248AGGCACATGGGCATAGGTAA267 forward, 446CCATGAGAATCCGCTTGTTT427 reverse, yielding a product of 199 bp (22), was coamplified at 24 cycles as an internal reaction control.

The cDNA amplification was performed in a final volume of 50 µl in the presence of the reverse transcription product, 30 pmol of each galectin-3 primer, 1.5 mM MgCl2, 0.2 mM 2'deoxynucleoside 5'triphosphates mix, and 2.5 U Taq DNA polymerase in the thermal cycler (GeneAmp PCR system 9700, PE Applied Biosystems, Foster City, CA) (21). Aliquots of PCR products were resolved by 1.2% agarose/ethidium bromide gel electrophoresis. The amplified products were observed under an ethidium bromide sensitive detection system, Typhoon 8600 (Molecular Dynamics, Inc., Sunnyvale, CA), and densitometric values, in arbitrary units, were obtained for each amplified band using ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). Semiquantitative gene expression data were determined using the ratio of galectin-3/coamplified RPL19 density. Results of the galectin-3 mRNA level were reported as mean ± SD.

RT-PCR amplified products of 302 bp were purified from agarose gel with GFX PCR (Amersham Pharmacia Biotech), according to the manufacturer’s instructions. Then the product was cloned into the pUC18 SmaI/BAP plasmid (Amersham Pharmacia Biotech) and amplified into XL-1Blue Escherichia coli, which was transformed by electroporation and further plated on agar LB/IPTG (Life Technologies, Inc., Grand Island, NY)/Xgal (USB, Cleveland, OH). Isolated white colonies were chosen for growth in terrific broth medium and 1 µL terrific broth medium was then subjected to PCR reaction, using M13 forward and reverse primers. Subsequently, templates from 12 clones of galectin-3 were made with M13 forward or reverse primers, using the DYEnamic ET dye terminator kit (MegaBACE, Amersham Pharmacia Biotech), containing fluorescein-labeled dideoxynucleotides. A total of 24 templates were then subjected to automated sequencing using MegaBACE 1000 (Molecular Dynamics, Inc.), and sequence similarity search was carried out with BLASTN 2.2.1 (http://www.ncbi.nlm.nih.gov/blast) (22), which confirmed the fragment of human galectin-3 cDNA (GenBank accession no. AB006780).

Results

Galectin-3 immunohistochemical expression

Table 2Go summarizes the results obtained for galectin-3 immunostaining in thyroid tissues from 87 patients with MNG, follicular adenoma, follicular carcinoma, and papillary carcinoma diagnosis, and five normal tissues.


View this table:
[in this window]
[in a new window]
 
Table 2. Galectin-3 protein expression in the thyroid follicular cell

 
Immunohistochemical analysis of MNG showed lack of galectin-3 cytoplasmic reactivity in 20 of 24 samples and weak to moderate positivity in four cases (Fig. 1Go, A1 and A2). From the 31 follicular adenomas analyzed, 17 showed lack of galectin-3 immunostaining, nine were weak, three moderate, and only two presented strong focal immunostaining close to the external connective capsule (Fig. 1Go, B1, B2, and F). In thyroid carcinomas (follicular and papillary), 23 of 32 samples had strong or moderate galectin-3 expression, whereas seven were weak and two did not express galectin-3 (Fig. 1Go, C1, C2, D1, D2, and E).



View larger version (92K):
[in this window]
[in a new window]
 
Figure 1. Galectin-3 immunostaining in the thyroid tumors detected by alkaline phosphatase and fluorescence procedures. The galectin-3 expression by alkaline phosphatase method in MNG (A1), follicular adenoma (B1), follicular carcinoma (C1), and papillary carcinoma (D1) can be observed by the red staining using light microscopy (bar = 50 µm). The tissue immunopositivity is shown in red, mainly in the cytoplasm of follicular cells, and the pale blue counterstaining in the nuclei was demonstrated with Gill’s hematoxylin. Galectin-3 expression by immunofluorescence method in MNG (A2), follicular adenoma (B2), follicular carcinoma (C2), and papillary carcinoma (D2), using confocal laser scanning microscopy (A2, B2, and D2, bar = 20 µm; C2, bar = 10 µm). Cy3 brightness intensity scale 0–225 (on left) was quantified by LSM510 laser scanning microscope image system software (Carl Zeiss) (A3, B3, C3, D3). Lower panel, Galectin-3 expression in follicular carcinoma (E) and follicular adenoma (F) by immunohistochemical method using alkaline phosphatase; bar = 50 µm. Although in follicular carcinoma, galectin-3 positivity was restricted to malignant lesion, a diffuse expression through the tissue was observed in follicular adenoma (F).

 
Light microscopy immunostaining was performed in all 87 samples, and 20 were also analyzed by the fluorescence method to avoid false-positive results. Both immunohistochemical assays, with either alkaline phosphatase or immunofluorescence, led to similar results (Fig. 1Go).

The sensitivity and specificity of galectin-3 in malignant vs. benign thyroid lesions were 93.8% and 67.3%, respectively, whereas the sensitivity and specificity for follicular carcinoma vs. follicular adenoma were 90.0% and 54.8%, respectively, with 45.2% false-positive galectin-3 expression in follicular adenomas. Positive and negative predictive values were assessed as 62.5% and 94.9%, respectively, for malignant vs. benign lesions and 56.3% and 89.5% for follicular carcinoma vs. follicular adenoma (Table 3Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Comparative data of galectin-3 immunostaining findings and corresponding histomorphological diagnosis in thyroid tissues from 87 patients

 
Galectin-3 gene expression by RT-PCR

Galectin-3 mRNA expression in the thyroid tissue of 23 patients was estimated by RT-PCR as stated above. Galectin-3 mRNA expression was observed in 100% of follicular (4.30 ± 0.00) and papillary carcinoma (4.02 ± 2.33) samples. Furthermore, galectin-3 mRNA expression was also observed in 80% of MNG (2.31 ± 1.01) and 60% of follicular adenoma (1.30 ± 0.64) samples. A similar expression pattern to normal tissue (0.18 ± 0.00) was observed in 40% of adenomas (0.18 ± 0.02) and 20% of MNG (0.25 ± 0.05) (Fig. 2Go).



View larger version (34K):
[in this window]
[in a new window]
 
Figure 2. Galectin-3 (Gal-3) mRNA expression in the thyroid tissues by RT-PCR. Representative photo from the gel shows gal-3 (302 bp) and RPL19 (199 bp) RT-PCR amplification products, from normal thyroid (NL), multinodular goiter (MNG), follicular adenoma (FA), follicular carcinoma (FC), papillary carcinoma (PC). DNA molecular weight standard (MW). The graph shows galectin-3 mRNA level in the thyroid tissues. Each densitometry value of galectin-3 expression was normalized with coamplified RPL19. Values are expressed as means ± SD.

 
Discussion

In the present study, we observed that the majority of the tissues from patients diagnosed with follicular and papillary carcinomas expressed galectin-3; however, benign lesions such as MNG and follicular adenoma also expressed the protein. Although galectin-3 immunostaining is highly sensitive to identify cancer, in accordance with other authors (3, 8), it is not specific to make a diagnosis of benign lesions. Furthermore, the accuracy of galectin-3 as a molecular marker to distinguish malignant vs. benign lesions was 77.0% and to follicular carcinoma vs. follicular adenoma 68.6%. We also observed that benign lesions expressed galectin-3 mRNA.

Some studies have demonstrated that in the tissues diagnosed as follicular adenoma or as suspicious lesions for malignancy, the expression of galectin-3 is restricted to follicular cells bordering the connective capsule, suggesting it might be related to malignant progression (3, 9). Although the molecular mechanisms of tumorigenesis are not completely established, the observation that benign lesions such as multinodular goiters present foci of clonal expansion, suggests a stage in the multistep evolution of goiters and adenomas to carcinoma (23, 24). Thus, it is tempting to postulate that adenomas with positive expression for galectin-3 could be considered potential early cancer, and then a therapeutic surgical conduct should be recommendable. Nevertheless, in the present study, we observed focal and diffuse patterns of galectin-3 immunostaining in follicular adenomas and MNG. In addition, recently Coli et al. (25) showed galectin-3 immunostaining in 17 of 27 follicular adenomas and 7 of 25 MNGs.

Elevated galectin-3 immunostaining has been associated with tumoral progression and/or metastasis in pancreatic cancer (26, 27, 28) and hepatocellular carcinoma (29). On the other hand, in breast, ovary, and prostate cancer, a decreased galectin-3 immunoexpression is associated with malignant transformation (30, 31, 32). Changes in the intracellular pattern of galectin-3 expression such as a decrease in the nuclear positivity and increase in the cytoplasmic expression were associated with malignant neoplastic transformation in the tongue (33). Discrepancies regarding the galectin-3 expression have also been observed in colon studies. Some authors found that increased expression may be related to tumoral progression of colon cell lines (34, 35), and studies on surgical samples demonstrated that the decrease of galectin-3 might be associated with the progression of colon cancer (36).

In the latest years, alterations in the expression of growth factors, their receptors, and intracellular markers have been studied extensively in an attempt to characterize tumoral evolution in the thyroid (12, 18). RET/PTC gene rearrangements have been associated with papillary carcinoma (37, 38, 39), and although the PAX8-PPAR{gamma}1 gene fusion has been identified in follicular carcinoma, it has not yet been used as a potential marker to distinguish follicular adenoma from follicular carcinoma (39, 40, 41). Thus, the immunohistochemical detection of galectin-3 could be helpful for the presurgical diagnosis of cancer if its expression were really restricted to malignant processes. However, because galectin-3 was expressed in benign as well as malignant lesions, its efficiency in aiding diagnosis of follicular adenoma and follicular carcinoma seems questionable. These findings highlight the importance of caution to use galectin-3 immunohistochemical evaluation as a marker for malignancy in the thyroid gland.

Acknowledgments

Footnotes

Address all correspondence and requests for reprints to: Edna T. Kimura, M.D., Ph.D., Department of Histology and Embryology, Institute of Biomedical Sciences, Universidade de São Paulo, Av. Prof. Lineu Prestes 1524, São Paulo 05508-900, SP, Brazil. E-mail: etkimura{at}usp.br.

This work was supported by research grants from the São Paulo State Research Foundation (FAPESP) 00/04297-8, Bunka Foundation, Research Grant 2001, and fellowship grants from the Brazilian Research Council (CNPq) 109559/00-2 (to L.M.) and FAPESP 98/15269-3, 01/08044-0 (to S.E.M.) and FAPESP 98/14692-0 (to K.N.E.).

Abbreviation: MNG, Multinodular goiter.

Received January 24, 2002.

Accepted July 3, 2002.

References

  1. Perillo NL, Marcus ME, Baum LG 1998 Galectins: versatile modulators of cell adhesion, cell proliferation, and cell death. J Mol Med 76:402–412[CrossRef][Medline]
  2. Chiariotti L, Salvatore P, Benvenuto G, Bruni CB 1999 Control of galectin gene expression. Biochimie (Paris) 81:381–388[Medline]
  3. Bartolazzi A, Gasbarri A, Papotti M, Bussolati G, Lucante T, Khan A, Inohara H, Marandino F, Orlandi F, Nardi F, Vecchione A, Tecce R, Larsson O 2001 Application of an immunodiagnostic method for improving preoperative diagnosis of nodular thyroid lesions. Lancet 357:1644–1650[CrossRef][Medline]
  4. Cvejic D, Savin S, Paunovic I, Tatic S, Havelka M, Sinadinovic J 1998 Immunohistochemical localization of galectin-3 in malignant and benign human thyroid tissue. Anticancer Res 18:2637–2641[Medline]
  5. Fernandez PL, Merino MJ, Gomez M, Campo E, Medina T, Castronovo V, Sanjuán X, Cardesa A, Liu F-T, Sobel ME 1997 Galectin-3 and laminin expression in neoplastic and non-neoplastic thyroid tissue. J Pathol 181:80–86[CrossRef][Medline]
  6. Gasbarri A, Martegani MP, Del Prete F, Lucante T, Natali PG, Bartolazzi A 1999 Galectin-3 and CD44v6 isoforms in the preoperative evaluation of thyroid nodules. J Clin Oncol 17:3494–3502[Abstract/Free Full Text]
  7. Inohara H, Honjo Y, Yoshii T, Akahani S, Yoshida J-I, Hattori K, Okamoto S, Sawada T, Raz A, Kudo T 1999 Expression of galectin-3 in fine-needle aspirates as a diagnostic marker differentiating benign from malignant thyroid neoplasms. Cancer 85:2475–2484[CrossRef][Medline]
  8. Orlandi F, Saggiorato E, Pivano G, Puligheddu B, Termine A, Cappia S, De Giuli P, Angeli A 1998 Galectin-3 is a presurgical marker of human thyroid carcinoma. Cancer Res 58:3015–3020[Abstract/Free Full Text]
  9. Saggiorato E, Cappia S, De Giuli P, Mussa A, Pancani G, Caraci P, Angeli A, Orlandi F 2001 Galectin-3 as a presurgical immunocytodiagnostic marker of minimally invasive follicular thyroid carcinoma. J Clin Endocrinol Metab 86:5152–5158[Abstract/Free Full Text]
  10. Xu XC, el-Naggar AK, Lotan R 1995 Differential expression of galectin-1 and galectin-3 in thyroid tumors. Potential diagnostic implications. Am J Pathol 147:815–822[Abstract]
  11. Derwahl M, Studer H 2002 Hyperplasia versus adenoma in endocrine tissues: are they different? Trends Endocrinol Metab 13:23–28[CrossRef][Medline]
  12. Farid NR, Shi Y, Zou M 1994 Molecular basis of thyroid cancer. Endocr Rev 15:202–232[Abstract/Free Full Text]
  13. Agrawal S 1995 Diagnostic accuracy and role of fine needle aspiration cytology in management of thyroid nodules. J Surg Oncol 58:168–172[Medline]
  14. Kawachi K, Matsushita Y, Yonezawa S, Nakano S, Shirao K, Natsugoe S, Sueyoshi K, Aikou T, Sato E 2000 Galectin-3 expression in various thyroid neoplasms and its possible role in metastasis formation. Hum Pathol 31:428–433[CrossRef][Medline]
  15. Hedinger C, Williams ED, Sobin LH 1989 The WHO histological classification of thyroid tumors: a commentary on the second edition. Cancer 63:908–911[CrossRef][Medline]
  16. Hedinger C, Willians ED, Sobin LH 1993 Histological typing of thyroid tumors. In: International histological classification of tumours, World Health Organization, ed 2. Berlin, Heidelberg, New York, London, Paris, Tokyo: Springer-Verlag
  17. Rosai J, Carcangiu ML, DeLellis RA 1992 Tumors of the thyroid gland. In: Rosai J, Sobin LH. Atlas of tumor pathology. Third series, fascicle 5. Washington, DC: Armed Forces Institute of Pathology
  18. Kimura ET, Kopp P, Zbaeren J, Asmis LM, Ruchti C, Maciel RM, Studer H 1999 Expression of transforming growth factor beta1, beta2, and beta3 in multinodular goiters and differentiated thyroid carcinomas: a comparative study. Thyroid 9:119–125[Medline]
  19. Liu FT, Hsu DK, Zuberi RI, Hill PN, Shenhav A, Kuwabara I, Chen SS 1996 Modulation of functional properties of galectin-3 by monoclonal antibodies binding to the non-lectin domains. Biochemistry 35:6073–6079[CrossRef][Medline]
  20. Dawson-Saunders B, Trapp RG 1994 Basic, clinical biostatistics, ed 2. Norwalk: Appleton, Lange; 232–248
  21. Sambrook J, Fristsch E, Marniatis T 1989 Molecular cloning: a laboratory manual, ed 2. New York: Cold Spring Harbor Laboratory Press
  22. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402[Abstract/Free Full Text]
  23. Fagin JA 1992 Genetic basis of endocrine disease 3: molecular defects in thyroid gland neoplasia. J Clin Endocrinol Metab 75:1398–1400[CrossRef][Medline]
  24. Kopp P, Kimura ET, Aeschimann S, Oestreicher M, Tobler A, Fey MF, Studer H 1994 Polyclonal and monoclonal thyroid nodules coexist within human multinodular goiters. J Clin Endocrinol Metab 79:134–139[Abstract]
  25. Coli A, Bigotti G, Zucchetti F, Negro F, Massi G 2002 Galectin-3, a marker of well-differentiated thyroid carcinoma, is expressed in thyroid nodules with cytological atypia. Histopathology 40:80–87[CrossRef][Medline]
  26. Berberat PO, Friess H, Wang L, Zhu Z, Bley T, Frigeri L, Zimmermann A, Buchler MW 2001 Comparative analysis of galectins in primary tumors and tumor metastasis in human pancreatic cancer. J Histochem Cytochem 49:539–549[Abstract/Free Full Text]
  27. Schaffert C, Pour PM, Chaney WG 1998 Localization of galectin-3 in normal and diseased pancreatic tissue. Int J Pancreatol 23:1–9[Medline]
  28. Wang L, Friess H, Zhu Z, Frigeri L, Zimmermann A, Korc M, Berberat PO, Buchler MW 2000 Galectin-1 and galectin-3 in chronic pancreatitis. Lab Invest 80:1233–1241[Medline]
  29. Hsu DK, Dowling CA, Jeng KC, Chen JT, Yang RY, Liu FT 1999 Galectin-3 expression is induced in cirrhotic liver and hepatocellular carcinoma. Int J Cancer 81:519–526[CrossRef][Medline]
  30. Van den Brule FA, Berchuck A, Bast RC, Liu FT, Gillet C, Sobel ME, Castronovo V 1994 Differential expression of the 67-kD laminin receptor and 31-kD human laminin-binding protein in human ovarian carcinomas. Eur J Cancer 8:1096–1099[CrossRef]
  31. Castronovo V, Van Den Brule FA, Jackers P, Clausse N, Liu FT, Gillet C, Sobel ME 1996 Decreased expression of galectin-3 is associated with progression of human breast cancer. J Pathol 179:43–48[CrossRef][Medline]
  32. Van den Brule F A, Waltregny D, Liu FT, Castronovo V 2000 Alteration of the cytoplasmic/nuclear expression pattern of galectin-3 correlates with prostate carcinoma progression. Int J Cancer 89:361–367[CrossRef][Medline]
  33. Honjo Y, Inohara H, Akahani S, Yoshii T, Takenaka Y, Yoshida J-I, Hattori K, Tomiyama Y, Raz A, Kubo T 2000 Expression of cytoplasmic galectin-3 as a prognostic marker in tongue carcinoma. Clin Cancer Res 6:4635–4640[Abstract/Free Full Text]
  34. Bresalier RS, Mazurek N, Sternberg LR, Byrd JC, Yunker CK, Nangia-Makker P, Raz A 1998 Metastasis of human colon cancer is altered by modifying expression of the beta-galactoside-binding protein galectin 3. Gastroenterology 115:287–296[CrossRef][Medline]
  35. Lee EC, Woo HJ, Korzelius CA, Steele Jr GD, Mercurio AM 1991 Carbohydrate-binding protein 35 is the major cell-surface laminin-binding protein in colon carcinoma. Arch Surg 126:1498–1502[Abstract/Free Full Text]
  36. Lotz MM, Andrews Jr CW, Korzelius CA, Lee EC, Steele Jr GD, Clarke A, Mercurio AM 1993 Decreased expression of Mac-2 (carbohydrate binding protein 35) and loss of its nuclear localization are associated with the neoplastic progression of colon carcinoma. Proc Natl Acad Sci USA 90:3466–3470[Abstract/Free Full Text]
  37. Cheung CC, Carydis B, Ezzat S, Bedard YC, Asa SL 2001 Analysis of ret/PTC gene rearrangements refines the fine needle aspiration diagnosis of thyroid cancer. J Clin Endocrinol Metab 86:2187–2190[Abstract/Free Full Text]
  38. Fusco A, Grieco M, Santoro M, Berlingieri MT, Pilotti S, Pierotti MA, Della Porta G, Vecchio G 1987 A new oncogene in human thyroid papillary carcinomas and their lymph-nodal metastases. Nature 328:170–172[CrossRef][Medline]
  39. Fagin JA 2002 Perspective: lessons learned from molecular genetic studies of thyroid cancer insights into pathogenesis and tumor-specific therapeutic targets. Endocrinology 143:2025–2028[Free Full Text]
  40. Fuhrer D 2001 A nuclear receptor in thyroid malignancy: is PAX8/PPAR{gamma} the Holy Grail of follicular thyroid cancer? Eur J Endocrinol 144:453–456[CrossRef][Medline]
  41. Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM, Fletcher JA 2000 PAX8-PPAR{gamma}1 fusion oncogene in human thyroid carcinoma [corrected]. Science 289:1357–1360[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
Y. Y Liu, H. Morreau, J. Kievit, J. A Romijn, N. Carrasco, and J. W Smit
Combined immunostaining with galectin-3, fibronectin-1, CITED-1, Hector Battifora mesothelial-1, cytokeratin-19, peroxisome proliferator-activated receptor-{gamma}, and sodium/iodide symporter antibodies for the differential diagnosis of non-medullary thyroid carcinoma
Eur. J. Endocrinol., March 1, 2008; 158(3): 375 - 384.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M. R. Sapio, A. Guerra, D. Posca, P. P. Limone, M. Deandrea, M. Motta, G. Troncone, A. Caleo, P. Vallefuoco, G. Rossi, et al.
Combined analysis of galectin-3 and BRAFV600E improves the accuracy of fine-needle aspiration biopsy with cytological findings suspicious for papillary thyroid carcinoma
Endocr. Relat. Cancer, December 1, 2007; 14(4): 1089 - 1097.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
C. C. Lubitz, S. K. Ugras, J. J. Kazam, B. Zhu, T. Scognamiglio, Y.-T. Chen, and T. J. Fahey III
Microarray Analysis of Thyroid Nodule Fine-Needle Aspirates Accurately Classifies Benign and Malignant Lesions
J. Mol. Diagn., September 1, 2006; 8(4): 490 - 498.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S. E. Matsuo, S. G. Leoni, A. Colquhoun, and E. T. Kimura
Transforming growth factor-{beta}1 and activin A generate antiproliferative signaling in thyroid cancer cells.
J. Endocrinol., July 1, 2006; 190(1): 141 - 150.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. L. Velez, E. Costamagna, E. T. Kimura, L. Fozzatti, C. G. Pellizas, M. M. Montesinos, A. M. Lucero, A. H. Coleoni, P. Santisteban, and A. M. Masini-Repiso
Bacterial Lipopolysaccharide Stimulates the Thyrotropin-Dependent Thyroglobulin Gene Expression at the Transcriptional Level by Involving the Transcription Factors Thyroid Transcription Factor-1 and Paired Box Domain Transcription Factor 8
Endocrinology, July 1, 2006; 147(7): 3260 - 3275.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
E Saggiorato, R De Pompa, M Volante, S Cappia, F Arecco, A P Dei Tos, F Orlandi, and M Papotti
Characterization of thyroid 'follicular neoplasms' in fine-needle aspiration cytological specimens using a panel of immunohistochemical markers: a proposal for clinical application
Endocr. Relat. Cancer, June 1, 2005; 12(2): 305 - 317.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. Wagner, R. Arciaga, A. Siperstein, M. Milas, I. Warshawsky, S. Sethu, K. Reddy, and M. K. Gupta
Thyrotropin Receptor/Thyroglobulin Messenger Ribonucleic Acid in Peripheral Blood and Fine-Needle Aspiration Cytology: Diagnostic Synergy for Detecting Thyroid Cancer
J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 1921 - 1924.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Chinnappa, L. Taguba, R. Arciaga, C. Faiman, A. Siperstein, A. E. Mehta, S. K. Reddy, C. Nasr, and M. K. Gupta
Detection of Thyrotropin-Receptor Messenger Ribonucleic Acid (mRNA) and Thyroglobulin mRNA Transcripts in Peripheral Blood of Patients with Thyroid Disease: Sensitive and Specific Markers for Thyroid Cancer
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 3705 - 3709.
[Abstract] [Full Text] [PDF]


Home page
INT J SURG PATHOLHome page
C. Torres-Cabala, A. Panizo-Santos, H. C. Krutzsch, H. Barazi, M. Namba, M. Sakaguchi, D. D. Roberts, and M. J. Merino
Differential Expression of S100C in Thyroid Lesions
International Journal of Surgical Pathology, April 1, 2004; 12(2): 107 - 115.
[Abstract] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Niedziela, E. Korman, and J. Maceluch
Authors' Response: Methodological Considerations Regarding the Use of Galectin-3 Expression Analysis in Preoperative Evaluation of Thyroid Nodules
J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 950 - 951.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martins, L.
Right arrow Articles by Kimura, E. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martins, L.
Right arrow Articles by Kimura, E. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals