help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, X.
Right arrow Articles by Groop, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, X.
Right arrow Articles by Groop, L.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Diabetes
The Journal of Clinical Endocrinology & Metabolism Vol. 87, No. 1 255-259
Copyright © 2002 by The Endocrine Society


Other Original Articles

Down-Regulation of Insulin Receptor Substrates (IRS)-1 and IRS-2 and Src Homologous and Collagen-Like Protein Shc Gene Expression by Insulin in Skeletal Muscle Is Not Associated with Insulin Resistance or Type 2 Diabetes

Xudong Huang, Allan Vaag, Mona Hansson and Leif Groop

Wallenberg Laboratory, Department of Endocrinology, University of Lund, 20502 Malmo, Sweden

Address all correspondence and requests for reprints to: Xudong Huang, Wallenberg Laboratory, Department of Endocrinology, MAS 46 P 3, 20502 Malmo, Sweden. E-mail: xudong.huang{at}endo.mas.lu.se


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
To examine whether altered gene expression of insulin receptor substrates (IRS)-1 and IRS-2 and Src homologous and collagen-like protein Shc is an inherited trait and is associated with muscle insulin resistance or type 2 diabetes, we measured mRNA levels of these genes by a relative quantitative RT-PCR method in muscle biopsies taken before and after an insulin clamp from 12 monozygotic twin pairs discordant for type 2 diabetes and 12 control subjects. Insulin-stimulated glucose uptake was decreased both in the diabetic and nondiabetic twin, compared with healthy control subjects (5.2 ± 0.7 and 8.5 ± 0.8 vs. 11.4 ± 0.9 mg/kg·min-1; P < 0.01 and P < 0.02, respectively). Basal mRNA levels of IRS-1, IRS-2, and Shc were similar in the diabetic and nondiabetic twins as well as in the control subjects. Insulin decreased mRNA expression of IRS-1 by 72% (from 0.75 ± 0.06 to 0.21 ± 0.04 relative units; P < 0.001), IRS-2 by 71% (from 0.55 ± 0.10 to 0.16 ± 0.08 relative units; P < 0.03), and Shc by 25% (from 0.95 ± 0.04 to 0.71 ± 0.04 relative units; P < 0.01) vs. baseline as demonstrated in the control subjects. The postclamp Shc mRNA level was slightly higher in the diabetic twins (P = 0.05) but similar in the nondiabetic twins, as compared with the control subjects, whereas postclamp IRS-1 and IRS-2 mRNA levels were similar between the study groups. There was an inverse correlation between postclamp Shc mRNA concentration and glucose uptake (r = -0.53, P = 0.01; n = 22) in the controls and nondiabetic twins. However, the decrease in Shc gene expression by insulin was not significantly different between the study groups. In conclusion, because insulin down-regulates IRS-1, IRS-2, and Shc gene expression in skeletal muscle in diabetic and nondiabetic monozygotic twins and control subjects to the same extent, it is unlikely that expression of these genes is an inherited trait or contributes to skeletal muscle insulin resistance.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
INSULIN BINDS TO and activates the insulin receptor kinase, which, in turn, phosphorylates insulin receptor substrates (IRSs). The major substrates of the insulin receptor are IRS-1, IRS-2, and Src homologous and collagen-like protein Shc (1, 2, 3), which are expressed in various tissues, including skeletal muscle. Upon phosphorylation, these substrates act as docking proteins for downstream complexes, leading to downstream mitogenic and metabolic effects, including insulin-mediated glucose uptake. Both IRS-1 and IRS-2 are necessary for insulin-stimulated Glut4 translocation via PI 3-kinase pathway in adipocytes and in skeletal muscle (1, 4, 5). Also, IRS-1 and Shc can interact with Son-of-sevenless/Grb-2 complex and thus activate the Ras/MAPK pathway. The Ras/MAPK pathway has also been shown to enhance membrane Glut 4 intrinsic activity in adipose cells and L6 myotubes (6). To date, no consistent mutations have been found in IRS-2 and Shc genes responsible for muscle insulin resistance in type 2 diabetes, apart from a polymorphism in the IRS-1 gene implicated in ß-cell dysfunction (7, 8, 9). Insulin has been ascribed a regulatory effect on the expression of some genes involved in insulin action and glucose metabolism in human skeletal muscle, including up-regulation of PI 3-kinase, Glut4, hexokinase II, Rad, and glycogen synthase (10, 11, 12, 13, 14), and down-regulation of lipoprotein lipase (10). Altered gene expression of hexokinase II, PI 3-kinase, and glycogen synthase has been reported in muscle of type 2 diabetic patients (12, 13, 14, 15). Little is known about whether altered IRS-1, IRS-2, and Shc gene expression is an inherited trait or associated with muscle insulin resistance or type 2 diabetes. To address this question, we analyzed IRS-1, IRS-2, and Shc gene expression in muscle biopsies taken before and after an insulin clamp from 12 control subjects and from 12 monozygotic twins pairs discordant for type 2 diabetes (16, 17). The study of monozygotic twins discordant for diabetes allowed us to study whether the potential defect of gene expression is under genetic control.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Subjects

Twelve Caucasian monozygotic twin pairs discordant for type 2 diabetes and 12 healthy subjects without family history of diabetes participated in the study. Type 2 diabetes had been diagnosed after the age of 40 yr, based on a standardized 75-g oral glucose tolerance test (18). The control subjects were matched to the nondiabetic twins for age, sex, and body mass index (Table 1Go). Monozygosity of the twins was confirmed by genetic markers (16). Insulin sensitivity was measured by a 3-h euglycemic hyperinsulinemic clamp with prior infusion of insulin (16, 17). Muscle biopsies were obtained in the basal state (0 min) and at the end of the clamp (+180 min), frozen immediately in liquid nitrogen, and stored at -80 C until analyzed. Informed consent was obtained from all subjects. The protocol was approved by the regional ethics committee, and the study was conducted according to the principles of the Declaration of Helsinki.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical characteristics of the diabetic and nondiabetic monozygotic twins and the control subjects

 
Quantitation of IRS-1, IRS-2, and SHC gene expression

RNA expression was examined using a modified primer-dropping RT-PCR method (19). Total RNA was isolated from the muscle biopsies by the acid guanidinium thiocyanate method (20) and was subjected to DNase I (Promega Corp., Madison, WI) treatment, according to the manufacturer’s instruction, to avoid genomic DNA contamination. The treated total RNA (400 ng) was then reverse-transcribed in a 40-µl reaction with a 5-µM oligo(dT)18 primer in the presence of 200 U SUPERSCRIPT II reverse transcriptase (RT) (Life Technologies, Inc., Glasgow, Scotland) and 25 µM deoxynucleotide triphosphate for 60 min at 37 C. After heat inactivation of the RT at 95 C for 5 min, total cDNA was subjected to PCR coamplification of IRS-1, IRS-2, Shc genes, together with cyclophilin as a reference gene. Cyclophilin was used as a reference gene because it is unaffected by insulin and the diabetic state (21). Validation of this method has been described in a previous study (11). The primer pairs for IRS-1 were (from 5' to 3') CTTCTGTCAGGTGTCCATCC and CTCTGCAGCAATGCCTGTTC; for IRS-2, ACAATGGTGACTACACCGAG and CTGCTTTTCCTGAGAGAGAC; and for Shc, GGGACCTGTTTGACATGAAG and TAGGGAATAGGGTGGAAAGG. The Shc primers define a region that is included in all the 3 Shc isoforms p66, p52, and p46. The primer pairs for cyclophilin (cycloF-cycloR or cycloF-cycloR2) were: GTCTCCTTTGAGCTGTTTGC (cycloF), TGGCCTCCACAATATTCATGC (cycloR), CTGGGAACCATTTGTGTTGG (cycloR2). To study the effect of insulin on gene expression, we measured IRS-1, IRS-2, and Shc mRNA levels in skeletal muscle biopsies from 12 control subjects, before and after a euglycemic clamp, using the following conditions: For IRS-1, the PCR reaction (20 µl) contains 2 µl RT reaction, 1x PCR buffer, 200 µM deoxynucleotide triphosphate, 5% dimethylsulfoxide, 5% formamide, 0.5 U Taq polymerase, 0.25 µM IRS-1 primers, and 0.2 µM cyclophilin primers (cycloF-cycloR2). The PCR was run for 36 cycles (94 C, 30 sec; 55 C, 30 sec; 72 C, 30 sec) and followed by a final extension at 72 C for 10 min. For IRS-2 and Shc, the PCR conditions were similar to that of IRS-1 except for cycle numbers and primer concentrations (44 for 0.25 µM IRS-2 primers, 40 for 0.2 µM cycloF-cycloR2; 34 for 0.2 µM Shc primers, 34 for 0.2 µM cycloF-cycloR). The PCR conditions were optimized according to the primer-dropping method (19) for each individual gene. PCR products were separated on a 2% agarose gel containing ethidium bromide, photographed with UPP-110HA printing paper (Sony, Tokyo, Japan), and quantitated using a Personal Densitometer SI scanner together with ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA). The mRNA signals were expressed relative to that of cyclophilin. To examine whether altered gene expression of IRS-1, IRS-2, and Shc is associated with type 2 diabetes, we measured basal and postclamp mRNA concentrations of these genes in all three groups (Table 1Go). We used the same conditions as described above for measuring basal IRS-1, IRS-2, and Shc mRNA concentrations. Postclamp Shc mRNA concentrations were also measured under the same conditions as above, but postclamp IRS-1 and IRS-2 mRNA concentrations were measured using different conditions. This was because the IRS-1 and IRS-2 mRNA concentrations in some postclamp samples were too low to measure using the conditions described above. To measure such low mRNA concentrations and to allow a direct comparison of them among the groups, we had to change the conditions for postclamp IRS-1 and IRS-2 concentration measurements.

Analytical measurements

Plasma glucose was determined with a glucose oxidase method (Glucose Analyzer 2; Beckman Coulter, Inc. Instruments, Fullerton, CA). Plasma insulin was measured using a double-antibody RIA (Pharmacia Diagnostics, Uppsala, Sweden) (16, 17).

Statistical analysis

Data are expressed as means ± SEM. Statistical analysis was performed using an NCSS 6.0.21 statistical package (NCSS Statistical Software, Kaysville, UT). The significance of differences within or between groups was tested by Wilcoxon or Mann-Whitney rank tests. The relationship between various variables was analyzed by Spearman correlations.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Clinical characteristics of the subjects

Fasting plasma glucose levels were higher in both the diabetic and the nondiabetic twins, whereas fasting plasma insulin levels were higher only in diabetic twins, compared with those of the control subjects (Table 1Go). Plasma insulin concentrations in the basal state and during the clamp were similar in the diabetic (69.6 ± 16.5 and 528.1 ± 51.6 pM) and the nondiabetic (50.9 ± 6.4 and 497.9 ± 40.9 pM) twins as well as in the control subjects (45.9 ± 5.0 and 559.6 ± 32.3 pM). The diabetic twins had 55% lower rates of insulin-stimulated glucose uptake (P < 0.01), 63% lower rates of glucose storage (P < 0.01), and 37% lower rates of glucose oxidation (P < 0.01), compared with the control subjects (Table 1Go). The nondiabetic monozygotic co-twins also had a 25% lower rate of insulin-stimulated glucose uptake [8.5 ± 0.8 vs. 11.4 ± 0.9 mg/kg fat free mass (FFM) per min; P < 0.03], which was particularly caused by a 37% decrease in the rate of glucose storage (4.8 ± 0.6 vs. 7.6 ± 0.9 mg/kg FFM per min; P < 0.02), compared with the control subjects (Table 1Go).

IRS-1, IRS-2, and Shc gene expression

Basal IRS-1, IRS-2, and Shc mRNA levels were similar in the diabetic and nondiabetic twins as well as in the control subjects (Table 2Go). Insulin infusion decreased IRS-1 mRNA levels 3.6-fold (from 0.75 ± 0.06 to 0.21 ± 0.04 relative units; P < 0.001); IRS-2, 3.4-fold (from 0.55 ± 0.10 to 0.16 ± 0.08 relative units; P < 0.03); and Shc, 1.3-fold (from 0.95 ± 0.04 to 0.71 ± 0.04 relative units; P < 0.01) vs. baseline as demonstrated in the control subjects (Fig. 1Go). The postclamp Shc mRNA level was slightly higher in the diabetic twins (P = 0.05) but similar in the nondiabetic twins, as compared with the control subjects (Table 2Go), whereas postclamp IRS-1, IRS-2 mRNA levels were similar in all three groups (Table 2Go). There was an inverse correlation between the postclamp Shc mRNA concentration and the insulin-mediated glucose uptake (M-value) in all subjects (r = -0.52, P < 0.01). This correlation was also observed in the combined group of the control subjects and the nondiabetic twins (r = -0.53, P = 0.01), whereas no correlation was observed between the basal Shc mRNA concentration and the M-value. However, the change in Shc gene expression between basal and postclamp states was not significantly different among the three groups. Neither basal nor postclamp IRS-1 and IRS-2 mRNA concentrations showed any significant correlation with the M-values, either in all subjects or in the subgroups (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 2. IRS-1, IRS-2, and Shc mRNA expression in the diabetic and nondiabetic monozygotic twins and the control subjects

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. The effect of insulin on IRS-1, IRS-2, and Shc mRNA expression in skeletal muscle of 12 control subjects. Total RNA was extracted from muscle biopsies taken before and after a 3-h euglycemic insulin clamp. mRNA expression was measured by relative RT-PCR and expressed relative to cyclophilin. Insulin infusion decreased mRNA expression of IRS-1 by 72% (P < 0.001), IRS-2 by 71% (P < 0.03), and Shc by 25% (P < 0.01). B, baseline; C, clamp.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
In this study, we examined the gene expression of three substrates of the insulin receptor kinase, i.e. IRS-1, IRS-2, and Shc, in skeletal muscle from monozygotic twins discordant for diabetes and healthy control subjects. Whereas insulin clearly decreased expression of these substrates, no difference was seen between diabetic and control subjects, nor between diabetic and nondiabetic twins. It is well established that insulin stimulates phosphorylation of IRS-1, IRS-2, and Shc through binding to and activation of the insulin receptor kinase, thereby activating downstream effectors. Phosphorylation occurs rapidly, within a few minutes after insulin stimulation. However, after prolonged insulin treatment, desensitization to insulin action occurs at multiple steps, including both protein and mRNA changes. Insulin-induced receptor down-regulation, as reflected by a decrease in insulin binding, has been reported in murine NIH 3T3 HIR3.5 fibroblasts (22). In this cell model, the decrease in insulin binding is associated with decreased cellular insulin receptor content (22). In rat AR42J pancreatic acinar cells (23) and in human HepG2 hepatocytes (24), the decrease in the insulin receptor protein concentration could be, at least in part, attributed to decreased insulin receptor mRNA concentration. However, in rat hepatoma cells, insulin down-regulation of the receptor may not be sufficient to completely account for insulin desensitization (25). Therefore, a down-regulation of postreceptor substrates has been proposed (25) and demonstrated in rat hepatoma cells (26). Song et al. ( 27) showed that IRS-1 and IRS-2 phosphorylation was initially increased and subsequently decreased, in a time-dependent manner, in three types of rat skeletal muscles incubated with insulin for 40 min. In keeping with these results, we observed a decrease in mRNA concentrations of IRS-1, IRS-2, and Shc in human skeletal muscle after a 3-h insulin clamp, achieving plasma insulin concentrations of about 500 pM. Similar results have been reported by Andreelli et al. (15), who observed a 2-fold reduction in IRS-1 mRNA expression in human skeletal muscle after a 3-h clamp, with somewhat higher insulin concentrations (approximately 900 pM). More recently, Ducluzeau et al. (14) reported down-regulation of IRS-1 mRNA in skeletal muscle after a 3-h euglycemic insulin clamp, without differences between control subjects and patients with type 2 diabetes. Also compatible with these results, decreased mRNA and protein levels of IRS-1 and IRS-2 have been reported in skeletal muscle of the ob/ob mice (28), Zucker fatty rats ( 29), and Sprague Dawley rats fed with high-fat diet (30). In addition, a recent study by Shimomura et al. (31) reported that chronic hyperinsulinemia also reduces the amount of IRS-2 mRNA and protein in mouse liver, both in vivo and in vitro. No data are, to our knowledge, available on the effect of insulin on Shc gene expression in human skeletal muscle. Together, the data clearly show that insulin down-regulates gene expression of IRSs in skeletal muscle. If this down-regulation is associated with a similar reduction in protein levels, this could, of course, present a mechanism by which insulin signaling is down-regulated, providing that phosphorylation of these substrates also is impaired by insulin. Given the recent identification of calpain 10 as a putative candidate gene for type 2 diabetes (32), it is interesting to note that calpains have been ascribed a role in insulin-mediated breakdown of the IRS protein (33). The mechanism by which insulin decreases IRS mRNA concentrations is unknown. Recently, it has been demonstrated that the PKC isoform, PKC-{delta}, positively regulates IRS-1 gene transcription in human breast cancer cells (34). It has also been shown that insulin causes translocation of PKC-{delta} from the cytosol to the cell membrane in both rat and human skeletal muscle (35, 36). Whether insulin-mediated PKC-{delta} translocation could influence transcription of IRSs in human skeletal muscle is currently unknown.

It is also clear, from our results, that the capacity of insulin to down-regulate expression of the IRS-1, IRS-2, and Shc genes is not resistant to the effect of insulin. We did not find any correlation between the degree of IRS-1 and IRS-2 gene down-regulation and the M-value, either in the diabetic or in the control subjects. In contrast, the postclamp Shc gene expression was inversely correlated with the M-value, particularly in the nondiabetic subjects. It is unclear whether the slight increase in Shc mRNA concentrations seen in the diabetic twins really has a physiological meaning. Similar results were reported by Andreelli et al. (15) and Ducluzeau et al. (14), who observed that insulin down-regulation of the IRS-1 gene was not impaired in muscle from obese and type 2 diabetic patients. Although fasting hyperinsulinemia and insulin resistance are hallmarks of IGT and mild diabetes, we did not see any impairment in the down-regulatory effect of insulin on expression of IRS-1 and IRS-2 in these subjects. One could hypothesize that chronic hyperinsulinemia could cause a reduction in mRNA expression similar to that of the insulin infusion. On the other hand, we do not know the dose-response characteristics of the effect of insulin on expression of these genes, i.e. whether fasting hyperinsulinemia in the range of 50–80 pM is sufficient to do the same as 500 pM insulin during the clamp. Although protein levels were not examined in this study, some other studies have shown decreased levels of IRS-1 and IRS-2 proteins in muscle from obese humans (37) and insulin-resistant animals (28, 29, 38). Moreover, chronic insulin treatment of adipocytes increased degradation of IRS-1 protein but did not change mRNA expression of IRS-1 (33, 39, 40, 41). In conclusion, because insulin down-regulates IRS-1, IRS-2, and Shc gene expression in skeletal muscle in the diabetic and nondiabetic monozygotic twins and the control subjects to the same extent, it is unlikely that expression of these genes is a heritable trait or contributes to skeletal muscle insulin resistance.


    Acknowledgments
 


    Footnotes
 
This work was supported by grants from Albert Pahlsson Foundation, Crafoord Foundation, Sigrid Juselius Foundation, MAS Foundation at Lund University, and Ingabritt and Arne Lundberg Foundation.

Abbreviations: FFM, Fat free mass; IRS, insulin receptor substrate; M-value, insulin-mediated glucose uptake; RT, reverse transcriptase; Shc, Src homologous and collagen-like protein.

Received March 19, 2001.

Accepted September 28, 2001.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Cheatham B, Kahn CR 1995 Insulin action and the insulin signaling network. Endocr Rev 16:117–142[Abstract/Free Full Text]
  2. Kahn CR 1994 Banting Lecture. Insulin action, diabetogenes, and the cause of type II diabetes. Diabetes 43:1066–1084[Medline]
  3. White MF, Kahn CR 1994 The insulin signaling system. J Biol Chem 269:1–4[Free Full Text]
  4. Quon MJ, Butte AJ, Zarnowski MJ, Sesti G, Cushman SW, Taylor SI 1994 Insulin receptor substrate 1 mediates the stimulatory effect of insulin on GLUT4 translocation in transfected rat adipose cells. J Biol Chem 269:27920–27924[Abstract/Free Full Text]
  5. Zhou L, Chen H, Lin CH, Cong LN, McGibbon MA, Sciacchitano S, Lesniak MA, Quon MJ, Taylor SI 1997 Insulin receptor substrate-2 (IRS-2) can mediate the action of insulin to stimulate translocation of GLUT4 to the cell surface in rat adipose cells. J Biol Chem 272:29829–29833[Abstract/Free Full Text]
  6. Sweeney G, Somwar R, Ramlal T, Volchuk A, Ueyama A, Klip A 1999 An inhibitor of p38 mitogen-activated protein kinase prevents insulin-stimulated glucose transport but not glucose transporter translocation in 3T3–L1 adipocytes and L6 myotubes. J Biol Chem 274:10071–10078[Abstract/Free Full Text]
  7. Bernal D, Almind K, Yenush L, Ayoub M, Zhang Y, Rosshani L, Larsson C, Pedersen O, White MF 1998 Insulin receptor substrate-2 amino acid polymorphisms are not associated with random type 2 diabetes among Caucasians. Diabetes 47:976–979[Medline]
  8. Porzio O, Federici M, Hribal ML, Lauro D, Accili D, Lauro R, Borboni P, Sesti G 1999 The Gly972–>Arg amino acid polymorphism in IRS-1 impairs insulin secretion in pancreatic beta cells. J Clin Invest 104:357–364[Medline]
  9. Almind K, Ahlgren MG, Hansen T, Urhammer SA, Clausen JO, Pedersen O 1999 Discovery of a Met300Val variant in Shc and studies of its relationship to birth weight and length, impaired insulin secretion, insulin resistance, and type 2 diabetes mellitus. J Clin Endocrinol Metab 84:2241–2244[Abstract/Free Full Text]
  10. Laville M, Auboeuf D, Khalfallah Y, Vega N, Riou JP, Vidal H 1996 Acute regulation by insulin of phosphatidylinositol-3-kinase, Rad, Glut 4, and lipoprotein lipase mRNA levels in human muscle. J Clin Invest 98:43–49[Medline]
  11. Huang X, Eriksson KF, Vaag A, Lehtovirta M, Hansson M, Laurila E, Kanninen T, Olesen BT, Kurucz I, Koranyi L, Groop L 1999 Insulin-regulated mitochondrial gene expression is associated with glucose flux in human skeletal muscle. Diabetes 48:1508–1514[Abstract]
  12. Huang X, Vaag A, Hansson M, Weng J, Laurila E, Groop L 2000 Impaired insulin-stimulated expression of the glycogen synthase gene in skeletal muscle of type 2 diabetic patients is acquired rather than inherited. J Clin Endocrinol Metab 85:1584–1590[Abstract/Free Full Text]
  13. Pendergrass M, Koval J, Vogt C, Yki-Jarvinen H, Iozzo P, Pipek R, Ardehali H, Printz R, Granner D, Defronzo RA, Mandarino LJ 1998 Insulin-induced hexokinase II expression is reduced in obesity and NIDDM. Diabetes 47:387–394[Abstract]
  14. Ducluzeau PH, Perretti N, Laville M, Andreelli F, Vega N, Riou JP, Vidal H 2001 Regulation by insulin of gene expression in human skeletal muscle and adipose tissue. Evidence for specific defects in type 2 diabetes. Diabetes 50:1134–1142[Abstract/Free Full Text]
  15. Andreelli F, Laville M, Ducluzeau PH, Vega N, Vallier P, Khalfallah Y, Riou JP, Vidal H 1999 Defective regulation of phosphatidylinositol-3-kinase gene expression in skeletal muscle and adipose tissue of non-insulin-dependent diabetes mellitus patients. Diabetologia 42:358–364[CrossRef][Medline]
  16. Vaag A, Henriksen JE, Madsbad S, Holm N, Beck Nielsen H 1995 Insulin secretion, insulin action, and hepatic glucose production in identical twins discordant for non-insulin-dependent diabetes mellitus. J Clin Invest 95: 690–698
  17. Vaag A, Alford F, Beck Nielsen H 1996 Intracellular glucose and fat metabolism in identical twins discordant for non-insulin-dependent diabetes mellitus (NIDDM): acquired versus genetic metabolic defects? Diabet Med 13:806–815[CrossRef][Medline]
  18. WHO Study Group 1985 Diabetes mellitus: Technical Report Series 727. Geneva: World Health Organization
  19. Wong H, Anderson WD, Cheng T, Riabowol KT 1994 Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method. Anal Biochem 223:251–258[CrossRef][Medline]
  20. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  21. Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D, Warden CH 1997 Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15:269–272[CrossRef][Medline]
  22. Treadway JL, Whittaker J, Pessin JE 1989 Regulation of the insulin receptor kinase by hyperinsulinism. J Biol Chem 264:15136–15143[Abstract/Free Full Text]
  23. Okabayashi Y, Maddux BA, McDonald AR, Logsdon CD, Williams JA, Goldfine ID 1989 Mechanisms of insulin-induced insulin-receptor down-regulation. Decrease of receptor biosynthesis and mRNA levels. Diabetes 38:182–187[Abstract]
  24. Rohilla AM, Anderson C, Wood WM, Berhanu P 1991 Insulin down-regulates the steady-state level of its receptor’s messenger ribonucleic acid. Biochem Biophys Res Commun 175:520–526[CrossRef][Medline]
  25. Heaton JH, Gelehrter TD 1981 Desensitization of hepatoma cells to insulin action. Evidence for a post-receptor mechanism. J Biol Chem 256:12257–12262[Abstract/Free Full Text]
  26. Saad MJ, Folli F, Kahn CR 1995 Insulin and dexamethasone regulate insulin receptors, insulin receptor substrate-1, and phosphatidylinositol 3-kinase in Fao hepatoma cells. Endocrinology 136:1579–1588[Abstract]
  27. Song XM, Ryder JW, Kawano Y, Chibalin AV, Krook A, Zierath JR 1999 Muscle fiber type specificity in insulin signal transduction. Am J Physiol 277:R1690–R1696
  28. Kerouz NJ, Horsch D, Pons S, Kahn CR 1997 Differential regulation of insulin receptor substrates-1 and -2 (IRS-1 and IRS-2) and phosphatidylinositol 3- kinase isoforms in liver and muscle of the obese diabetic (ob/ob) mouse. J Clin Invest 100:3164–3172[Medline]
  29. Anai M, Funaki M, Ogihara T, Terasaki J, Inukai K, Katagiri H, Fukushima Y, Yazaki Y, Kikuchi M, Oka Y, Asano T 1998 Altered expression levels and impaired steps in the pathway to phosphatidylinositol 3-kinase activation via insulin receptor substrates 1 and 2 in Zucker fatty rats. Diabetes 47:13–23[Abstract]
  30. Kim YB, Nakajima R, Matsuo T, Inoue T, Sekine T, Komuro M, Tamura T, Tokuyama K, Suzuki M 1996 Gene expression of insulin signal-transduction pathway intermediates is lower in rats fed a beef tallow diet than in rats fed a safflower oil diet. Metabolism 45:1080–1088[CrossRef][Medline]
  31. Shimomura I, Matsuda M, Hammer RE, Bashmakov Y, Brown MS, Goldstein JL 2000 Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol Cell 6:77–86[CrossRef][Medline]
  32. Horikawa Y, Oda N, Cox NJ, Li X, Orho-Melander M, Hara M, Hinokio Y, Lindner TH, Mashima H, Schwarz PE, del Bosque-Plata L, Oda Y, Yoshiuchi I, Colilla S, Polonsky KS, Wei S, Concannon P, Iwasaki N, Schulze J, Baier LJ, Bogardus C, Groop L, Boerwinkle E, Hanis CL, Bell GI 2000 Genetic variation in the gene encoding calpain-10 is associated with type 2 diabetes mellitus. Nat Genet 26:163–175[CrossRef][Medline]
  33. Smith LK, Rice KM, Garner CW 1996 The insulin-induced down-regulation of IRS-1 in 3T3–L1 adipocytes is mediated by a calcium-dependent thiol protease. Mol Cell Endocrinol 122:81–92[CrossRef][Medline]
  34. deVente JE, Carey JO, Bryant WO, Pettit GJ, Ways DK 1996 Transcriptional regulation of insulin receptor substrate 1 by protein kinase C. J Biol Chem 271:32276–32280[Abstract/Free Full Text]
  35. Yamada K, Avignon A, Standaert ML, Cooper DR, Spencer B, Farese RV 1995 Effects of insulin on the translocation of protein kinase C-theta and other protein kinase C isoforms in rat skeletal muscles. Biochem J 308:177–180
  36. Itani SI, Zhou Q, Pories WJ, MacDonald KG, Dohm GL 2000 Involvement of protein kinase C in human skeletal muscle insulin resistance and obesity. Diabetes 49:1353–1358[Abstract]
  37. Goodyear LJ, Giorgino F, Sherman LA, Carey J, Smith RJ, Dohm GL 1995 Insulin receptor phosphorylation, insulin receptor substrate-1 phosphorylation, and phosphatidylinositol 3-kinase activity are decreased in intact skeletal muscle strips from obese subjects. J Clin Invest 95:2195–2204
  38. Friedman JE, Ishizuka T, Liu S, Farrell CJ, Bedol D, Koletsky RJ, Kaung HL, Ernsberger P 1997 Reduced insulin receptor signaling in the obese spontaneously hypertensive Koletsky rat. Am J Physiol 273:E1014–E1023
  39. Ricort JM, Tanti JF, Van Obberghen E, Le Marchand-Brustel Y 1995 Alterations in insulin signalling pathway induced by prolonged insulin treatment of 3T3–L1 adipocytes. Diabetologia 38:1148–1156[Medline]
  40. Rice KM, Turnbow MA, Garner CW 1993 Insulin stimulates the degradation of IRS-1 in 3T3–L1 adipocytes. Biochem Biophys Res Commun 190:961–967[CrossRef][Medline]
  41. Sun XJ, Goldberg JL, Qiao LY, Mitchell JJ 1999 Insulin-induced insulin receptor substrate-1 degradation is mediated by the proteasome degradation pathway. Diabetes 48:1359–1364[Abstract]



This article has been cited by other articles:


Home page
EndocrinologyHome page
F. Renstrom, J. Buren, and J. W. Eriksson
Insulin Receptor Substrates-1 and -2 Are Both Depleted but via Different Mechanisms after Down-Regulation of Glucose Transport in Rat Adipocytes
Endocrinology, July 1, 2005; 146(7): 3044 - 3051.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, X.
Right arrow Articles by Groop, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, X.
Right arrow Articles by Groop, L.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Medline Plus Health Information
*Diabetes


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals