help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riepe, F. G.
Right arrow Articles by Sippell, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riepe, F. G.
Right arrow Articles by Sippell, W. G.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 9 4353-4357
Copyright © 2001 by The Endocrine Society


Other Original Articles

Longitudinal Imaging Reveals Pituitary Enlargement Preceding Hypoplasia in Two Brothers with Combined Pituitary Hormone Deficiency Attributable to PROP1 Mutation

Felix G. Riepe, Carl-Joachim Partsch, Oliver Blankenstein, Heiner Mönig, Roland W. Pfäffle and Wolfgang G. Sippell

Division of Pediatric Endocrinology (F.G.R., C.-J.P., W.G.S.), Department of Pediatrics, and Department of Internal Medicine (H.M.), Christian-Albrechts-University, D-24105 Kiel, Germany; and Department of Pediatrics (O.B., R.W.P.), Aachen University of Technology (RWTH), D-52074 Aachen, Germany

Abstract

Mutations of the PROP-1 gene cause combined pituitary hormone deficiency. Progressive ACTH/cortisol insufficiency is found in a few patients. Congenital hypoplasia of the anterior pituitary gland is the most common magnetic resonance imaging finding in patients with PROP-1 mutations. We present two brothers with compound heterozygosity for the two mutations 150delA and 301–302delAG of the PROP-1 gene. Both showed combined pituitary hormone deficiency of GH, TSH, PRL, and gonadotropins, as is typical for PROP-1 deficiency. We observed a developing insufficiency of ACTH and cortisol secretory capacity in both patients. Computed tomography revealed an enlarged pituitary in the older brother at 3.5 yr of age. Repeated magnetic resonance imaging after 12 yr showed a constant hypoplasia of the anterior pituitary lobe. Similarly, magnetic resonance imaging of the younger brother showed a constant enlargement of the anterior pituitary gland until 10 yr. At the age of 11 yr, the anterior pituitary was hypoplastic. The reason for pituitary enlargement in early childhood with subsequent decrease in pituitary size is not known. We speculate that altered expression of early transcription factors could be involved. Because both patients have the same PROP-1 mutations and an identical pattern of combined pituitary hormone deficiency, we suggest that early pituitary enlargement may be the typical course in such patients in whom pituitary surgery is not indicated.

A CASCADE OF pituitary transcription factors is responsible for the organogenesis of the anterior pituitary gland. Disturbances of single transcriptional factors can lead to congenital combined pituitary hormone deficiency (CPHD). One of these transcription factors is the PROP-1 protein. PROP-1 is involved in the ontogenesis of pituitary gonadotrophs, somatotrophs, lactotrophs, and thyrotrophs. A missense mutation of the murine Prop-1 gene is responsible for the Ames dwarfism in mice (1). The first examples of PROP-1 mutations in humans were reported by Wu et al. (2). Eight distinct mutations have been identified so far. These PROP-1 mutant alleles include 301–302delAG, R120C, F117I, 149delAG, codon50delA, R73C, 342-343delAT, F88S, and 112–124del (2, 3, 4, 5, 6, 7, 8, 9, 10, 11). The affected patients suffer from LH, FSH, GH, PRL, and TSH deficiency. Some develop ACTH deficiency (11, 12).

Most patients with PROP-1 mutations have a hypoplastic pituitary gland (2, 4, 8, 10, 12, 13, 14). However, there are various reports of pituitary enlargement in patients with PROP-1 mutations (4, 13, 15, 16). There seems to be no genotype-phenotype correlation and even no consistency in siblings (12). Reports of a longitudinal follow-up of pituitary morphology are available for a few patients only (Table 1Go) (13, 16).


View this table:
[in this window]
[in a new window]
 
Table 1. Pituitary morphology and follow-up in patients with PROP1 mutations

 
In this report, we focus on the pituitary size in two brothers with inactivating PROP-1 deletions studied prospectively for almost 12 yr and try to explain the considerable variations in pituitary sizes in patients with loss of function of PROP-1.

Subjects and Methods

Subjects

Two brothers with compound heterozygosity for the mutations delA150/delAG301/302 of the PROP-1 gene were followed longitudinally. Parental informed consent was obtained before the study. Both show combined pituitary hormone deficiency of GH, PRL, TSH, and gonadotropins. The father’s height is 177 cm (-0.5 SD score), and the mother’s height is 166 cm (-0.2 SD score), resulting in a target height of 178 ± 8.5 cm for the two boys. None of the first-degree relatives is affected by short stature, hypothyroidism, or hypogonadism.

Patient 1, the older brother, was born by spontaneous vaginal delivery at term. Birth weight was 3520 g (50th centile), the length was 52 cm (50th centile), and the Apgar scores were 9/10/10. He was breast-fed until 4 months. Early psychomotor development was delayed. Failure to thrive was noticed at 3.5 yr. He presented with a height of 87.1 cm (-4.0 SD score) at that time. CPHD was diagnosed by standard stimulation tests. Treatment was initiated with T4 (50 µg/d) and biosynthetic GH (12 IU/m2 body surface/week). Pretreatment growth velocity was 5.4 cm/yr and increased to 15.2 cm/yr during the first year of GH therapy. Hydrocortisone replacement was prescribed for stress situations. At the age of 10 yr, thyroxine was increased to 75 µg/d. Sex steroid substitution was started at the age of 13 yr with testosterone undecenoate orally in increasing doses. At present, the patient is 15 yr of age and is doing well under replacement therapy. His height-SD score improved to -0.4 (current height, 175.9 cm).

Patient 2, the younger brother, was born at term after an uneventful pregnancy by spontaneous delivery. Birth weight and length were normal [3250 g (25th centile), 50 cm (20th centile)]. Apgar scores were 9/10/10. Breast feeding was done for 3 months. Early development was delayed. At the age of 1 yr, his height was 67 cm (-3.4 SD score). Treatment with 50 µg of T4 per day was started. Hydrocortisone replacement was prescribed for stress situations. At 11 yr, the dose was increased to 75 µg daily. Diagnosis of CPHD including GH deficiency was established after stimulation testing at age 1.9 yr. Treatment with biosynthetic GH (12 IU/m2 body surface/week) was started. Pretreatment growth velocity was 7.7 cm/yr, which increased to 13.6 cm/yr during the first year of GH therapy. Currently, the patient is 12 yr of age and is doing well under substitution treatment. His height-SD score improved to -0.4 (current height, 150.2 cm). Testosterone replacement was started recently.

Endocrinological investigations

The diagnosis of CPHD for GH, PRL, TSH, and gonadotropins was made by standard stimulation tests. GH secretion was tested by 21% arginine hydrochloride (0.5 g/kg iv; B. Braun, Melsungen, Germany), GHRH (1 µg/kg iv; Ferring Pharmaceuticals Ltd., Kiel, Germany), and glucagon (0.05 mg/kg im; GlucaGen, Novo Nordisk Pharma, Mainz, Germany) plus propanolol (1 mg/kg orally; Dociton, Zeneca Pharmaceuticals, Plankstadt, Germany). GH, PRL, and TSH were measured by RIA, monoclonal immunoradiometric assay, and electroimmunoassay, respectively (Seria hGH and PRL MAIA Clone, Serono Diagnostika, Freiburg, Germany; TSH microparticle electroimmunoassay, Abbott, Wiesbaden, Germany). PRL and TSH were determined before and 30 min after TRH injection (200 µg/m2; Ferring Pharmaceuticals Ltd.). Gonadotropins were determined by monoclonal immunoradiometric assay (LH and FSH MAIA Clone, Serono Diagnostika) before and 30 min after GnRH stimulation (60 µg/m2 LH-releasing hormone; Ferring Pharmaceuticals Ltd.). Basal and free T4 were measured by microparticle electroimmunoassay (Abbott). The CRH stimulation test (Ferring Pharmaceuticals Ltd.) was performed using 1 µg/kg human CRH administered iv at 0900 h. Blood samples were collected for cortisol and ACTH measurements at -15, 0, 15, 30, 45, 60, 90, and 120 min after injection. ACTH was measured by an immunoluminescence assay (Lumitest ACTH, Brahms Diagnostics, Berlin, Germany). Cortisol was measured by RIA (BioChemImmuno Systems, Freiburg, Germany).

Analysis of the PROP-1 gene

DNA was extracted from peripheral blood lymphocytes of patients and their parents using the QIAGEN Blood Kit (QIAGEN, Hilden, Germany). PCR amplification was performed with oligonucleotides corresponding to intronic sequences surrounding the three coding PROP-1 exons (exon 1-sense, GTCAGAGATTCAGGGACACTTGG; exon 1-antisense, ATGCTTTCAGCCTCACACC; exon 2-sense, AGGCACATGTGGTCCAGCACC; exon 2-antisense, GATAGCACCAAAGAAATCTGC; exon 3-sense, CTTGTCATTGGAGTAGGGTGTC; exon 3-antisense, CAGGAATTCACCATGATCTCC). PCR was performed as follows: 50 µL of the reaction solution contained approximately 100 ng of genomic DNA, 50 pmol of each primer, 0.5 U of DNA polymerase from Thermus brockianus (Primezyme, Biometra, Göttingen, Germany), 200 µmol/liter of each deoxynucleotide, and 1.5 mmol/liter MgCl2 in 10 mmol/liter Tris-HCl and 50 mmol/liter KCl, pH 8.8, buffer. PCR was performed on a Mastercycler (Eppendorf, Hamburg, Germany). It consisted of 25 cycles of 92 C for 30 sec, 54 C for 30 sec, and 72 C for 1 min. PCR products were resolved on a 2% agarose gel and stained with ethidium bromide. PCR products were screened for the presence of a mutation by single stranded conformational polymorphism analysis. After purification of PCR products on Qiaquick columns (QIAGEN, Hilden, Germany), samples were denatured by heat and run on a 0.04 x 16.5 x 22 cm vertical gel electrophoresis chamber at 3 W for 17 h using a 0.5-fold concentrated MDE gel solution (Biozym Diagnostik, Oldendorf, Germany). Samples were visualized by silver staining. Automated sequencing was performed on a ABI 373A Sequencer (Perkin-Elmer Corp., Norwalk, CT) using the ABIPrism Dye Terminater Kit and following the cycle-sequencing protocol provided by the manufacturer.

Neuroradiological investigations

Sella turcica x-ray was done by lateral radiography of the skull. Computed tomography was performed with a Picker SD600 (Marconi/Picker, Cleveland, OH) with 2-mm slices. Magnetic resonance imaging was obtained with a 1-Tesla scanner (Magnetom Impact, Siemens, Berlin, Germany). Sagittal, coronal, and transverse T1- and T2-weighted images were obtained with a slice thickness of 2.0–2.5 mm. Strict midline position was assessed by simultaneous visualization of the stalk, the anterior lobe, and the posterior lobe of the pituitary gland and the Sylvius’ aqueduct. Maximal height of the pituitary gland was measured perpendicular to the sellar floor (17).

Results

Endocrinological findings

At 3.5 yr of age, patient 1 showed an inadequate maximum increase in GH plasma levels after stimulation by arginine and GHRH [0.3 -> 0.6 µg/liter (normal range for age and sex, 16.7 ± 1.29) and 0.6 -> 4.6 µg/liter (28.8 ± 2.0), respectively]. Basal PRL and TSH were normal [6.5 µg/liter (2–14.5) and 1.8 mIU/liter (0.85–6.48)] but failed to reach normal levels after TRH stimulation [9.7 µg/liter (13–32.5) and 2.7 mIU/liter (5.6–28.3), respectively]. T4 [5.7 nmol/liter (118.3–194.2)[ and free T4 [3.9 pmol/liter (12.1–22.0)] were subnormal. Basal gonadotropin levels were in the low prepubertal range and showed no response to GnRH [LH, <0.3 IU/liter (<0.3–2.5) -> <0.3 IU/liter (1.3–3.8); FSH, 0.4 IU/liter (<0.5–2.2) -> 0.7 IU/liter (2.6–6.3)]. Baseline cortisol at 3.4 yr was normal [325 nmol/liter (91–361)]. A hCRH stimulation test was performed at 15 yr of age. Basal ACTH was 4 pmol/liter (1–8). ACTH response to hCRH was 15 pmol/liter at 15 min (>18). Baseline cortisol at 15 yr was 210 nmol/liter (60–480). The peak cortisol level 30 min after hCRH was 500 nmol/liter (>513).

Patient 2 showed subnormal maximum GH responses to arginine [1.7 -> 2.3 µg/liter (16.7 ± 1.2)], glucagon/propanolol [2.1 -> 2.8 µg/liter (16.9 ± 1.9)], and GHRH [0.6 -> 5.9 µg/liter (28.8 ± 2.0)] at 1.9 yr of age. Basal PRL was low and showed an insufficient increase after TRH [2.1 µg/liter (2–14.5) -> 8.9 µg/liter (13–32.5)]. Basal TSH was normal but showed an inadequate increase after TRH [2.1 mIU/liter (0.85–6.48) -> 4.5 mIU/liter (5.6–28.3)]. Basal and free T4 were subnormal [4.5 nmol/liter (118.3–194.2) and 5.1 pmol/liter (12.1–22.0), respectively]. Gonadotropins were low and showed no increase after GnRH stimulation [LH, 0.4 IU/liter (<0.3–2.5) -> <0.3 IU/liter (1.3–3.8); FSH, <0.3 IU/liter (<0.5–2.2) -> 0.7 IU/liter (2.6–6.3)]. Baseline cortisol at that time was normal [247 nmol/liter (48–284)]. A CRH stimulation test was done at the age of 12 yr. Basal ACTH was normal [3 pmol/liter (1–8)]. ACTH response to CRH was subnormal [10 pmol/liter (>18)]. Baseline cortisol at 12 yr was 166 nmol/liter (60–480). The peak cortisol level 45 min after CRH stimulation was low [422 nmol/liter (>513)].

Genomic DNA analysis

Both brothers showed compound heterozygosity for a 1-bp deletion on one allele, which deletes codon 50 from GGA to GG, and a 2-bp deletion in codon 101 on the other allele, which deletes AGT to T. On both alleles, the reading frame is shifted, thereby creating a nonsense peptide starting from the site of mutation. The first mutation affects an amino acid N terminal of the homeodomain that is critical for the DNA-binding abilities of this transcription factor. All amino acids of the homeodomain, therefore, are affected. However, the new reading frame introduces a stop codon at codon 164, which is 104 amino acids downstream from the mutation. The 2-bp deletion affects an amino acid in the center of the second helix of the homeodomain. Just seven amino acids downstream, a termination codon is introduced by the altered reading frame. The father was heterozygous for the A150 deletion, and the mother was heterozygous for the A301/G302 deletions of codon 101.

Neuroradiological findings

An enlarged spherical sella ("cherry sella") was noticed by skull x-ray in patient 1 at age 3.5 yr. Computed tomography at that age revealed an enlarged pituitary 10 mm in diameter and 13 mm in height [normal height, 5.7 ± 1.8 mm; range, 2.5–7.0 mm (18)]. Magnetic resonance imaging at age 12, 13, and 14 yr showed a constant hypoplasia of the anterior pituitary lobe, with a pituitary height of 2 mm at all three investigations [normal pituitary height for age, 5.3 ± 0.8 mm (17)]. The position and size of the posterior lobe, the stalk, and the hypothalamus were normal (Fig. 1Go).



View larger version (182K):
[in this window]
[in a new window]
 
Figure 1. Patient 1. Top left, Lateral skull film at 3.5 yr; top right, computed tomography scan at 3.5 yr; bottom left, magnetic resonance image at 12 yr; bottom right, magnetic resonance image at 14 yr.

 
Lateral skull x-ray of patient 2 at 1 yr of age revealed a normal shape of the sella. Magnetic resonance imaging at 9 and 10 yr showed a constant enlargement of the anterior pituitary gland, with a pituitary height of 16 and 15 mm, respectively [normal height for age, 4.5 ± 0.6 mm (17)], but otherwise normal morphology. At the age of 11 yr, a marked hypoplasia of the anterior pituitary lobe with a pituitary height of only 2 mm [normal height for age, 4.5 ± 0.6 mm (17)] was found (Fig. 2Go).



View larger version (190K):
[in this window]
[in a new window]
 
Figure 2. Patient 2. Top left, Lateral skull film at 1 yr; top right, magnetic resonance image at 9 yr; bottom left, magnetic resonance image at 10 yr; bottom right, magnetic resonance image at 11 yr.

 
Discussion

The Prop-1 gene was first identified in the Ames dwarf mouse by Sornson et al. (1). The phenotype of Prop-1 mutant Ames mice includes the near absence of GH, TSH, and PRL and reduced levels of LH and FSH (20). The responsible defect for the Ames’s dwarfism was found to be a point mutation in the Prop-1 gene (Ser83Pro), which manifests a partial loss of function (1). The human PROP-1 phenotype involves deficiencies of GH, PRL, TSH, LH, and FSH, although some examples of progressing ACTH deficiency exist (11, 12, 13, 19). We report two brothers with CPHD caused by a compound heterozygosity for 301–302delAG/150delA in exon 2 of the PROP-1 gene. The 301–302AG deletion is the most common mutation of the human PROP-1 gene (2). To our knowledge, 45 cases with this mutation have been reported in the literature to date. Fofanova et al. (7) reported the first 149–150delGA deletion in Russian patients with CPHD. Both expressed proteins are free from DNA binding and transcriptional activation (2, 7). Because our two affected patients show compound heterozygosity for the 301–302delAG mutation and the 150delA mutation, they are not expected to produce a functional PROP-1 protein.

Both of our patients showed the classic CPHD phenotype, including GH, TSH, FSH, LH, and PRL deficiency. After retesting the two brothers at 12 and 15 yr, respectively, we could demonstrate impaired ACTH and cortisol secretory capacity after CRH. Baseline ACTH and cortisol levels were in the normal range, and neither patient so far had an adrenal crisis. These findings correspond well to various reports in the literature (11, 12, 13, 19).

Information regarding the pituitary size in humans with PROP-1 mutations is not consistent. Most patients with PROP-1 mutations have a hypoplastic anterior pituitary lobe (Table 1Go) (8, 12, 14). In contrast, there are few reports on patients with PROP-1 mutations and pituitary enlargement. In 1978, Parks et al. (22) reported on sellar enlargement in three siblings with CPHD. Enlargement of the anterior pituitary was also found in two of three Brazilian patients and in two Jamaican patients with the 301–302delAG mutation (15). Rosenbloom et al. (4) found three patients with a sellar enlargement in lateral skull x-rays. Mendonca et al. (13) performed the first longitudinal follow-up investigation of the pituitary morphology in one woman with a homozygous 301–302delAG mutation. She showed a pituitary enlargement at 8 yr of age. At 27 yr of age, the anterior pituitary was hypoplastic. The report of our patients is the first to show a longitudinal follow-up with neuroradiological imaging in two siblings with identical PROP-1 mutations. Both showed a pituitary enlargement in young infancy. At about 11 yr of age, however, their anterior pituitary glands became hypoplastic. The pituitary involution occurred within 1 yr in our second patient. Because no imaging was performed between ages 3.5 and 11 yr in the older brother, it is not known at what age his pituitary involuted. In contrast to our two brothers, the recently reported cases with pituitary enlargements showed no consistency of the pituitary size in siblings (23).

The reason for the changing pituitary size during childhood is not known. Pituitary organogenesis is controlled by a cascade of various transcription factors. As we know from mice, these factors are expressed during short periods of fetal development. The Hesx-1 gene, also referred to as Rpx, was the first known transcription factor expressed in regions responsible for the development of the anterior pituitary gland (24, 25). Hesx-1 expression is restricted to the oral ectoderm, which gives rise to Rathke’s pouch. Hesx-1 can be identified in the precursors of all pituitary cell types. Expression decreases from day e11.5 and is extinguished by day e13.5 in normal mice. Prop-1 is expressed in the pituitary from day e10.5 to e15.5, followed by the increase of Pit-1 (26, 27). After that, it is no longer recognized. In Prop-1 mutant Ames mice, the expression of a series of homeodomain factors continues beyond their normal time of expression. Hesx-1 is expressed in the anterior pituitary anlage until day e18.5 (26). Therefore, Prop-1 seems to be required as a down-regulator for Hesx-1. Because there is no Pit-1 expression in Ames dwarf mice from day e15.5 to e18.5, Prop-1 also may be necessary as a Pit-1 activator. Additionally, the POU domain factor Brn-4 and Prop-1 itself showed prolongation of pituitary expression in mice (1). The Ames pituitary shows a striking dysmorphogenesis that becomes apparent at day e13-e13.5. Although no reports regarding pituitary enlargement in Ames mice have been published and pituitary hypoplasia has been documented from early gestation until adulthood (26, 27), the pituitary size is not constant. During embryological development, the nascent anterior pituitary gland in Prop-1 mutant mice is about 50% smaller than in normal mice (26). The adult Ames mice have even smaller anterior pituitary glands (about 25% of normal size) (28, 29). The reason may be a further loss of immature precursor cells, more likely resulting from reduced proliferation than reduced cell survival, because there were no signs of apoptosis (26).

There are no data on pituitary transcription factors regarding their time of expression in humans. If a prolonged expression of transcription factors such as HESX-1, which is inversely correlated with pituitary differentiation (25), is recognizable in humans, one could speculate that undifferentiated precursor cells may be maintained for a longer time in a viable state and are thus responsible for pituitary masses. The histopathology of a surgically removed pituitary mass from a PROP-1-deficient Jamaican patient revealing no recognizable cell line but amorphous material would be compatible with this hypothesis (15). Higher levels of homeobox-containing genes are known to be associated with the proliferation of undifferentiated cells (30, 31). Because the Ames’s Prop-1 mutation is not a complete loss-of-function mutation, phenotypical differences to humans may not interfere with this hypothesis, because hyperplastic pituitaries were only found in patients with PROP-1 mutations resulting in a PROP-1 protein without biological function. It may be possible that various homeodomain factors are expressed in those cases even longer. The generation of a Prop-1 knockout mouse might help to elucidate this, because human material will not be available.

All pituitary masses in patients carrying PROP-1 mutations were seen in early childhood (13, 16, 22). Shrinkage of the pituitary was observed between 10 and 20 yr of age. The observation of cystic alterations of the pituitary may indicate an intermediate state of the shrinking gland (Parks, J. S., personal communication) (32). Pituitary enlargement was not seen in adulthood. This may be the consequence of the termination of specific transcription factor gene expression. Because pituitary enlargement is only seen in 301–302delAG mutations, we speculate that only specific gene defects may contribute to an overexpression of various pituitary transcription factors. As there is marked clinical heterogeneity among affected humans, it is unlikely that all patients will show the same pituitary involution. For some PROP-1 mutant humans, the sequence of pituitary enlargement followed by involution during the second decade of life resulting in pituitary hypoplasia may be the natural history of the disease.

For the clinician, it is important to recognize that PROP-1 mutations can present with pituitary enlargement during early childhood. Pituitary surgery is not indicated in patients with PROP-1 mutations. The pituitary tumor must not be mistaken for craniopharyngioma, pituitary adenoma, dysgerminoma, or Rathke’s pouch cyst.

Acknowledgments

Footnotes

Address for correspondence: Prof. Dr. Lmed. Wolfgang G. Sippell, Department of Pediatrics, Christian-Albrechts-University of Kiel, Schwanenweg 20, D-24105 Kiel, Germany.

This work was presented in part at the 39th Annual Meeting of the European Society for Pediatric Endocrinology, Brussels, Belgium, September 17–20, 2000.

Abbreviation: CPHD, Combined pituitary hormone deficiency.

Received November 30, 2000.

Accepted May 14, 2001.

References

  1. Sornson MW, Wu W, Dasen JS, et al. 1996 Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism. Nature 384:327–333[CrossRef][Medline]
  2. Wu W, Cogan JD, Pfäffle RW, Dasen JS, Frisch H, O’Connell SM 1998 Mutations in PROP1 cause familial combined pituitary hormone deficiency. Nat Genet 18:147–149[CrossRef][Medline]
  3. Duquesnoy P, Roy A, Dastot F, et al. 1998 Human Prop-1: cloning, mapping, genomic structure. Mutations in familial combined pituitary hormone deficiency. FEBS Lett 437:216–220[CrossRef][Medline]
  4. Rosenbloom AL, Almonte AS, Brown MR, Fisher DA, Baumbach L, Parks JS 1999 Clinical and biochemical phenotype of familial anterior hypopituitarism from mutation of the PROP1 gene. J Clin Endocrinol Metab 84:50–57[Abstract/Free Full Text]
  5. Krzisnik C, Kolacio Z, Battelino T, Brown MR, Parks JS, Laron Z 1999 The "little people" of the island of Krk revisited: etiology of hypopituitarism revealed. J Endocr Genet 1:9–19
  6. Cogan JD, Wu W, Phillips III JA, et al. 1998 The PROP1 2-base pair deletion is a common cause of combined pituitary hormone deficiency. J Clin Endocrinol Metab 83:3346–3349[Abstract/Free Full Text]
  7. Fofanova O, Takamura N, Kinoshita E, et al. 1998 Compound heterozygous deletion of the PROP1 gene in children with combined pituitary hormone deficiency. J Clin Endocrinol Metab 83:2601–2604[Abstract/Free Full Text]
  8. Flück C, Deladoey J, Rutishauser K, et al. 1998 Phenotypic variability in familial combined pituitary hormone deficiency caused by a PROP1 gene mutation resulting in the substitution of Arg->Cys at codon 120 (R120C). J Clin Endocrinol Metab 83:3727–3734[Abstract/Free Full Text]
  9. Fofanova OV, Takamura, Kinoshita E, et al. 1998 A mutational hot spot in the Prop-1 gene in Russian children with combined pituitary hormone deficiency. Pituitary 1:45–49[CrossRef][Medline]
  10. Osario MGF, Kopp P, Marui S, et al. 2000 Hypopituitarism in a Brazilian girl caused by a new mutation in Prop-1 (F88S). Horm Res 53(Suppl 2):58 (Abstract)
  11. Agarwal G, Bhatia V, Cook S, Thomas PQ 2000 Adrenocorticotropin deficiency in combined pituitary hormone deficiency patients homozygous for a novel PROP-1 deletion. J Clin Endocrinol Metab 85:4556–4561[Abstract/Free Full Text]
  12. Pernasetti F, Toledo SPA, Vyacheslav VV, et al. 2000 Impaired adrenocorticotropin-adrenal axis in combined pituitary hormone deficiency caused by two-base pair deletion (301–302delAG) in the Prophet of Pit-1 gene. J Clin Endocrinol Metab 83:390–397
  13. Mendonca BB, Osorio MGF, Latronico C, Estefan V, Su Sih Lo L, Arnhold IJP 1999 Longitudinal hormonal and pituitary imaging changes in two females with combined pituitary hormone deficiency due to deletion of A301,G302 in the PROP1 gene. J Clin Endocrinol Metab 84:942–945[Abstract/Free Full Text]
  14. Fofanova O, Takamura N, Kinoshita E, et al. 2000 MR imaging of the pituitary gland in children and young adults with congenital combined pituitary hormone deficiency associated with PROP1 mutations. Am J Radiol 174:555–559[Abstract/Free Full Text]
  15. Parks JS, Brown MR, Baumbach L, Sanchez JC, Stanley CA, Gianella-Neto D Natural history and molecular mechanisms of hypopituitarism with large sella turcica. Proceedings of the 80th Annual Meeting of The Endocrine Society, New Orleans, LA, 1998; abstract 470
  16. Teinturier C, Vallette S, Adamsbaum C, Brue T, Bougnères PF 2000 Pseudotumor of the pituitary associated with Prop-1 deletion. Horm Res 53(Suppl 2):59 (Abstract)
  17. Argyropoulou M, Perignon F, Brunelle F, Brauner R, Rappaport R 1991 Height of normal pituitary gland as a function of age evaluated by magnetic resonance imaging in children. Pediatr Radiol 21:247–249[CrossRef][Medline]
  18. Inoue Y, Nemoto Y, Fujita K, et al. 1986 Pituitary dwarfism: CT evaluation of the pituitary gland. Radiology 159:171–173[Abstract/Free Full Text]
  19. Asteria C, Oliveira JHA, Abucham J, Beck-Peccoz P 2000 Central hypocortisolism as part of combined pituitary hormone deficiency due to mutations of PROP-1 gene. Eur J Endocrinol 143:347–352[Abstract]
  20. Tang K, Bartke A, Gardiner CS, Wagner TE, Yun JS 1993 Gonadotropin secretion, synthesis, and gene expression in human growth hormone transgenic mice and in Ames dwarf mice. Endocrinology 132:2518–2524[Abstract/Free Full Text]
  21. Deleted in Proof.
  22. Parks JS, Tenore A, Bongiovanni AM, Kirkland RT 1978 Familial hypopituitarism with large sella turcica. N Engl J Med 298:698–702[Abstract]
  23. Parks JS, Brown MR, Hurley DL, Phelps CJ, Wajnrajch MP 1999 Heritable disorders of pituitary development. J Clin Endocrinol Metab 84:4362–4370[Abstract/Free Full Text]
  24. Thomas PQ, Johnsen BV, Rathjen J, Rathjen RD 1995 Sequence, genomic organization, and expression of the novel homeobox gene HESX1. J Biol Chem 270:3869–3875[Abstract/Free Full Text]
  25. Hermesz E, Mackem S, Mahon KA 1996 Rpx: a novel anterior-restricted homeobox gene progressively activated in the prechordal plate, anterior neural plate and Rathke’s pouch of the mouse embryo. Development 122:41–52[Abstract]
  26. Gage PJ, Brinkmeier ML, Scarlett LM, Knapp LT, Camper SA, Mahon KA 1996 The Ames dwarf gene, df, is required early in pituitary ontogeny for the extinction of Rpx transcription and initiation of lineage-specific cell proliferation. Mol Endocrinol 10:1570–1581[Abstract/Free Full Text]
  27. Gage PJ, Lossie AC, Scarlett LM, Lloyd RV, Camper SA 1995 Ames dwarf mice exhibit somatotrope commitment but lack growth hormone-releasing factor response. Endocrinology 136:1161–1167[Abstract]
  28. Andersen B, Pearse RV, Jenne K, et al. 1995 The Ames dwarf gene is required for Pit-1 gene activation. Dev Biol 172:495–503[CrossRef][Medline]
  29. Cheng TC, Beamer WG, Phillips JA, Bartke A, Mallonee RL, Dowling C 1983 Etiology of growth hormone deficiency in Little, Ames, and Snell dwarf mice. Endocrinology 113:1669–1678[Abstract/Free Full Text]
  30. Duboule D 1995 Vertebrate Hox genes and proliferation: an alternative pathway to homeosis? Curr Genet Dev 5:525–528
  31. Sauvageau G, Thorsteinsdottir U, Eaves CJ, et al. 1995 Overexpression of Hox-B in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 9:1753–1765[Abstract/Free Full Text]
  32. Voutetakis A, Sertedaki A, Maniati-Christidi M, Dacou-Voutetakis C 2000 PROP1 mutations in multiple pituitary hormone deficiency (MPHD): diverse phenotype and pituitary anatomy. Horm Res 53(Suppl 2):58 (Abstract)



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
D. Kelberman, K. Rizzoti, R. Lovell-Badge, I. C. A. F. Robinson, and M. T. Dattani
Genetic Regulation of Pituitary Gland Development in Human and Mouse
Endocr. Rev., December 1, 2009; 30(7): 790 - 829.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
E. M Delemarre, B. Felius, and H. A Delemarre-van de Waal
Inducing puberty
Eur. J. Endocrinol., December 1, 2008; 159(suppl_1): S9 - S15.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. Castinetti, A. Saveanu, R. Reynaud, M. H. Quentien, A. Buffin, R. Brauner, N. Kaffel, F. Albarel, A. M. Guedj, M. El Kholy, et al.
A Novel Dysfunctional LHX4 Mutation with High Phenotypical Variability in Patients with Hypopituitarism
J. Clin. Endocrinol. Metab., July 1, 2008; 93(7): 2790 - 2799.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Neuroradiol.Home page
L.L.F. do Amaral, R.M. Ferreira, N.P.F.D. Ferreira, R.A. Mendonca, V.H.R. Marussi, J.L. da Cunha, B.R. Macaranduba, and J.D. Medeiros
Combined Pituitary Hormone Deficiency and PROP-1 Mutation in Two Siblings: A Distinct MR Imaging Pattern of Pituitary Enlargement
AJNR Am. J. Neuroradiol., August 1, 2007; 28(7): 1369 - 1370.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
D. Kelberman and M. T. Dattani
Hypothalamic and pituitary development: novel insights into the aetiology
Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S3 - S14.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. W. Pfaeffle, J. J. Savage, C. S. Hunter, C. Palme, M. Ahlmann, P. Kumar, J. Bellone, E. Schoenau, E. Korsch, J. H. Bramswig, et al.
Four Novel Mutations of the LHX3 Gene Cause Combined Pituitary Hormone Deficiencies with or without Limited Neck Rotation
J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1909 - 1919.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. P. S. Bhangoo, C. S. Hunter, J. J. Savage, H. Anhalt, S. Pavlakis, E. C. Walvoord, S. Ten, and S. J. Rhodes
A Novel LHX3 Mutation Presenting as Combined Pituitary Hormonal Deficiency
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 747 - 753.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. Lebl, J. Vosahlo, R. W Pfaeffle, H. Stobbe, J. Cerna, D. Novotna, J. Zapletalova, B. Kalvachova, V. Hana, V. Weiss, et al.
Auxological and endocrine phenotype in a population-based cohort of patients with PROP1 gene defects
Eur. J. Endocrinol., September 1, 2005; 153(3): 389 - 396.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. P. G. Turton, R. Reynaud, A. Mehta, J. Torpiano, A. Saveanu, K. S. Woods, A. Tiulpakov, V. Zdravkovic, J. Hamilton, S. Attard-Montalto, et al.
Novel Mutations within the POU1F1 Gene Associated with Variable Combined Pituitary Hormone Deficiency
J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4762 - 4770.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. D. Ward, L. T. Raetzman, H. Suh, B. M. Stone, I. O. Nasonkin, and S. A. Camper
Role of PROP1 in Pituitary Gland Growth
Mol. Endocrinol., March 1, 2005; 19(3): 698 - 710.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Reynaud, M. Chadli-Chaieb, S. Vallette-Kasic, A. Barlier, J. Sarles, I. Pellegrini-Bouiller, A. Enjalbert, L. Chaieb, and T. Brue
A Familial Form of Congenital Hypopituitarism Due to a PROP1 Mutation in a Large Kindred: Phenotypic and in Vitro Functional Studies
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5779 - 5786.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. K. Lee, Y.-S. Zhu, J. J. Cordero, L.-Q. Cai, I. Labour, C. Herrera, and J. Imperato-McGinley
Long-Term Growth Hormone Therapy in Adulthood Results in Significant Linear Growth in Siblings with a PROP-1 Gene Mutation
J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 4850 - 4856.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Bottner, E. Keller, J. Kratzsch, H. Stobbe, J. F. W. Weigel, A. Keller, W. Hirsch, W. Kiess, W. F. Blum, and R. W. Pfaffle
PROP1 Mutations Cause Progressive Deterioration of Anterior Pituitary Function including Adrenal Insufficiency: A Longitudinal Analysis
J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5256 - 5265.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Voutetakis, M. Argyropoulou, A. Sertedaki, S. Livadas, P. Xekouki, M. Maniati-Christidi, I. Bossis, N. Thalassinos, N. Patronas, and C. Dacou-Voutetakis
Pituitary Magnetic Resonance Imaging in 15 Patients with Prop1 Gene Mutations: Pituitary Enlargement May Originate from the Intermediate Lobe
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2200 - 2206.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
L. T. Raetzman, R. Ward, and S. A. Camper
Lhx4 and Prop1 are required for cell survival and expansion of the pituitary primordia
Development, March 11, 2003; 129(18): 4229 - 4239.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. C. Vieira, M. R. Dias da Silva, J. M. Cerutti, E. Brunner, M. Borges, L. T. Arnaldi, P. Kopp, and J. Abucham
Familial Combined Pituitary Hormone Deficiency due to a Novel Mutation R99Q in the Hot Spot Region of Prophet of Pit-1 Presenting as Constitutional Growth Delay
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 38 - 44.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Riepe, F. G.
Right arrow Articles by Sippell, W. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Riepe, F. G.
Right arrow Articles by Sippell, W. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals