| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Division of Pediatric Endocrinology (F.G.R., C.-J.P., W.G.S.), Department of Pediatrics, and Department of Internal Medicine (H.M.), Christian-Albrechts-University, D-24105 Kiel, Germany; and Department of Pediatrics (O.B., R.W.P.), Aachen University of Technology (RWTH), D-52074 Aachen, Germany
Abstract
Mutations of the PROP-1 gene cause combined pituitary hormone deficiency. Progressive ACTH/cortisol insufficiency is found in a few patients. Congenital hypoplasia of the anterior pituitary gland is the most common magnetic resonance imaging finding in patients with PROP-1 mutations. We present two brothers with compound heterozygosity for the two mutations 150delA and 301–302delAG of the PROP-1 gene. Both showed combined pituitary hormone deficiency of GH, TSH, PRL, and gonadotropins, as is typical for PROP-1 deficiency. We observed a developing insufficiency of ACTH and cortisol secretory capacity in both patients. Computed tomography revealed an enlarged pituitary in the older brother at 3.5 yr of age. Repeated magnetic resonance imaging after 12 yr showed a constant hypoplasia of the anterior pituitary lobe. Similarly, magnetic resonance imaging of the younger brother showed a constant enlargement of the anterior pituitary gland until 10 yr. At the age of 11 yr, the anterior pituitary was hypoplastic. The reason for pituitary enlargement in early childhood with subsequent decrease in pituitary size is not known. We speculate that altered expression of early transcription factors could be involved. Because both patients have the same PROP-1 mutations and an identical pattern of combined pituitary hormone deficiency, we suggest that early pituitary enlargement may be the typical course in such patients in whom pituitary surgery is not indicated.
A CASCADE OF pituitary transcription factors is responsible for the organogenesis of the anterior pituitary gland. Disturbances of single transcriptional factors can lead to congenital combined pituitary hormone deficiency (CPHD). One of these transcription factors is the PROP-1 protein. PROP-1 is involved in the ontogenesis of pituitary gonadotrophs, somatotrophs, lactotrophs, and thyrotrophs. A missense mutation of the murine Prop-1 gene is responsible for the Ames dwarfism in mice (1). The first examples of PROP-1 mutations in humans were reported by Wu et al. (2). Eight distinct mutations have been identified so far. These PROP-1 mutant alleles include 301–302delAG, R120C, F117I, 149delAG, codon50delA, R73C, 342-343delAT, F88S, and 112–124del (2, 3, 4, 5, 6, 7, 8, 9, 10, 11). The affected patients suffer from LH, FSH, GH, PRL, and TSH deficiency. Some develop ACTH deficiency (11, 12).
Most patients with PROP-1 mutations have a hypoplastic pituitary gland
(2, 4, 8, 10, 12, 13, 14). However, there are various reports
of pituitary enlargement in patients with PROP-1 mutations (4, 13, 15, 16). There seems to be no genotype-phenotype correlation
and even no consistency in siblings (12). Reports of a
longitudinal follow-up of pituitary morphology are available for a few
patients only (Table 1
) (13, 16).
|
Subjects and Methods
Subjects
Two brothers with compound heterozygosity for the mutations delA150/delAG301/302 of the PROP-1 gene were followed longitudinally. Parental informed consent was obtained before the study. Both show combined pituitary hormone deficiency of GH, PRL, TSH, and gonadotropins. The father’s height is 177 cm (-0.5 SD score), and the mother’s height is 166 cm (-0.2 SD score), resulting in a target height of 178 ± 8.5 cm for the two boys. None of the first-degree relatives is affected by short stature, hypothyroidism, or hypogonadism.
Patient 1, the older brother, was born by spontaneous vaginal delivery at term. Birth weight was 3520 g (50th centile), the length was 52 cm (50th centile), and the Apgar scores were 9/10/10. He was breast-fed until 4 months. Early psychomotor development was delayed. Failure to thrive was noticed at 3.5 yr. He presented with a height of 87.1 cm (-4.0 SD score) at that time. CPHD was diagnosed by standard stimulation tests. Treatment was initiated with T4 (50 µg/d) and biosynthetic GH (12 IU/m2 body surface/week). Pretreatment growth velocity was 5.4 cm/yr and increased to 15.2 cm/yr during the first year of GH therapy. Hydrocortisone replacement was prescribed for stress situations. At the age of 10 yr, thyroxine was increased to 75 µg/d. Sex steroid substitution was started at the age of 13 yr with testosterone undecenoate orally in increasing doses. At present, the patient is 15 yr of age and is doing well under replacement therapy. His height-SD score improved to -0.4 (current height, 175.9 cm).
Patient 2, the younger brother, was born at term after an uneventful pregnancy by spontaneous delivery. Birth weight and length were normal [3250 g (25th centile), 50 cm (20th centile)]. Apgar scores were 9/10/10. Breast feeding was done for 3 months. Early development was delayed. At the age of 1 yr, his height was 67 cm (-3.4 SD score). Treatment with 50 µg of T4 per day was started. Hydrocortisone replacement was prescribed for stress situations. At 11 yr, the dose was increased to 75 µg daily. Diagnosis of CPHD including GH deficiency was established after stimulation testing at age 1.9 yr. Treatment with biosynthetic GH (12 IU/m2 body surface/week) was started. Pretreatment growth velocity was 7.7 cm/yr, which increased to 13.6 cm/yr during the first year of GH therapy. Currently, the patient is 12 yr of age and is doing well under substitution treatment. His height-SD score improved to -0.4 (current height, 150.2 cm). Testosterone replacement was started recently.
Endocrinological investigations
The diagnosis of CPHD for GH, PRL, TSH, and gonadotropins was made by standard stimulation tests. GH secretion was tested by 21% arginine hydrochloride (0.5 g/kg iv; B. Braun, Melsungen, Germany), GHRH (1 µg/kg iv; Ferring Pharmaceuticals Ltd., Kiel, Germany), and glucagon (0.05 mg/kg im; GlucaGen, Novo Nordisk Pharma, Mainz, Germany) plus propanolol (1 mg/kg orally; Dociton, Zeneca Pharmaceuticals, Plankstadt, Germany). GH, PRL, and TSH were measured by RIA, monoclonal immunoradiometric assay, and electroimmunoassay, respectively (Seria hGH and PRL MAIA Clone, Serono Diagnostika, Freiburg, Germany; TSH microparticle electroimmunoassay, Abbott, Wiesbaden, Germany). PRL and TSH were determined before and 30 min after TRH injection (200 µg/m2; Ferring Pharmaceuticals Ltd.). Gonadotropins were determined by monoclonal immunoradiometric assay (LH and FSH MAIA Clone, Serono Diagnostika) before and 30 min after GnRH stimulation (60 µg/m2 LH-releasing hormone; Ferring Pharmaceuticals Ltd.). Basal and free T4 were measured by microparticle electroimmunoassay (Abbott). The CRH stimulation test (Ferring Pharmaceuticals Ltd.) was performed using 1 µg/kg human CRH administered iv at 0900 h. Blood samples were collected for cortisol and ACTH measurements at -15, 0, 15, 30, 45, 60, 90, and 120 min after injection. ACTH was measured by an immunoluminescence assay (Lumitest ACTH, Brahms Diagnostics, Berlin, Germany). Cortisol was measured by RIA (BioChemImmuno Systems, Freiburg, Germany).
Analysis of the PROP-1 gene
DNA was extracted from peripheral blood lymphocytes of patients and their parents using the QIAGEN Blood Kit (QIAGEN, Hilden, Germany). PCR amplification was performed with oligonucleotides corresponding to intronic sequences surrounding the three coding PROP-1 exons (exon 1-sense, GTCAGAGATTCAGGGACACTTGG; exon 1-antisense, ATGCTTTCAGCCTCACACC; exon 2-sense, AGGCACATGTGGTCCAGCACC; exon 2-antisense, GATAGCACCAAAGAAATCTGC; exon 3-sense, CTTGTCATTGGAGTAGGGTGTC; exon 3-antisense, CAGGAATTCACCATGATCTCC). PCR was performed as follows: 50 µL of the reaction solution contained approximately 100 ng of genomic DNA, 50 pmol of each primer, 0.5 U of DNA polymerase from Thermus brockianus (Primezyme, Biometra, Göttingen, Germany), 200 µmol/liter of each deoxynucleotide, and 1.5 mmol/liter MgCl2 in 10 mmol/liter Tris-HCl and 50 mmol/liter KCl, pH 8.8, buffer. PCR was performed on a Mastercycler (Eppendorf, Hamburg, Germany). It consisted of 25 cycles of 92 C for 30 sec, 54 C for 30 sec, and 72 C for 1 min. PCR products were resolved on a 2% agarose gel and stained with ethidium bromide. PCR products were screened for the presence of a mutation by single stranded conformational polymorphism analysis. After purification of PCR products on Qiaquick columns (QIAGEN, Hilden, Germany), samples were denatured by heat and run on a 0.04 x 16.5 x 22 cm vertical gel electrophoresis chamber at 3 W for 17 h using a 0.5-fold concentrated MDE gel solution (Biozym Diagnostik, Oldendorf, Germany). Samples were visualized by silver staining. Automated sequencing was performed on a ABI 373A Sequencer (Perkin-Elmer Corp., Norwalk, CT) using the ABIPrism Dye Terminater Kit and following the cycle-sequencing protocol provided by the manufacturer.
Neuroradiological investigations
Sella turcica x-ray was done by lateral radiography of the skull. Computed tomography was performed with a Picker SD600 (Marconi/Picker, Cleveland, OH) with 2-mm slices. Magnetic resonance imaging was obtained with a 1-Tesla scanner (Magnetom Impact, Siemens, Berlin, Germany). Sagittal, coronal, and transverse T1- and T2-weighted images were obtained with a slice thickness of 2.0–2.5 mm. Strict midline position was assessed by simultaneous visualization of the stalk, the anterior lobe, and the posterior lobe of the pituitary gland and the Sylvius’ aqueduct. Maximal height of the pituitary gland was measured perpendicular to the sellar floor (17).
Results
Endocrinological findings
At 3.5 yr of age, patient 1 showed an inadequate maximum increase
in GH plasma levels after stimulation by arginine and GHRH [0.3 
0.6 µg/liter (normal range for age and sex, 16.7 ± 1.29) and
0.6 4.6 µg/liter (28.8 ± 2.0), respectively]. Basal PRL
and TSH were normal [6.5 µg/liter (2–14.5) and 1.8 mIU/liter
(0.85–6.48)] but failed to reach normal levels after TRH stimulation
[9.7 µg/liter (13–32.5) and 2.7 mIU/liter (5.6–28.3),
respectively]. T4 [5.7 nmol/liter
(118.3–194.2)[ and free T4 [3.9 pmol/liter
(12.1–22.0)] were subnormal. Basal gonadotropin levels were in the
low prepubertal range and showed no response to GnRH [LH, <0.3
IU/liter (<0.3–2.5) <0.3 IU/liter (1.3–3.8); FSH, 0.4 IU/liter
(<0.5–2.2) 0.7 IU/liter (2.6–6.3)]. Baseline cortisol at 3.4 yr
was normal [325 nmol/liter (91–361)]. A hCRH stimulation test was
performed at 15 yr of age. Basal ACTH was 4 pmol/liter (1–8). ACTH
response to hCRH was 15 pmol/liter at 15 min (>18). Baseline cortisol
at 15 yr was 210 nmol/liter (60–480). The peak cortisol level 30 min
after hCRH was 500 nmol/liter (>513).
Patient 2 showed subnormal maximum GH responses to arginine [1.7
2.3 µg/liter (16.7 ± 1.2)], glucagon/propanolol [2.1 2.8
µg/liter (16.9 ± 1.9)], and GHRH [0.6 5.9 µg/liter
(28.8 ± 2.0)] at 1.9 yr of age. Basal PRL was low and showed an
insufficient increase after TRH [2.1 µg/liter (2–14.5) 8.9
µg/liter (13–32.5)]. Basal TSH was normal but showed an inadequate
increase after TRH [2.1 mIU/liter (0.85–6.48) 4.5 mIU/liter
(5.6–28.3)]. Basal and free T4 were subnormal
[4.5 nmol/liter (118.3–194.2) and 5.1 pmol/liter (12.1–22.0),
respectively]. Gonadotropins were low and showed no increase after
GnRH stimulation [LH, 0.4 IU/liter (<0.3–2.5) <0.3 IU/liter
(1.3–3.8); FSH, <0.3 IU/liter (<0.5–2.2) 0.7 IU/liter
(2.6–6.3)]. Baseline cortisol at that time was normal [247
nmol/liter (48–284)]. A CRH stimulation test was done at the age of
12 yr. Basal ACTH was normal [3 pmol/liter (1–8)]. ACTH response to
CRH was subnormal [10 pmol/liter (>18)]. Baseline cortisol at 12 yr
was 166 nmol/liter (60–480). The peak cortisol level 45 min after CRH
stimulation was low [422 nmol/liter (>513)].
Genomic DNA analysis
Both brothers showed compound heterozygosity for a 1-bp deletion on one allele, which deletes codon 50 from GGA to GG, and a 2-bp deletion in codon 101 on the other allele, which deletes AGT to T. On both alleles, the reading frame is shifted, thereby creating a nonsense peptide starting from the site of mutation. The first mutation affects an amino acid N terminal of the homeodomain that is critical for the DNA-binding abilities of this transcription factor. All amino acids of the homeodomain, therefore, are affected. However, the new reading frame introduces a stop codon at codon 164, which is 104 amino acids downstream from the mutation. The 2-bp deletion affects an amino acid in the center of the second helix of the homeodomain. Just seven amino acids downstream, a termination codon is introduced by the altered reading frame. The father was heterozygous for the A150 deletion, and the mother was heterozygous for the A301/G302 deletions of codon 101.
Neuroradiological findings
An enlarged spherical sella ("cherry sella") was noticed by
skull x-ray in patient 1 at age 3.5 yr. Computed tomography at that age
revealed an enlarged pituitary 10 mm in diameter and 13 mm in height
[normal height, 5.7 ± 1.8 mm; range, 2.5–7.0 mm
(18)]. Magnetic resonance imaging at age 12, 13, and 14
yr showed a constant hypoplasia of the anterior pituitary lobe, with a
pituitary height of 2 mm at all three investigations [normal pituitary
height for age, 5.3 ± 0.8 mm (17)]. The position
and size of the posterior lobe, the stalk, and the hypothalamus were
normal (Fig. 1).
|
).
|
The Prop-1 gene was first identified in the Ames dwarf mouse by Sornson et al. (1). The phenotype of Prop-1 mutant Ames mice includes the near absence of GH, TSH, and PRL and reduced levels of LH and FSH (20). The responsible defect for the Ames’s dwarfism was found to be a point mutation in the Prop-1 gene (Ser83Pro), which manifests a partial loss of function (1). The human PROP-1 phenotype involves deficiencies of GH, PRL, TSH, LH, and FSH, although some examples of progressing ACTH deficiency exist (11, 12, 13, 19). We report two brothers with CPHD caused by a compound heterozygosity for 301–302delAG/150delA in exon 2 of the PROP-1 gene. The 301–302AG deletion is the most common mutation of the human PROP-1 gene (2). To our knowledge, 45 cases with this mutation have been reported in the literature to date. Fofanova et al. (7) reported the first 149–150delGA deletion in Russian patients with CPHD. Both expressed proteins are free from DNA binding and transcriptional activation (2, 7). Because our two affected patients show compound heterozygosity for the 301–302delAG mutation and the 150delA mutation, they are not expected to produce a functional PROP-1 protein.
Both of our patients showed the classic CPHD phenotype, including GH, TSH, FSH, LH, and PRL deficiency. After retesting the two brothers at 12 and 15 yr, respectively, we could demonstrate impaired ACTH and cortisol secretory capacity after CRH. Baseline ACTH and cortisol levels were in the normal range, and neither patient so far had an adrenal crisis. These findings correspond well to various reports in the literature (11, 12, 13, 19).
Information regarding the pituitary size in humans with PROP-1
mutations is not consistent. Most patients with PROP-1 mutations have a
hypoplastic anterior pituitary lobe (Table 1
) (8, 12, 14).
In contrast, there are few reports on patients with PROP-1 mutations
and pituitary enlargement. In 1978, Parks et al.
(22) reported on sellar enlargement in three siblings with
CPHD. Enlargement of the anterior pituitary was also found in two of
three Brazilian patients and in two Jamaican patients with the
301–302delAG mutation (15). Rosenbloom et al.
(4) found three patients with a sellar enlargement in
lateral skull x-rays. Mendonca et al. (13)
performed the first longitudinal follow-up investigation of the
pituitary morphology in one woman with a homozygous 301–302delAG
mutation. She showed a pituitary enlargement at 8 yr of age. At 27 yr
of age, the anterior pituitary was hypoplastic. The report of our
patients is the first to show a longitudinal follow-up with
neuroradiological imaging in two siblings with identical PROP-1
mutations. Both showed a pituitary enlargement in young infancy. At
about 11 yr of age, however, their anterior pituitary glands became
hypoplastic. The pituitary involution occurred within 1 yr in our
second patient. Because no imaging was performed between ages 3.5 and
11 yr in the older brother, it is not known at what age his pituitary
involuted. In contrast to our two brothers, the recently reported cases
with pituitary enlargements showed no consistency of the pituitary size
in siblings (23).
The reason for the changing pituitary size during childhood is not known. Pituitary organogenesis is controlled by a cascade of various transcription factors. As we know from mice, these factors are expressed during short periods of fetal development. The Hesx-1 gene, also referred to as Rpx, was the first known transcription factor expressed in regions responsible for the development of the anterior pituitary gland (24, 25). Hesx-1 expression is restricted to the oral ectoderm, which gives rise to Rathke’s pouch. Hesx-1 can be identified in the precursors of all pituitary cell types. Expression decreases from day e11.5 and is extinguished by day e13.5 in normal mice. Prop-1 is expressed in the pituitary from day e10.5 to e15.5, followed by the increase of Pit-1 (26, 27). After that, it is no longer recognized. In Prop-1 mutant Ames mice, the expression of a series of homeodomain factors continues beyond their normal time of expression. Hesx-1 is expressed in the anterior pituitary anlage until day e18.5 (26). Therefore, Prop-1 seems to be required as a down-regulator for Hesx-1. Because there is no Pit-1 expression in Ames dwarf mice from day e15.5 to e18.5, Prop-1 also may be necessary as a Pit-1 activator. Additionally, the POU domain factor Brn-4 and Prop-1 itself showed prolongation of pituitary expression in mice (1). The Ames pituitary shows a striking dysmorphogenesis that becomes apparent at day e13-e13.5. Although no reports regarding pituitary enlargement in Ames mice have been published and pituitary hypoplasia has been documented from early gestation until adulthood (26, 27), the pituitary size is not constant. During embryological development, the nascent anterior pituitary gland in Prop-1 mutant mice is about 50% smaller than in normal mice (26). The adult Ames mice have even smaller anterior pituitary glands (about 25% of normal size) (28, 29). The reason may be a further loss of immature precursor cells, more likely resulting from reduced proliferation than reduced cell survival, because there were no signs of apoptosis (26).
There are no data on pituitary transcription factors regarding their time of expression in humans. If a prolonged expression of transcription factors such as HESX-1, which is inversely correlated with pituitary differentiation (25), is recognizable in humans, one could speculate that undifferentiated precursor cells may be maintained for a longer time in a viable state and are thus responsible for pituitary masses. The histopathology of a surgically removed pituitary mass from a PROP-1-deficient Jamaican patient revealing no recognizable cell line but amorphous material would be compatible with this hypothesis (15). Higher levels of homeobox-containing genes are known to be associated with the proliferation of undifferentiated cells (30, 31). Because the Ames’s Prop-1 mutation is not a complete loss-of-function mutation, phenotypical differences to humans may not interfere with this hypothesis, because hyperplastic pituitaries were only found in patients with PROP-1 mutations resulting in a PROP-1 protein without biological function. It may be possible that various homeodomain factors are expressed in those cases even longer. The generation of a Prop-1 knockout mouse might help to elucidate this, because human material will not be available.
All pituitary masses in patients carrying PROP-1 mutations were seen in early childhood (13, 16, 22). Shrinkage of the pituitary was observed between 10 and 20 yr of age. The observation of cystic alterations of the pituitary may indicate an intermediate state of the shrinking gland (Parks, J. S., personal communication) (32). Pituitary enlargement was not seen in adulthood. This may be the consequence of the termination of specific transcription factor gene expression. Because pituitary enlargement is only seen in 301–302delAG mutations, we speculate that only specific gene defects may contribute to an overexpression of various pituitary transcription factors. As there is marked clinical heterogeneity among affected humans, it is unlikely that all patients will show the same pituitary involution. For some PROP-1 mutant humans, the sequence of pituitary enlargement followed by involution during the second decade of life resulting in pituitary hypoplasia may be the natural history of the disease.
For the clinician, it is important to recognize that PROP-1 mutations can present with pituitary enlargement during early childhood. Pituitary surgery is not indicated in patients with PROP-1 mutations. The pituitary tumor must not be mistaken for craniopharyngioma, pituitary adenoma, dysgerminoma, or Rathke’s pouch cyst.
Acknowledgments
Footnotes
Address for correspondence: Prof. Dr. Lmed. Wolfgang G. Sippell, Department of Pediatrics, Christian-Albrechts-University of Kiel, Schwanenweg 20, D-24105 Kiel, Germany.
This work was presented in part at the 39th Annual Meeting of the European Society for Pediatric Endocrinology, Brussels, Belgium, September 17–20, 2000.
Abbreviation: CPHD, Combined pituitary hormone deficiency.
Received November 30, 2000.
Accepted May 14, 2001.
References
Cys at codon 120 (R120C). J Clin Endocrinol
Metab 83:3727–3734This article has been cited by other articles:
 |
|
 |
|
  F. Castinetti, A. Saveanu, R. Reynaud, M. H. Quentien, A. Buffin, R. Brauner, N. Kaffel, F. Albarel, A. M. Guedj, M. El Kholy, et al. A Novel Dysfunctional LHX4 Mutation with High Phenotypical Variability in Patients with Hypopituitarism J. Clin. Endocrinol. Metab., July 1, 2008; 93(7): 2790 - 2799. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.L.F. do Amaral, R.M. Ferreira, N.P.F.D. Ferreira, R.A. Mendonca, V.H.R. Marussi, J.L. da Cunha, B.R. Macaranduba, and J.D. Medeiros Combined Pituitary Hormone Deficiency and PROP-1 Mutation in Two Siblings: A Distinct MR Imaging Pattern of Pituitary Enlargement AJNR Am. J. Neuroradiol., August 1, 2007; 28(7): 1369 - 1370. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Kelberman and M. T. Dattani Hypothalamic and pituitary development: novel insights into the aetiology Eur. J. Endocrinol., August 1, 2007; 157(suppl_1): S3 - S14. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. W. Pfaeffle, J. J. Savage, C. S. Hunter, C. Palme, M. Ahlmann, P. Kumar, J. Bellone, E. Schoenau, E. Korsch, J. H. Bramswig, et al. Four Novel Mutations of the LHX3 Gene Cause Combined Pituitary Hormone Deficiencies with or without Limited Neck Rotation J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1909 - 1919. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. S. Bhangoo, C. S. Hunter, J. J. Savage, H. Anhalt, S. Pavlakis, E. C. Walvoord, S. Ten, and S. J. Rhodes A Novel LHX3 Mutation Presenting as Combined Pituitary Hormonal Deficiency J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 747 - 753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lebl, J. Vosahlo, R. W Pfaeffle, H. Stobbe, J. Cerna, D. Novotna, J. Zapletalova, B. Kalvachova, V. Hana, V. Weiss, et al. Auxological and endocrine phenotype in a population-based cohort of patients with PROP1 gene defects Eur. J. Endocrinol., September 1, 2005; 153(3): 389 - 396. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. G. Turton, R. Reynaud, A. Mehta, J. Torpiano, A. Saveanu, K. S. Woods, A. Tiulpakov, V. Zdravkovic, J. Hamilton, S. Attard-Montalto, et al. Novel Mutations within the POU1F1 Gene Associated with Variable Combined Pituitary Hormone Deficiency J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4762 - 4770. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. D. Ward, L. T. Raetzman, H. Suh, B. M. Stone, I. O. Nasonkin, and S. A. Camper Role of PROP1 in Pituitary Gland Growth Mol. Endocrinol., March 1, 2005; 19(3): 698 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Reynaud, M. Chadli-Chaieb, S. Vallette-Kasic, A. Barlier, J. Sarles, I. Pellegrini-Bouiller, A. Enjalbert, L. Chaieb, and T. Brue A Familial Form of Congenital Hypopituitarism Due to a PROP1 Mutation in a Large Kindred: Phenotypic and in Vitro Functional Studies J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5779 - 5786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Lee, Y.-S. Zhu, J. J. Cordero, L.-Q. Cai, I. Labour, C. Herrera, and J. Imperato-McGinley Long-Term Growth Hormone Therapy in Adulthood Results in Significant Linear Growth in Siblings with a PROP-1 Gene Mutation J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 4850 - 4856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bottner, E. Keller, J. Kratzsch, H. Stobbe, J. F. W. Weigel, A. Keller, W. Hirsch, W. Kiess, W. F. Blum, and R. W. Pfaffle PROP1 Mutations Cause Progressive Deterioration of Anterior Pituitary Function including Adrenal Insufficiency: A Longitudinal Analysis J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5256 - 5265. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Voutetakis, M. Argyropoulou, A. Sertedaki, S. Livadas, P. Xekouki, M. Maniati-Christidi, I. Bossis, N. Thalassinos, N. Patronas, and C. Dacou-Voutetakis Pituitary Magnetic Resonance Imaging in 15 Patients with Prop1 Gene Mutations: Pituitary Enlargement May Originate from the Intermediate Lobe J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2200 - 2206. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. T. Raetzman, R. Ward, and S. A. Camper Lhx4 and Prop1 are required for cell survival and expansion of the pituitary primordia Development, March 11, 2003; 129(18): 4229 - 4239. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. C. Vieira, M. R. Dias da Silva, J. M. Cerutti, E. Brunner, M. Borges, L. T. Arnaldi, P. Kopp, and J. Abucham Familial Combined Pituitary Hormone Deficiency due to a Novel Mutation R99Q in the Hot Spot Region of Prophet of Pit-1 Presenting as Constitutional Growth Delay J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 38 - 44. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
