| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Departments of Internal Medicine (D.E.S., R.S.B., D.A.A.), Pathology (T.J.G.), and Psychiatry (M.N.S.), University of Michigan Medical School, Ann Arbor, Michigan 48109; and Department of Medicine (M.D.B., R.M.S.), Division of Pulmonary and Critical Medicine, UCLA School of Medicine, Los Angeles, California 90024
Address all correspondence and requests for reprints to: David E. Schteingart. M.D., University of Michigan Medical Center, 5570 MSRB II, Box 0678, 1150 West Medical Center Drive, Ann Arbor, Michigan 48109-0001. E-mail: dschtein{at}umich.edu
Abstract
A patient with adrenocortical carcinoma presented with fever,
leukocytosis, and increased acute phase reactants. The tumor was
infiltrated with neutrophils. Immunohistochemical staining of the tumor
showed positive signal for epithelial neutrophil-activating protein-78,
an angiogenic and chemotactic CXC chemokine. Conditioned medium from
tumor-derived cells (RL-251) showed high concentration of IL-8,
epithelial neutrophil-activating protein-78, Gro 
, and Gro 
,
angiogenic CXC chemokines with a potential role in tumorigenesis. An
adrenal cancer/severe combined immunodeficiency mouse chimera was
developed. Mice grew tumors rapidly, and circulating levels of IL-8
and epithelial neutrophil-activating protein-78 were detected. In
contrast, animals transplanted with NCI-H295 cells, a
nonchemokine-secreting cell line, grew tumors more slowly and did not
have detectable chemokine levels. Similar to the patient, mice with
RL-251 tumors developed marked leukocytosis and neutrophilia, and their
tumors were infiltrated with neutrophils. Mice were passively immunized
with epithelial neutrophil-activating protein-78 antisera. A marked
decrease in tumor growth was observed. Potential for chemokine
production by other adrenocortical tumors was investigated by RT-PCR in
archival material. Six of seven adrenal carcinomas and one of three
adenomas had cDNA for IL-8; six of seven carcinomas and the three
adenomas had cDNA for epithelial neutrophil-activating protein-78. We
concluded that the clinical presentation of this case resulted from
increased tumor production of chemotactic chemokines. Through their
angiogenic and chemotactic properties these chemokines may play an
important role in adrenal tumorigenesis.
ADRENOCORTICAL CARCINOMAS ARE rare but highly malignant neoplasms that occur with an incidence of one to two per million population per year (1). In approximately 50% of patients, the tumor presents with clinical and biochemical manifestations of excessive adrenal cortical hormone secretion. Cushing’s syndrome alone or in association with virilization occurs in 85% of functioning tumors. In the remaining 50%, tumors are silent in regards to the well-known metabolic effects of adrenal cortical steroids and may be discovered incidentally during abdominal imaging for unrelated abdominal complaints. When tumors are large, the presenting symptoms may be nonspecific such as abdominal pain and fever. We describe a novel clinical syndrome associated with primary adrenocortical carcinoma that appeared to be caused by tumor overproduction of CXC chemokines. These chemokines are cytokines that display four highly conserved cysteine amino acid residues, with the first two cysteines separated by a nonconserved amino acid residue. Chemokines with a three-amino acid motif, the glutamic acid-leucine-arginine motif that immediately precedes the first cysteine amino acid residue in the primary structure, have potent angiogenic activity essential for tumor growth. We present evidence that these chemokines contributed to the growth of this adrenocortical carcinoma.
Case description
A 75-yr-old man with a past medical history of arthritis and hypertension presented with recent onset of right flank and back pain and blood pressure of 219/107 mm Hg. He had also noticed a recent onset of spells consisting of chills, warmth, sweating, and flushing. The patient had good appetite and had not experienced weight changes. He complained of bruising with minor trauma for 5 months before his evaluation. He had been initially evaluated at another hospital at which abdominal computerized tomography (CT) revealed a 4-by-5-cm right adrenal mass. A fine-needle CT guided aspiration biopsy of this mass was consistent with adrenocortical carcinoma. On physical examination the patient was warm and flushed with a temperature of 39.5 C. He did not have a cushinoid appearance. His lungs showed occasional ronchi and his heart a grade ii/vi apical systolic murmur. The abdomen was nontender and no masses were palpable. Extremities revealed 4+ pretibial pitting edema. Initial laboratory studies revealed a normocytic, normochromic anemia (hematocrit 27.3%, hemoglobin 9.1 g/100, and marked leukocytosis [white count 27,300/mm3]) with neutrophilia (83%). His erythrosedimentation rate was high (116 mm/hr) and ferritin levels were also high (962 µg/liter), consistent with elevation of acute phase reactants.
Because of the possibility of an acute infectious process, seven blood
cultures were obtained during his febrile episodes without evidence of
bacterial growth. A trans-esophageal echocardiogram was
negative for vegetations or thrombi and a gallium scan was negative for
a focal source of infection. Repeat abdominal CT revealed a 5 x
6 x 7 heterogeneous mass in the right adrenal. Measurement of
adrenal cortical hormones showed normal baseline cortisol and cortisol
metabolite excretion measured as urinary free cortisol,
17-hydroxycorticosteroids and 17-ketosteroids. However, serum cortisol
levels showed absence of circadian rhythm and corresponding ACTH levels
were undetectable (Table 1
). The
suppressed ACTH levels occurred in spite of fever spikes at the time of
sample collection. These studies were performed in the General Clinical
Research Center and informed consent was obtained. The research
protocol was reviewed and approved by the Institutional Review Board.
The patient underwent a laparotomy with identification and resection of
an well-encapsulated, necrotic adrenal mass. Six intraduodenal,
umbilicated neoplastic lesions were observed. One of these lesions was
resected. Culture of tissue samples obtained from the primary adrenal
mass showed no bacterial growth. The pathological examination of the
surgical specimens showed a poorly differentiated adrenocortical
carcinoma and intraduodenal metastases. Figure 1 shows a high-power view of a
histological section obtained from the primary tumor. The histological
pattern was consistent with a high-grade adrenocortical carcinoma
exhibiting nuclear pleomorphism and mitoses surrounded by neutrophils.
The metastatic lesion revealed a cellular pattern identical to the
primary tumor. Postoperatively the patient became afebrile and the
white count decreased by 40%. However, he died several months later
with tumor metastases.
|
|
Immunohistochemistry
Samples of tumor were fixed in 4% paraformaldehyde and sections prepared and stained for epithelial neutrophil activating protein 78 (ENA-78) using a modification of a previously described technique (2). Nonspecific binding sites were blocked with normal goat serum, washed, and overlaid with 1:1500 dilution of either control (rabbit) or rabbit antihuman ENA-78 serum. Slides were then rinsed and overlaid with secondary biotinylated goat antirabbit IgG (1:35) and incubated for 60 min. After washing twice with Tris-buffered saline, slides were overlaid with streptavidin, conjugated horseradish peroxidase (Vectastain ABC reagent) and incubated for 45 min. Diaminobenzidine was used for chromogenic localization of the chemokine antigen.
Establishment of RL-251 cell line
A cell suspension was prepared from a tumor specimen after treatment with collagenase and plated in fibronectin-coated plastic with RPMI 1640 medium containing 10% FBS and basic fibroblast growth factor. After several passes the cells were able to grow in uncoated plastic and in the absence of growth factors with a control population doubling time of 36 h. Colony formation experiments indicated a 35% plating efficiency. These cells did not produce significant amounts of cortisol in vitro. The cells had an abnormal diploid karyotype with numerous deletions and translocations. NCI-H295 cells obtained from the American Type Culture Collection (Manassas, VA) were used as control. These cells belong to a steroid-secreting, human adrenocortical carcinoma cell line established by Gazdar (3) with a 7-d doubling time. Cell growth for both cell lines was evaluated by measuring relative protein content using the sulforhodamine B assay (4) at baseline and at various times after incubation.
Measurement of CXC chemokines. IL-8, ENA-78, and
growth-related oncogenes (Gro and Gro ) were measured in
supernatant of tumor cell cultures using specific ELISAs (5, 6). Flat-bottom 96-well microtiter plates (NUNC IMMUNO-PLATE
I96-F) were coated with a 50 µl/well of the polyclonal antichemokine
antibodies for 24 h at 4 C and washed with PBS, 7.5, 0.005%
TWEEN-20 (wash buffer). Microtiter plate nonspecific-binding sites were
blocked with 2% BSA in PBS and incubated for 60 min at 37 C. Plates
were rinsed three times. A 50-µL sample was added followed by
incubation for 1 h at 37 C. Biotinylated polyclonal rabbit
anti-CXC chemokines, streptavidin-peroxidase conjugate, and chromogen
substrate were sequentially added to the plates, each time followed by
incubation and washings. After the addition of chromogen substrate, the
plates were incubated at room temperature to the desired extinction and
the reaction terminated with a 50-ml/well of 3
MH2SO4 solution. Plates were read at 490 nm in an
automated microplate reader.
Establishment of an animal model. An adrenal cancer/severe combined immunodeficiency (SCID) mouse chimera was developed with each of the two cell lines, RL-251 and NCI-H295. Fox Chase SCID CB 17 mice, 4–6 wk of age, were injected sc in the flank with 1 x 106 cells suspended in 100 µl RPMI 1640 media. A 90% tumor take was observed. Animals were maintained under sterile conditions in laminar floor rooms in the Unit for Laboratory Animal Medicine, and studies were conducted in accord with the principles and procedures outlined for the use of animals in research.
Passive immunization studies. To test the hypothesis that the CXC chemokines promoted tumor growth in the RL-251/SCID mouse chimera, mice were passively immunized with anti ENA-78 antisera to block its angiogenic and chemotactic activity. Polyclonal rabbit antihuman ENA-78 sera were produced by immunization of rabbits with ENA-78 (Preprotech, Rocky Hill, NJ) in multiple intradermal sites with complete Freund’s adjuvant. Antibody specificity was confirmed by Western blot analysis against recombinant human ENA-78. The antibody was found to neutralize 30 ng of ENA-78 at a dilution of 1:1000. Twenty SCID mice were inoculated with RL-251 cells (1 x 106 cells/inoculate) sc in each flank. Ten animals were injected with anti-ENA-78 sera ip every 2 d for 6 wk beginning at the time of inoculation. The other 10 animals were injected with normal rabbit serum ip every 2 d and used as controls. At the completion of the study, animals were euthanized and tumors harvested, weighed in a Mettler balance, and partitioned for endothelial cell and leukocyte markers.
Endothelial cell and leukocyte markers. Tumor tissue was digested with collagenase and DNAase and cell suspensions prepared. Specific antibodies against endothelial cell markers factor VIII and CD31 were added to wells of microtiter plates and cells delivered to each well and mixed. After incubation at 4 C for 20–40 min in the dark, they were washed and stained using fluorochromes and processed by flow cytometry. Results were expressed as percent of cells that stained positive for FVIII and CD31. Leukocyte infiltration was assessed by fluorescence-activated cell sorter (FACS) analysis of tumor digests.
Hormone assays. Serum cortisol levels were measured by an automated method, plasma ACTH by the Allegro Nichols assay, urinary 17-hydroxycorticoids by the method of Silber & Porter (7) and 17-ketosteroids by the method of Drekter (8). Urinary free cortisol was measured by RIA using Diagnostic Products Corporation (Los Angeles, CA) kits.
RT-PCR for IL-8 and ENA-78. RT-PCR was performed by the method of Baumforth et al. (9). IL-8 primers used were AAGCTGGCCGTGGCTCTCTTG and AGCCCTCTTCAAAAACTTCTC. The upstream primer was located at the 3' end of exon 1 and the downstream primer was located at the 3' of exon 3 and overlapped exon 4 by three base pairs (GenBank accession M28130). ENA-78 primers were GAACCCGCGACCGCTCGCAGC and CCTATGGCGAACACTTGCAGA. The upstream primer began at base 294 of ENA-78 messenger RNA and the downstream primer began at base 428 (GenBank accession x78686). Porphobilinogen deaminase (PBGD) primers for both IL-8/PBGD AND ENA-78/PBGD were ACGATCCCGAGACTCTGCTTCG and GGTTACATTAAAGGCTGTTGCTTG.
Results
In vitro studies
Immunoreactive ENA-78 was present in tumor sections stained by an
immunoperoxidase method and suggested that the tumor was producing this
chemokine (Fig. 2). We then measured CXC
chemokine expression in vitro during incubation of RL and
NCI-H295 tumor cells. Conditioned media was harvested from confluent
cultures of both cell types at 1, 3, and 6 d. High levels of CXC
chemokines (IL-8, ENA-78, Gro and Gro ) were observed in
cultures of the RL-251 cells (Fig. 3).
Expression of CXC chemokines was undetectable in culture supernatants
of the NCI-H295 cells.
|
|
An adrenal cancer/SCID mouse chimera was developed with each of
these cell lines. Mice transplanted with RL-251 cells grew tumors
within 2–3 wk. Animals were euthanized at the end of the study and
peripheral blood obtained through cardiac puncture for analysis of IL-8
and ENA-78. Circulating chemokine levels were detected in every animal
(Fig. 4). In contrast, blood obtained
from animals transplanted with NCI-H295 cells did not have detectable
chemokine levels. The mean peripheral white blood cell count of the RL
mice (n = 5) was 56.8 x 103 with
90.4% neutrophils, compared with 2.0 x 103
with 70% neutrophils in the control mice without tumors (n = 3);
P < 0.001. Tumors were dissected from the sc tissue,
weighed, and examined histologically. A high-power view of the
hematoxylin and eosin (H&E) stained sections of the RL-251 CXC
chemokine producing mouse tumor showed a carcinoma histologically
similar to the original surgical specimen. Tumor cells were surrounded
by an intense neutrophil infiltrate (Fig. 5). Tumor sections stained positive for
ENA-78. In contrast, the tumor derived from NCI-H295 cells did not show
a neutrophil infiltrate. Also and in contrast to animals with the
NCI-H295 tumors, animals with the RL-251 tumors exhibited marked
leukocyte infiltration of their livers. The growth rates of the two
cell lines in vitro and tumors in vivo were
different. Doubling time (mean ± SD) for
the CXC chemokine-secreting cells was shorter 44 ± 7.2 h
than the nonchemokine-producing cells, 109 ± 15.3;
P < 0.001. Tumors derived from the CXC
chemokine-producing cell line grew faster than the
nonchemokine-producing tumors. Mice inoculated with 10 x
106 RL-251 cells took 12 d to show tumors,
compared with 80 d for a similar inoculate dose of the NCI-H295
cells.
|
|
). Leukocyte
infiltration, as assessed by FACS analysis of tumor digests was also
decreased (Fig. 7)
|
|
. As expected, RL-251 cells had cDNA
for both IL-8 and ENA-78. H-295 cells that do not produce either
chemokine in vitro or in vivo did not have cDNA
for IL-8 but had cDNA for ENA-78. Six of seven adrenal carcinomas and
one of three adenomas had cDNA for IL-8. Six of seven carcinomas and
the three adenomas had cDNA for ENA-78.
|
We suggest that the patient’s clinical presentation resulted from increased tumor production of chemotactic chemokines that mobilized white cells and produced an inflammatory syndrome with fever and leukocytosis. This is supported by the presence of positive signal for ENA-78 obtained in tumor sections by immunohistochemistry. The patient also had biochemical evidence of ACTH-independent cortisol production by the tumor but urinary free cortisol levels were normal, and he did not have clinical evidence of Cushing’s syndrome. This biochemical profile has been described as preclinical Cushing’s syndrome and found in association with incidentally discovered adrenocortical tumors (10). We investigated whether CXC chemokine production was an isolated occurrence in this patient or a feature of other adrenocortical tumors by surveying archival adrenocortical tumors for presence of inflammatory cells and message for IL-8 and ENA-78. Inflammatory infiltrates were found in 30% of the tumors, and message for IL-8 and ENA-78 was detected in the majority of both malignant and benign adrenocortical tumors.
A unique cell line derived from our patient’s tumor was able to
produce IL-8, ENA-78, Gro , and Gro . These four cytokines are
members of the CXC chemokine family. In their monomeric form, the CXC
chemokines range in mass from 7 to 10 kDa and are characteristically
basic, heparin-binding proteins. These chemokines display four highly
conserved cysteine amino acid residues, with the first two cysteines
separated by a nonconserved amino acid residue (CXC) (11).
The CXC chemokines are all clustered on human chromosome 4 (q12-q21)
and exhibit 20–50% homology on the amino acid level. The CXC
chemokine family was originally recognized for their leukocyte
chemotactic activity. However, these cytokines can also behave as
angiogenic or angiostatic factors depending upon the presence or
absence, respectively, of a three amino acid motif, glu-leu-arg (ELR
motif) that precedes the first conserved amino acid residue in the
primary structure (12). The four CXC chemokines produced
by this cell line contain the ELR motif and possess angiogenic
activity.
The possibility that an adrenal neoplasm can overproduce chemokines is
consistent with the observation that the normal adrenal produces
cytokines. Main sources are local immune cells (13) and
adrenal cortical cells. When stimulated, these immune cells secrete a
variety of cytokines, including IL-1, IL-6, and TNF- and peptides
such as VIF and TGF-ß (14, 15) that can influence
adrenal cortical function. Although there is extensive literature
regarding cytokines in the adrenal cortex, there are no reports
examining the expression or secretion of the subclass of CXC
chemokines. It is possible that these chemokines are locally produced
and play an autocrine role in the growth and proliferation of
adrenocortical cells. The interplay of growth factors, cytokines, and
hormones in adrenal cortical growth and differentiation may also be
important in adrenal tumorigenesis once the initial oncogenic event has
occurred. The potential role of cytokines in adrenal tumors is also
highlighted by a report of a cortisol-secreting adrenocortical adenoma
infiltrated with macrophages and leukocytes containing CD 45 and CD 8
markers (16). This adenoma had high expression of IL-1
receptors, and tumor cells in vitro showed a dose-dependent
increase in cortisol secretion. This tumor, however, was not shown to
produce either IL-1 or other cytokines. Although paraneoplastic
clinical syndromes associated with other tumors have been described as
mediated by cytokines, this is the first report of a clinical syndrome
associated with overproduction of CXC chemokines.
CXC chemokines have been shown to influence tumorigenesis in other types of neoplasms. IL-8 and ENA-78 have been found to promote tumor growth in non-small-cell lung cancer (NSCLC) (5, 17, 18). Using an NSCLC/SCID mouse chimera developed with two different human NSCLC cell lines, IL-8 production correlated directly with the rate of tumor growth (19). When IL-8 was depleted in vivo by passive immunization with neutralizing antibodies, tumorigenesis was markedly reduced through a reduction in tumor-associated vascular density and angiogenic activity (6). Similar findings have been shown for ENA-78. These findings indicate that IL-8- and ENA-78-mediated angiogenesis is critical to tumorigenesis of human NSCLC. Our studies with passive immunization of the RL-251/SCID mouse chimera suggest that this mechanism can now be extended to adrenal cortical carcinoma.
Neutrophil infiltration in association with tumor cells may contribute to the process of tumorigenesis. Interactions between leukocytes and tumor cells can occur at different stages of tumor cell dissemination. For example, lymphocytes and monocyte/macrophages can infiltrate the tumor mass and modulate tumor cell migration and proliferation by means of the release of cytokines, growth factors, and chemotactic peptides. In turn, tumor cells can modulate their own proliferation through the release of growth and transforming factors. (20, 21, 22).
There are indications that an inflammatory reaction surrounding any tumor may enhance tumor invasion. For example, infection may cause progression of some forms of adenocarcinoma of the ascending colon (23). Experimentally, tumor cells infected with microbial particles can grow faster, invade surrounding normal tissue, and metastasize more rapidly than noninfected ones (24). Murine fibrosarcoma cells, infected with Candida albicans, produced tumors that appeared sooner and grew more rapidly than tumors produced by uninfected control cells. In contrast to noninfected tumors, infected tumors were characterized by a marked polymorphonuclear leukocytic response. This leukocytic response was associated with widespread invasion of normal tissues surrounding the tumor that was not present in the tumors developed from noninfected cells. The infected animals developed micrometastases more rapidly throughout the lungs with small clusters of tumor cells visible in both intravascular and extravascular locations.
The presence of large numbers of leukocytes may facilitate tumor spread by degrading the normal tissue surrounding the tumor. A variety of substances originating in the neutrophil granule are actively secreted by leukocytes in vitro upon stimulation. These substances could dissolve the tumor matrix, help mobilize tumor cells, and facilitate their migration through tissues and endothelium for blood vessel invasion (25, 26). The combination of neovascularization and neutrophil-mediated disruption of tumor matrix together with other effects on capillary attachment and penetration may be important steps in tumor growth and metastasis. This process could be repeated in distant sites, further promoting the dissemination of tumor.
The frequency at which chemokine production is a feature of adrenocortical carcinoma remains to be confirmed. Our finding that 30% of archival adrenal carcinomas had inflammatory cells and many of the adrenocortical tumors had message for IL-8 and ENA-78 by RT-PCR suggests that CXC chemokines may play an important role in adrenal tumorigenesis. The presence of cDNA for IL-8 and ENA-78 in archival adrenocortical tumors does not prove active secretion of CXC chemokines by these tumors. It does, however, support the possibility that these chemokines are secreted and enhance tumor growth by a systemic effect or modulate tumor growth by paracrine effects.
Footnotes
This work was supported in part by NIH Grants NCRR-M-01-RR-000-42, CA- 87879, and HL-66027 and the Millie Schembechler Adrenal Cancer Research Fund of the University of Michigan Comprehensive Cancer Center.
Abbreviations: CT, Computerized tomography; ENA-78,
epithelial neutrophil activating protein 78; FACS,
fluorescence-activated cell sorter; Gro and Gro , growth-related
oncogenes; H&E, hematoxylin and eosin; NSCLC, non-small-cell lung
cancer; PBGD, porphobilinogen deaminase; SCID, severe combined
immunodeficiency.
Received September 19, 2000.
Accepted April 27, 2001.
References
This article has been cited by other articles:
 |
|
 |
|
  F. M. Barlaskar, A. C. Spalding, J. H. Heaton, R. Kuick, A. C. Kim, D. G. Thomas, T. J. Giordano, E. Ben-Josef, and G. D. Hammer Preclinical Targeting of the Type I Insulin-Like Growth Factor Receptor in Adrenocortical Carcinoma J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 204 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Else, T. J. Giordano, and G. D. Hammer Evaluation of Telomere Length Maintenance Mechanisms in Adrenocortical Carcinoma J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1442 - 1449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wen, S. F. Giardina, D. Hamming, J. Greenman, E. Zachariah, M. D. Bacolod, H. Liu, J. Shia, P. S. Amenta, F. Barany, et al. GRO{alpha} Is Highly Expressed in Adenocarcinoma of the Colon and Down-Regulates Fibulin-1. Clin. Cancer Res., October 15, 2006; 12(20): 5951 - 5959. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. G. Romero, G. R. Vergara, Z. Zhu, G. S. Covington, M. W. Plonczynski, L. L. Yanes, E. P. Gomez-Sanchez, and C. E. Gomez-Sanchez Interleukin-8 Synthesis, Regulation, and Steroidogenic Role in H295R Human Adrenocortical Cells Endocrinology, February 1, 2006; 147(2): 891 - 898. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Rotondi, A. Falorni, A. De Bellis, S. Laureti, P. Ferruzzi, P. Romagnani, A. Buonamano, E. Lazzeri, C. Crescioli, M. Mannelli, et al. Elevated Serum Interferon-{gamma}-Inducible Chemokine-10/CXC Chemokine Ligand-10 in Autoimmune Primary Adrenal Insufficiency and in Vitro Expression in Human Adrenal Cells Primary Cultures after Stimulation with Proinflammatory Cytokines J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2357 - 2363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Bornstein and P. J. Hornsby What Can We Learn from Gene Expression Profiling for Adrenal Tumor Management? J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1900 - 1902. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
