| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Division of Endocrinology, Department of Medicine (I.A.H.), Children’s Hospital, Boston, Massachusetts 02115; Cancer Genetics Department (A.E.N., B.G.R., R.S.M., D.J.M.), Kolling Institute of Medical Research, Royal North Shore Hospital, Sydney 2065, Australia; Department of Physiology and Institute for Biomedical Research (A.E.N., R.S.M.), University of Sydney, Sydney 2006, Australia; Department of Medicine (B.G.R., D.J.M.), University of Sydney, Sydney 2006, Australia; The New Children’s Hospital (C.T.C.), Westmead 2145, Australia; and Department of Pediatrics (Endocrinology) (T.O.C.), Yale University School of Medicine, New Haven, Connecticut 06520-8064
Address all correspondence and requests for reprints to: Ingrid A. Holm, M.D., Division of Endocrinology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115. E-mail: ingrid.holm{at}tch
Abstract
PHEX is the gene defective in X-linked hypophosphatemic rickets. In this study, analysis of PHEX revealed mutations in 22 hypophosphatemic rickets patients, including 16 of 28 patients in whom all 22 PHEX exons were studied. In 13 patients, in whom no PHEX mutation had been previously detected in 17 exons, the remaining 5 PHEX exons were analyzed and mutations found in 6 patients. Twenty different mutations were identified, including 16 mutations predicted to truncate PHEX and 4 missense mutations.
Phenotype analysis was performed on 31 hypophosphatemic rickets patients with PHEX mutations, including the 22 patients identified in this study, 9 patients previously identified, and affected family members. No correlation was found between the severity of disease and the type or location of the mutation. However, among patients with a family history of hypophosphatemic rickets, there was a trend toward more severe skeletal disease in patients with truncating mutations. Family members in more recent generations had a milder phenotype. Postpubertal males had a more severe dental phenotype. In conclusion, although identifying mutations in PHEX may have limited prognostic value, genetic testing may be useful for the early identification and treatment of affected individuals. Furthermore, this study suggests that other genes and environmental factors affect the severity of hypophosphatemic rickets.
FAMILIAL HYPOPHOSPHATEMIC RICKETS (FHR) represents a group of disorders characterized by a defect in renal phosphate transport leading to phosphate wasting and hypophosphatemia. FHR is also characterized by abnormal regulation of vitamin D metabolism, resulting in inappropriately normal 1,25-dihydroxyvitamin D concentrations in the face of hypophosphatemia. The manifestations of FHR include skeletal deformities, short stature, osteomalacia, dental abscesses, and bone pain.
X-linked hypophosphatemic rickets (HYP), inherited in a dominant manner, is the most common form of FHR (1). Autosomal dominant hypophosphatemic rickets (ADHR) (2, 3, 4, 5, 6) and autosomal recessive hypophosphatemic rickets have also been reported (7, 8, 9, 10, 11). Individuals with the features of FHR but no family history of rickets (sporadic cases) are also common, and many subsequently transmit the phenotype in an X-linked dominant manner consistent with HYP (12).
PHEX, located on Xp22.1, has been identified as the gene defective in HYP (13). The predicted protein is homologous to a family of neutral endopeptidases, including neprilysin (NEP) (14), endothelin-converting enzyme-1 (ECE-1) (15), and the Kell antigen (16). We previously demonstrated that the 1916-bp partial PHEX cDNA initially identified (13) consisted of 18 exons (17). We also showed conservation between the genomic structures of PHEX, NEP, and ECE-1 (17). Like NEP and ECE-1, PHEX contains a short N-terminal tail, a single N-terminal hydrophobic region characteristic of a transmembrane domain, and a highly conserved zinc-binding pentapeptide (HEFTH) motif at the 3' end in exon 17 (17, 18, 19, 20, 21). The full-length PHEX cDNA has since been cloned (22, 23) and consists of a 2247-bp coding region spanning 22 exons (18). PHEX has a second zinc-binding motif (ENIADNGG) in exon 19 that is highly conserved in the neutral endopeptidase family (18, 19, 20, 21). Additional conserved features among PHEX and the neutral endopeptidases include several conserved cysteine residues (18, 19, 20, 21) and three highly conserved amino acids (Glu 581, Asp 646, and His 710 in PHEX) that in NEP are involved in its catalytic activity (18, 19, 20).
The function of PHEX, and the role of PHEX in renal phosphate transport, has yet to be elucidated. In humans and in mice, PHEX messenger RNA is expressed in osteoblasts (21, 24), odontoblasts (24), ovary, and lung (22, 23, 25). Significantly, no PHEX messenger RNA expression has been detected in the kidney (22, 23, 25). There is in vitro evidence supporting a cell membrane location for PHEX and evidence that PHEX degrades parathyroid-derived peptides, suggesting that PHEX does indeed function as an endopeptidase (26).
Mutation analyses performed by our group and others have identified mutations in PHEX in individuals with HYP (17, 18, 20, 27, 28). In our previous report (17), 17 of the PHEX exons were analyzed in 22 patients and PHEX mutations were detected in 9 patients. To complete our analysis of the PHEX gene in patients with HYP, we analyzed the remaining 5 PHEX exons in the 13 patients in whom no PHEX mutation was detected in our previous study (17) and all 22 PHEX exons in an additional 28 patients.
There is considerable variability in the phenotype manifested in HYP, from mild hypophosphatemia to severe deformities of the long bones requiring surgical correction (29). Mutational analysis in a total of 50 unrelated patients with HYP scored for phenotypic severity has allowed for a detailed genotype-phenotype analysis examining the possibility of correlation between phenotype severity and either the type or location of the mutation. Furthermore, we examined whether the phenotype severity changed with successive generations within a family. Finally, given evidence both for and against a gene dose effect in HYP (30, 31, 32, 33, 34, 35), phenotype analysis was performed to identify any correlation between disease severity and sex of the individual.
Here we report our mutational analysis of all 22 PHEX exons in 28 individuals with HYP and 5 PHEX exons in 13 individuals with HYP (familial and sporadic cases). We present phenotype analysis of all patients in whom a mutation was detected in this and our previous study (17) and all available affected family members for familial cases. Finally, we report our analysis of potential correlation between phenotype and genotype and our investigation of reverse anticipation and gene dosage effect.
Subjects and Methods
Patient population
A total of 50 unrelated patients with HYP were studied, including the 22 previously reported patients in whom mutation analysis of exons 1–14 and 16–18 was performed (17). Thirty-five individuals had a family history of HYP and 15 were sporadic cases with no affected family members. One individual previously described (17) was a female with sporadic HYP and a de novo, apparently balanced translocation 46,XX,t(9;13)(q22;q14). Phenotype analysis was performed on the 31 patients in whom mutations were detected, including the 22 patients detected in this study, and the 9 patients previously reported (17). For familial cases, phenotype information was collected for all available affected family members.
Patients were studied from the Endocrine Clinic at the Children’s Hospital in Boston, the Pediatric Endocrine Clinic at Massachusetts General Hospital in Boston, the Children’s General Clinical Research Center at Yale University School of Medicine in New Haven, Connecticut, the National Institutes of Health in Bethesda, Maryland, Johns Hopkins Hospital in Baltimore, and the Royal North Shore Hospital and the New Children’s Hospital (formerly the Royal Alexandra Hospital for Children) in Sydney, Australia. Ethics approval for the study was sought and received from the Committee for Clinical Investigation at Children’s Hospital in Boston, the Ethics Committees of Royal North Shore Hospital and the New Children’s Hospital in Sydney, and the Human Investigation Committee at Yale University School of Medicine.
DNA had previously been obtained from the 13 individuals in whom no PHEX mutation was detected in exons 1 through 14 and 16 through 18 in the previous study and from their family members (17). For the 28 individuals whose DNA had not been previously screened for PHEX mutations, informed consent was obtained, blood collected, and DNA extracted from 95 individuals, including 64 individuals with HYP and 31 unaffected family members.
Mutation analysis was carried out on one affected individual from each family; a male was chosen for the mutational analysis if possible (24 patients). DNA from a 46,XX and a 46,XY cell line was used as controls for single-strand conformation polymorphism (SSCP) analysis. DNA from an additional 96 unaffected, unrelated individuals was used to determine whether putative missense mutations were polymorphisms.
Mutational analysis of PHEX
SSCP analysis was performed on each of the 22 PHEX exons by PCR amplification using 30 ng of patient DNA. Primers were used for exons 1 through 14 and 16 through 18, as previously described (17) and for the other exons were as follows: 15F CCTGCCTGTATAATGATGATTG, 15R ACCAGGTTACCAAGGAGACA, 19F TTCCTTTTTTCTTTCTGTTAG, 19R GCTTGATTTTTAGAACCACGG, 20F TGAGCAAAGAG- AAAAAC CCACCGTT, 20R GGAGCAAACTCAAGTCCTGCATCTC-, 21F GAATGAAAGCTCATTTGTTGGG, 21R TCTGGTAGAGCCCTTGGATG, 22F CAGAACCTGTTGATGTGCAAGA, and 22R GTCTCAGGATGCCATAAACCAGC (primers for exons 19 through 22 were designed based on the sequence surrounding exon 19 through 22 kindly provided by Fiona Francis, Institut Cochin de Genetique Moleculaire, Paris, France). The PCR products were separated by electrophoresis on 0.5x MDE gels (FMC Bioproducts, Rockland, ME), with and without glycerol (10%), at room temperature. In heterozygous females and in some males, the aberrantly migrating bands were excised from the gel, the DNA eluted in 100 µl H2O for 6–12 h, and 5 µl of the eluted DNA used for a second round of PCR amplification with the primers used for SSCP analysis. In several cases the apparently normal allele was also excised, eluted, and amplified by PCR to use as a control. In most males, exons were amplified by PCR using 120 ng of genomic DNA. In all cases, the PCR products were purified using the Wizard PCR Preps DNA purification system (Promega Corp., Madison, WI) and sequenced with the same primers used for SSCP analysis. All sequencing in this study was performed on either an ABI 373 or ABI 377 sequencer. Sequence comparisons were carried out using Sequencher (Gene Codes Corp., Amersham Pharmacia Biotech, Piscataway, NJ).
Mutations that altered a restriction enzyme site were confirmed by restriction digest as follows: 120–250 ng of genomic DNA from the affected individual and either from affected and unaffected family members (if available) or from two to five unrelated unaffected individuals (negative controls) were amplified by PCR with primers used for SSCP analysis. The PCR products were separated by electrophoresis on a 1% agarose gel, excised from the gel and purified using the Wizard PCR Preps DNA purification system (Promega Corp.), or purified by phenol-chloroform extraction and ethanol precipitation. Fifteen to twenty microliters of the purified product were digested with 10–20 U of the restriction enzyme (New England Biolabs, Inc., Beverly, MA) and the products separated by electrophoresis on a 2–3% agarose gel.
Mutations that did not alter a restriction site were confirmed by performing the amplification-refractory mutation system (ARMS) as described (36) for affected and unaffected family members (if available), or by SSCP analysis and/or sequencing of affected and unaffected family members. One nonsense mutation was confirmed by cycle sequencing (CircumVent Thermal Cycle Didexoy DNA Sequencing Kit, New England Biolabs, Inc.). To exclude the possibility that putative missense mutations were not in fact polymorphisms present in the normal population, ARMS or SSCP analysis was carried out using DNA from unaffected unrelated individuals with no history of rickets (48 or 96 individuals, respectively).
Phenotype analysis
Phenotype analysis was performed in all 31 individuals found to have a mutation in the PHEX gene in this study and the previous study (17) and in all available affected family members. Individuals with sporadic occurrence of HYP were included. Data were collected by review of the medical records and performed by the patient’s physician. The number of dental abscesses and osteotomies performed were recorded. The physician responsible for the clinical care of the individual qualitatively assessed the degree of lower extremity bowing as none, mild, moderate, or severe. If the lower extremities were knock-kneed instead of bowed, this was recorded. Other potential determinants of phenotype, including sex, age, and age at diagnosis, were recorded. Details regarding each individual’s treatment regimen during childhood were obtained, including whether the treatment occurred and, if so, whether phosphate and vitamin D were used. Preparations of vitamin D or vitamin D metabolites were specified.
The two phenotypic features analyzed were the severity of skeletal disease and the severity of dental disease. These features were categorized using the objective criteria of history of osteotomies, severity of bowing for skeletal disease, and history of dental abscesses for dental disease. For each phenotypic feature, families analyzed as a unit, or generations analyzed as a unit, were categorized as having mild disease if all members had mild disease or moderate to severe disease if at least one member had moderate to severe disease.
The categories were defined as follows:
1. Skeletal Disease. Twenty-nine families or unrelated individuals (sporadic cases) analyzed. Mild: Individual or all family members with no history of osteotomies and no or only mild bowing. Moderate to severe: Individual or one or more family members with a history of osteotomies and/or moderate to severe bowing.
2. Dental Disease. Twenty-seven families or unrelated individuals (sporadic cases) analyzed. Mild: Individual or all family members with no dental abscesses. Moderate to severe: Individual or one or more family members with dental abscesses.
Statistical analysis
To test the hypothesis that severity of phenotype was associated with mutation type or location, the affected individuals within a family (with the same mutation) were grouped and analysis performed on a family-as-a-unit basis, as performed in other genotype/phenotype studies (37). The two-tailed Fisher’s exact test (38) was used to calculate the P value and determine whether there was a statistically significant difference between the phenotypes of the genotype groups. Owing to our relatively small sample size, there may not be sufficient power to detect even moderately large associations at the usual significance level of P < 0.05. In order to not miss a potentially relevant correlation, and in accordance with previously published analyses for small sample sizes (39), we chose to employ a significance level of P < 0.10. This enabled trends to be identified that may be confirmed in later studies with a larger sample size.
Results
Mutations detected in PHEX
Mutations in PHEX were detected in 22 patients in this study (Tables 1, A–D). Mutations were detected among 16 of the 28 patients in whom all 22 exons were studied. Among the 13 individuals in whom no mutation had previously been identified in exons 1–14 and 16–18 (17), 6 mutations were detected, 5 of which were detected in exons not previously studied; a previously undetected mutation in exon 13 in one individual was detected. Interestingly, no PHEX mutation was detected in the patient previously reported (17) with the balanced translocation 46,XX,t(9;13)(q22;q14). The locations of the mutations detected in the PHEX gene are shown in Fig. 1.
Six nonsense mutations were detected, in which a single base pair change resulted in a stop codon predicted to cause truncation of the protein. Of interest, the 2 nonsense mutations detected in exon 22 (C746x and R747x) were predicted to lead to truncation of only 4 and 3 amino acids, respectively, from the C-terminal end of the protein. One large deletion of exons 1–3 was detected in a male; the 5' and 3' ends were not determined. Four small deletions of 1–2 bp, and one insertion of 4 bp, were detected, all resulting in downstream stop codons predicted to truncate the protein. Splice site mutations were detected in 5 individuals, including a mutation in the splice donor site of exon 13 (IVS13 + 1G > C), which was detected in 2 unrelated individuals.
Missense mutations were identified in 5 individuals. One missense mutation (P534L) was detected in 2 unrelated individuals. SSCP analysis performed in 96 normal individuals demonstrated that none of the mutations were likely to represent a polymorphism occurring in the random population.
Two silent polymorphisms were identified in the coding sequence of PHEX. The polymorphism c.24C > T (S8S) in exon 1 was detected in an unaffected 46,XX individual used as a control for SSCP analysis. The polymorphism c.690C > T (A230A) in exon 6 was found in the individual (AJ32) who had the W314x mutation. The c.690 C > T polymorphism obliterated an HaeIII restriction site and was confirmed by restriction digest. The presence of 2 previously reported polymorphisms in exons 18 and 19 (20) were confirmed by SSCP analysis and were not sequenced.
The mutations detected were confirmed by restriction digest when a restriction enzyme site was altered, by SSCP analysis and/or sequencing of family members, or by ARMS analysis. The large deletion of exons 1–3 was shown to be absent in unaffected male family members by PCR amplification.
Genotype-phenotype analysis
Genotype-phenotype analysis was performed in the 31 patients found to have a mutation in the PHEX gene, including the 22 patients reported in this study and the 9 patients previously reported (17) (Tables 1, A through D). For familial cases, phenotypic information was collected from all available affected family members. The total number of individuals for whom phenotypic information was collected, including sporadic cases, was 84.
a) Correlation of phenotype with mutation type and location
For the families studied, analyses were carried out on a
family-as-a-unit basis (37). The familial and sporadic
patients in whom mutations were detected (31 patients) were analyzed
together as a group. Separate analyses were also carried out on the
familial group (24 families) and the sporadic group (7 individuals),
with the aim of identifying trends specifically associated with either
of these groups (Table 2
).
|
, the region 5' of position 649 includes the PHEX
transmembrane domain and the 2 zinc-binding motifs in exons 17 and 19
(position 642–649), which are highly conserved in the neutral
endopeptidase family (18, 19, 20, 21). The region 5' of position
649 includes 7 of the cysteine residues, which are also highly
conserved in the neutral endopeptidase family
(18, 19, 20, 21).
|
). However, the
association between more severe skeletal disease and truncating
mutations was close to the significance level for this relatively small
sample size (P = 0.112, see Subjects and
Methods). When analyses were carried out on the familial and
sporadic groups separately, a trend between truncating mutations and
more severe skeletal disease was identified in the familial group
(P = 0.072).
Several anecdotal observations were made. The first was that the two
families with the nonsense mutations C746x and R747x, which resulted
in putative truncations of only 4 and 3 residues, respectively, from
the 3' end of PHEX, exhibited moderate to severe skeletal and dental
phenotypes (Table 1A).
|
). The phenotypes of these two
individuals were similar, with moderate to severe skeletal disease and
mild dental disease. The second mutation occurring in two unrelated
patients was a missense mutation, P534L, in family AB and in the
sporadic case 123–03 (Table 1D). The individuals with this missense
mutation, unlike the individuals with the splice site mutation,
differed in the severity both of their skeletal and dental disease.
|
|
), 081, and 109 (Table 1B).
|
We tested the hypothesis that within a family, affected
individuals in later generations exhibit reverse anticipation; that is,
they have a less severe phenotype, compared with affected individuals
in earlier generations (Table 3, Test 1).
For each family, information on the two most recent generations was
analyzed, when available, and the generation was classified as a whole
for the severity of disease. Eighteen families were analyzed for
severity of skeletal disease and 15 families analyzed for severity of
dental disease. There was significantly milder dental disease
(P = 0.025) and a trend toward milder skeletal disease
(P = 0.060) in the younger generation (generation II in
Table 3). Such an effect may be expected, given the general impression
that better treatment regimens have been implemented over time. The
less severe phenotype in the younger generation may also be due to
earlier onset of treatment, although the younger age of many of the
patients in generation II at observation was a variable that was not
controlled for in this analysis. The small numbers available precluded
more detailed statistical analysis.
|
The hypothesis that males may have a more severe phenotype than
females owing to a gene dosage effect was tested on all affected
patients as a group, and separate analyses were also carried out on
patients grouped as prepubertal or postpubertal (Table 3, Test 2). Each
group was analyzed separately for skeletal phenotype (26 males and 50
females) and for dental phenotype (19 males and 41 females). The same
definition was used for prepubertal status as by Whyte et
al. (33) in their phenotype analysis, namely less
than 10 yr of age for girls and less than 12 yr of age for boys. No
significant correlation was found for the whole group between the sex
of the patient and the severity of skeletal or dental disease
(P = 0.145 and P = 0.272,
respectively). When prepubertal and postpubertal patients were analyzed
separately, there was a trend toward more severe dental disease in
males in the postpubertal group (P = 0.064).
Discussion
The role that PHEX plays in the pathophysiology of HYP and in regulation of phosphate transport is unclear. In this study, mutational analysis of PHEX in a group of 50 patients with HYP was completed, and the dental and skeletal phenotype of patients with PHEX mutations, and their affected family members, was compiled. This allowed for determination of any correlation between the phenotype of these patients and the genotype (type or location of the mutation), generational position within a family, or sex of the individual.
Mutational analysis
Mutational analysis of the 22 PHEX exons in 28 individuals with HYP revealed mutations in 16 patients (57%). Six mutations were detected among 13 individuals in whom 17 of the 22 PHEX exons had previously been tested. Twenty different mutations were found because two mutations (IVS13 + 1G > C and P534L) were each detected in two unrelated families. Five of the 20 mutations (Q51x, P534L, IVS15+1G > A, R702x, and R747x) have been previously described (18, 20, 27, 28, 40). Of note, although novel mutations in PHEX are common, at least one mutation, P534L, has now been found in 9 individuals among several studies, including two in this study. A founder effect is unlikely because these individuals were from several different countries. In addition, one of the patients in our study with the P534L mutation () was a sporadic case. This was confirmed by sequencing PHEX exon 15 in both parents, which demonstrated that neither parent had the mutation. Thus, 123–03 had a de novo P534L mutation in PHEX, which excludes a founder effect in our study. The P534L mutation is in exon 15, and 18% of the mutations in this study, were detected in exon 15. Filisetti et al. (27) have also reported a high density of mutations in exon 15 and also in exon 17, in which the zinc-binding pentapeptide motif is located. Apart from this clustering, there are no apparent "hot spots" for mutations, with mutations being detected throughout the PHEX gene.
Combining the results of this study and our previous study in which 9 mutations were reported (17), PHEX mutations have been identified in 31 of 50 patients (62%), which is comparable to the mutation detection rate reported in other studies of the PHEX gene using SSCP analysis (18, 20, 28). When the familial and sporadic cases were separated, we found that mutations were detected in 69% (24 of 35) of familial cases, which is within the range of sensitivity of SSCP (41, 42, 43, 44). All of the families in whom no PHEX mutation was detected had an inheritance pattern consistent with X-linked dominant inheritance (although the families were too small to perform linkage studies to confirm this).
On the other hand, in this study, as in the other studies (18, 20, 28), the mutation detection rate was lower in sporadic cases (7 of 15 cases, 47%) than in familial cases (69%). One possible explanation is that some apparently sporadic cases could have ADHR with undiagnosed family members, given the decreased penetrance and loss of the phosphate-wasting defect described in this condition (3). Recently, mutations in a novel gene, fibroblast growth factor 23 have been identified in families with ADHR (45). However, in their study White et al. (45) found no fibroblast growth factor 23 mutations among the 18 patients with HYP without PHEX mutations. Alternatively, some sporadic cases could have autosomal recessive hypophosphatemic rickets, the gene for which this has not been cloned. Evidence for locus heterogeneity of HYP was also reported in one early linkage analysis study (46).
The majority of the PHEX mutations detected (21 of 29) are predicted to lead to truncation of the PHEX protein product. These include 9 nonsense point mutations, 1 large deletion, 6 small deletions or insertions that resulted in a downstream stop codon, and 5 splice-site mutations. Two of the nonsense mutations C746x and R747x resulted in predicted truncations of only 4 or 3 amino acids, respectively, from the C-terminal end of the protein. The cysteine residue at 746 is highly conserved between PHEX and the other members of the neutral endopeptidase family and is probably involved in disulfide-bond formation and in protein folding. The arginine residue at 747 is also conserved in the neutral endopeptidase neprilysin (18, 20) and has been shown to be involved in substrate binding in neprilysin (47).
Eight point missense mutations resulting in single amino acid substitutions were identified. Using sequence comparisons made with other members of the neutral endopeptidase family previously described (20), these mutations are predicted to alter amino acids that are highly conserved (C85Y, M253I, L378P, P534L, G572D, G579V, S711R) or, in one case, results in a change to a cysteine residue (R166C). The conserved amino acids include a cysteine residue likely to be involved in disulfide bond formation (C85Y) and a residue (P534L) predicted to disrupt PHEX catalytic site interactions by changes in secondary structure of the protein (20). Other substitutions include residues immediately adjacent or close to residues or motifs predicted to be involved in the catalytic site of PHEX (G572D, G579V, S711R) (20).
Genotype-phenotype analysis
Genotype-phenotype analyses were performed on the 31 patients in whom a mutation in PHEX was detected, and all affected family members for familial cases (a total of 84 individuals). The phenotype was assessed as severity of skeletal disease (mild vs. moderate to severe) and severity of dental disease (mild vs. moderate to severe) using objective criteria: history of osteotomy, degree of bowing, and history of dental abscesses. Skeletal and dental disease are the principal disease manifestations of X-linked HYP and have been used for previous assessments of the severity of the phenotype in studies of gene dosage (48). The family analyzed as a unit (or generation analyzed as a unit) was categorized as having moderate to severe disease if only one member had moderate to severe disease because the most severely affected family member was considered most likely to reflect the phenotype unmodified by factors such as treatment.
The first hypothesis tested was that patients with truncating mutations would have a more severe phenotype than those with nontruncating (missense) mutations. The second hypothesis tested was that patients with mutations located 5' of residue 649 would have a more severe phenotype than patients with mutations 3' of this sequence. Mutations in residues 1–649 would affect sequences with major predicted functional roles, including the transmembane domain of the PHEX protein and the two zinc-binding motifs (18, 19, 20, 21). No significant correlation was found between the severity of the skeletal or dental disease and either the type or location of the mutation for the total group of patients. A trend to more severe skeletal disease in patients with truncating mutations was found in the familial group. Anecdotal observations of the phenotypes exhibited by patients with the same mutations and patients with very small truncations of the protein would suggest, however, that a correlation between severity of the phenotype and the type or location of the mutation is unlikely. Further studies with larger sample sizes will be needed to investigate this association.
Analysis of phenotype was also carried out to test the hypothesis that affected individuals in later generations in a family may have a less severe phenotype (reverse anticipation). In the later (younger) generation of affected patients within a family, there was milder dental disease, which was statistically significant (P = 0.025), and a trend to milder skeletal disease (P = 0.060). The explanation for a milder phenotype may be the earlier onset of treatment or more effective treatment with the availability of 1,25-dihydroxy vitamin D in later generations. Another possible explanation for less severe dental disease in the younger generations is better general dental care or fluoridation. Specific dental defects, including enlarged pulp chambers and poorly mineralized dentin, are probably responsible for the frequent occurrence of dental abscesses in HYP (49, 50, 51). It is possible that improved dental care and fluoridation may affect the occurrence of these defects and thus have also contributed to the reduced occurrence of dental abscesses in the younger generation. It must also be noted that the age of observation of many of the patients was younger in the later generation. More detailed statistical analysis to control for such variables was precluded, however, by the small numbers available.
A broad analysis of the effect of sex on the phenotype of the individual was also performed to investigate whether males have a more severe phenotype than females owing to a gene dosage effect. HYP is an X-linked dominant disease. X-inactivation is the process of transcriptional silencing of one of the two X chromosomes in female cells to compensate for the dosage difference between females with two X chromosomes and males with one X chromosome. Random X-inactivation, resulting in about half of the normal alleles and half of the HYP alleles inactivated, would be predicted to result in a less severe phenotype in heterozygous females, compared with hemizygous males with no normal allele. Evidence against preferential inactivation of either the wild-type or mutant X chromosome was provided by demonstration of a random X-inactivation pattern in peripheral blood cells of patients with HYP (52). A recent X-inactivation analysis of the human X chromosome has indicated that the PHEX gene is subject to inactivation, although some escape from inactivation was detected (53).
Studies of Hyp mice, the mouse homologue of human HYP, have found no evidence for a gene dosage effect in serum phosphate concentration, femoral abnormalities, tail length, or vitamin D metabolism (34, 35). In human patients with HYP, no differences have been found in serum phosphate concentration between male and female adults (31) or in height z-scores, serum phosphate concentration, or renal phosphate reabsorption (TmP/GFR) in prepubertal children (33). There is evidence, however, for a more severe skeletal phenotype in male than in female adults (30, 31) and for a gene dosage effect on secondary dentin development in teeth of patients aged 15–25 yr (32).
In this study, no significant correlations were found between the sex of the patient and the severity either of skeletal or dental disease for the total group of affected individuals. All the affected patients available were included, and the analysis did not control for effects of treatment. Analysis was also carried out of the patients grouped as prepubertal or postpubertal by age to investigate any differences in gene dosage effect in these subgroups. Consistent with the previous findings of Whyte et al. (33), no statistical differences were found between male and female prepubertal children in this study, although the numbers were small. There was a trend identified to a more severe dental phenotype in postpubertal males than in females. This is consistent with the results of Shields et al. (32) who reported no evidence for a gene dosage effect in the tooth development of subjects below 15 yr of age, but in patients aged 15 to 25 yr, less development of secondary dentin mineralization in males was found.
In conclusion, our results indicate that the exact identification of the mutation in PHEX may have limited predictive value for the prognosis of patients with HYP. Although we saw a trend toward more severe skeletal phenotype in familial patients with truncating mutations, this must be further tested because our study used a relatively small sample size. Mutation analysis identified 15 novel mutations and confirmed that the mutations are found throughout the gene with no apparent "hot spots," making genetic testing by traditional methods relatively tedious and time consuming. The future availability of microarray mutation analysis should result in more feasible genetic screening. This will be useful clinically for the early identification by mutation analysis of affected children, to allow early treatment intervention. Early identification of affected infants based on serum phosphate determination is not entirely satisfactory. Finally, the inability to detect a genotype-phenotype correlation in this study, albeit with a relatively small sample size, suggests that environmental factors and/or other genes may also affect the severity of the phenotype. The identification, in postpubertal individuals, of a gene dosage effect in the dental phenotype indicates that sex steroids may be involved in the expression of the HYP phenotype.
Acknowledgments
We thank the following people for their assistance and contribution: Jack Chen, biostatistician at Northern Area Health Service, Sydney, for statistical advice, and Anne Louise Richardson for technical assistance. We thank the following people for providing patients for this study: Dr. John Crawford from the Pediatric Endocrine Division at Massachusetts General Hospital; Dr. Patricia Fechner from the Department of Pediatric Endocrinology at Stanford University; Dr. Constantine Stratakis, Chief of the Unit of Genetics and Endocrinology (UGEN), Developmental Endocrinology Branch (DEB), NICHD, NIH; Dr. Michael A. Levine, Director of Pediatric Endocrinology at The Johns Hopkins University School of Medicine; Prof. Sol Posen from Royal North Shore Hospital, Sydney; and Prof. Martin Silink, Dr. Neville Howard, and Dr. Geoff Ambler from the New Children’s Hospital, Sydney.
Footnotes
This work was supported by in part by NIH Grant K11 HD-00961 from the NICHD and by grants from the Mallinckrodt, Inc. Foundation, the Genentech, Inc. Foundation, and the Charles H. Hood Foundation (I.A.H.); the NH & MRC Australia (A.E.N., B.G.R., R.S.M.). This work was supported in part by NIH Grants K24–01288 (T.O.C.) from the NICHD, and MO1-RR06022 (Yale Children’s Clinical Research Center) from the National Center for Research Resources, NIH.
1 The first two authors contributed equally to this work. 
Abbreviations: ADHR, Autosomal dominant hypophosphatemic rickets; ARMS, amplification-refractory mutation system; ECE-1, endothelin-converting enzyme-1; FHR, familial hypophosphatemic rickets; HYP, X-linked hypophosphatemic rickets; NEP, neprilysin; SSCP, single-strand conformation polymorphism.
Received October 13, 2000.
Accepted April 20, 2001.
References
This article has been cited by other articles:
 |
|
 |
|
  J. Kim, K. H. Yang, J. S. Nam, J. R. Choi, J. Song, M. Chang, and K.-A Lee A Novel PHEX Mutation in a Korean Patient with Sporadic Hypophosphatemic Rickets Ann. Clin. Lab. Sci., January 1, 2009; 39(2): 182 - 187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Makras, N. A. T. Hamdy, S. G. Kant, and S. E. Papapoulos Normal Growth and Muscle Dysfunction in X-Linked Hypophosphatemic Rickets Associated with a Novel Mutation in the PHEX Gene J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1386 - 1389. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. A. Brownstein, F. Adler, C. Nelson-Williams, J. Iijima, P. Li, A. Imura, Y.-i. Nabeshima, M. Reyes-Mugica, T. O. Carpenter, and R. P. Lifton A translocation causing increased {alpha}-Klotho level results in hypophosphatemic rickets and hyperparathyroidism PNAS, March 4, 2008; 105(9): 3455 - 3460. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Singh, N Moghal, S H S Pearce, and T Cheetham The investigation of hypocalcaemia and rickets Arch. Dis. Child., May 1, 2003; 88(5): 403 - 407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Jan De Beur and M. A. Levine Molecular Pathogenesis of Hypophosphatemic Rickets J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2467 - 2473. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Liu, R. Guo, Q. Tu, and L. D. Quarles Overexpression of Phex in Osteoblasts Fails to Rescue the Hyp Mouse Phenotype J. Biol. Chem., January 25, 2002; 277(5): 3686 - 3697. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
