This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tajima, T. Articles by Miller, W. L. Search for Related Content PubMed PubMed Citation Articles by Tajima, T. Articles by Miller, W. L.

Heterozygous Mutation in the Cholesterol Side Chain Cleavage Enzyme (P450scc) Gene in a Patient with 46,XY Sex Reversal and Adrenal Insufficiency

Department of Pediatrics (T.T., K.F., J.N.), Hokkaido University School of Medicine N15, 060-8638 Sapporo, Japan; Division of Endocrinology and Metabolism (N.K.), Saitama Children’s Medical Center, Iwatsuki-city, 339-8551 Saitama, Japan; and Department of Pediatrics (W.L.M.), University of California–San Francisco, San Francisco, California 94143-0978

Address all correspondence and requests for reprints to: Kenji Fujieda, M.D., Ph.D., Department of Pediatrics, Asahikawa Medical College, 2-1-1-1, Midorigaoka, Higashi, Asahikawa 078-8510, Japan. E-mail: ken-fuji{at}asahikawa-med.ac.jp

Abstract

Cytochrome P450scc, the mitochondrial cholesterol side chain cleavage enzyme, is the only enzyme that catalyzes the conversion of cholesterol to pregnenolone and, thus, is required for the biosynthesis of all steroid hormones. Congenital lipoid adrenal hyperplasia is a severe disorder of steroidogenesis in which cholesterol accumulates within steroidogenic cells and the synthesis of all adrenal and gonadal steroids is impaired, hormonally suggesting a disorder in P450scc. However, congenital lipoid adrenal hyperplasia is caused by mutations in the steroidogenic acute regulatory protein StAR; it has been thought that P450scc mutations are incompatible with human term gestation, because P450scc is needed for placental biosynthesis of progesterone, which is required to maintain pregnancy. In studying patients with congenital lipoid adrenal hyperplasia, we identified an individual with normal StAR and SF-1 genes and a heterozygous mutation in P450scc. The mutation was found in multiple cell types, but neither parent carried the mutation, suggesting it arose de novo during meiosis, before fertilization. The patient was atypical for congenital lipoid adrenal hyperplasia, having survived for 4 yr without hormonal replacement before experiencing life-threatening adrenal insufficiency. The P450scc mutation, an in-frame insertion of Gly and Asp between Asp271 and Val272, was inserted into a catalytically active fusion protein of the P450scc system (H2N-P450scc-Adrenodoxin Reductase-Adrenodoxin-COOH), completely inactivating enzymatic activity. Cotransfection of wild-type and mutant vectors showed that the mutation did not exert a dominant negative effect. Because P450scc is normally a slow and inefficient enzyme, we propose that P450scc haploinsufficiency results in subnormal responses to ACTH, so that recurrent ACTH stimulation leads to a slow accumulation of adrenal cholesterol, eventually causing cellular damage. Thus, although homozygous absence of P450scc should be incompatible with term gestation, haploinsufficiency of P450scc causes a late-onset form of congenital lipoid adrenal hyperplasia that can be explained by the same two-hit model that has been validated for congenital lipoid adrenal hyperplasia caused by StAR deficiency.

THE MITOCHONDRIAL CHOLESTEROL side chain cleavage enzyme P450scc converts cholesterol to pregnenolone, thus catalyzing the first and rate-limiting step in steroidogenesis (1, 2). Congenital lipoid adrenal hyperplasia (lipoid CAH) is a severe inborn error of steroid hormone synthesis that disrupts the synthesis of all adrenal and gonadal steroids and leads to the accumulation of cholesterol esters (3, 4, 5). Mitochondria isolated from affected tissues fail to convert cholesterol to pregnenolone (6, 7, 8); hence, it was long thought that lipoid CAH was caused by P450scc mutations. However, genetic analysis of P450scc was normal in several patients (9, 10, 11). Mutations causing lipoid CAH were then found in the gene for the steroidogenic acute regulatory (StAR) protein (12, 13, 14, 15). StAR facilitates the transport of cholesterol into mitochondria (12, 13, 14, 15, 16, 17), where the P450scc system resides (2). StAR is expressed in the adrenals and gonads but not in the placenta (18), and placental biosynthesis of progesterone, which requires P450scc, is unaffected in lipoid CAH (19). Placentally produced progesterone is essential for the maintenance of human pregnancy. In some animals, such as rabbits and goats, the maternal corpus luteum secretes progesterone throughout pregnancy, but the human corpus luteum of pregnancy secretes progesterone only during the first trimester, during which there is a luteoplacental shift to the placental production of progesterone (20, 21). Therefore, we have suggested that mutations in P450scc would be incompatible with term gestation (22). However, in studying patients with the clinical findings of CAH (15, 23), we encountered a patient with normal StAR genes and a heterozygous mutation in P450scc. We now present clinical, hormonal, genetic, and functional data showing that heterozygosity for P450scc mutation causes a clinical syndrome resembling delayed-onset lipoid CAH, even though homozygous P450scc deficiency should cause early spontaneous abortion.

Materials and Methods

DNA analysis

The study was approved by the institutional review board, and the parents gave informed consent for DNA analysis. DNA was prepared from blood leukocytes as described (15, 23). The genes for StAR and for steroidogenic factor 1 (SF-1) were amplified by PCR and sequenced using oligonucleotides and conditions previously reported (15, 24). To analyze the P450scc gene from this family, PCR primers were designed for each exon within introns near the intron/exon borders, according to the published human P450scc sequence (25, 26). The sequences of these oligonucleotides are given in Table 1. The PCR conditions consisted of 5 min at 94 C, followed by 30 cycles of 40 sec at 94 C, 40 sec at 57 C, and 60 sec at 72 C. If nonspecific bands were present, the expected PCR product was purified by gel electrophoresis through 2% NuSieve (FMC Bioproducts, Rockland, ME). Direct sequencing of the PCR products was done with an ABI PRISM Dye Terminator Cycle Sequencing Kit and an ABI 373A automated fluorescent sequencer (PE Applied Biosystems, Foster City, CA), as described (15, 23).

The six-base insertion in the P450scc sequence was inserted by oligonucleotide-mediated site-direct mutagenesis into the P450scc segment of a vector termed F2, which encodes a fusion of the cholesterol side-chain cleavage enzyme and its electron-donating cofactors: H2N-P450scc-adrenodoxin reductase-adrenodoxin-COOH (27). The sequences of the oligonucleotides used for site-directed mutagenesis are given in Table 1. Primer 1 was the sense strand, and primer 2 was the antisense strand containing the six inserted nucleotides (underlined). The accuracy of the construct was confirmed by sequencing. Nonsteroidogenic COS-1 cells were transfected with 1 µg of either the wild-type or mutant F2 plasmid, using 10 µl lipofectramine, as described (12). The soluble hydroxysterol, 20-hydroxycholesterol, which is converted to pregnenolone by P450scc but bypasses the action of StAR (12), was added as substrate at a concentration of 12.5 µM, which is well above the 2.8 µM Km (Michaelis constant) of the F2 fusion protein (27). Culture media were harvested 48 h after transfection and assayed for pregnenolone by high performance liquid chromatography, as described (15, 23).

Case Report and Results

The proband, the first child of her parents, had a birth weight of 3160 g and a length of 51 cm following an uneventful pregnancy and birth. Inguinal hernias were diagnosed at 2 yr of age, and inguinal masses were resected at another clinic, but the details of that surgery are unknown. When first seen in our clinic at age 4 yr, she was lethargic and had hyperpigmentation. Her weight was 17.4 kg, and her height was 109.4 cm. She had clitoromegaly, no labial fusion, and separate vaginal and urethral openings. Gonads were not palpable. Her serum Na was 142 mEq/liter, and serum K was 4.2 mEq/liter (both normal). However, ACTH was extremely elevated (>880 pmol/liter; normal range, 2.33–6.04), cortisol was 59.4 nmol/liter (normal range, 110–496.6), PRA was 11.73 µg/liter·h (normal range, 0.87–2.76), and plasma aldosterone was 88.7 nmol/liter (normal range, 15.8–49.7) (Table 2). ACTH administration did not increase serum cortisol (30.4–34.2 nmol/L), and a salt-restricted diet did not stimulate urinary aldosterone excretion. Administration of GnRH increased LH from 6.7 mIU/ml to 75.3 mIU/ml and increased FSH from 23.3 mIU/ml to 75.2 mIU/ml. Human CG stimulation did not increase serum testosterone levels (1.03 to 0.85 nmol/liter). Antibodies to P450scc, P450c21, and P450c17 (Cosmic, Tokyo, Japan) were not detected in her serum, ruling out the common form of autoimmune Addison’s disease (28, 29). Her karyotype was 46,XY. Computed tomographic and ultrasonographic examinations revealed no hypertrophy of the adrenal glands, and no uterus. Vaginography demonstrated a blind vaginal pouch. She was treated with hydrocortisone and 9-fluorocortisone; she became more active, and her pigmentation disappeared.

StAR missense mutations that retain partial activity and cause a later onset of the clinical symptoms of lipoid CAH have been described (13, 14, 15); hence, we first sequenced this patient’s StAR gene, but this was homozygously normal. Recently, Achermann et al. (24) described a patient with physical and hormonal findings similar to lipoid CAH in whom a heterozygous mutation was found in the gene for SF-1, a transcription factor required for adrenal and gonadal expression of all steroidogenic enzymes. However, the SF-1 heterozygote had normal müllarian structures, whereas our patient lacked müllarian structures, and the SF-1 gene was homozygously normal in our patient. We then sequenced the exons of her gene for P450scc and identified heterozygosity for a six-base insertion in exon 4 (Fig. 1A). This mutation (TGGGACGTGATTTGGGACGGGGACGTGATT), which may have occurred by slipped strand mispairing (30), inserts codons for Gly and Asp between Asp 271 (GAC) and Val 272 (GTG) without altering the P450scc reading frame (Fig. 1B) (25, 26). Analysis of the patient’s genomic DNA from hair follicles and urinary sediment confirmed that this mutation was heterozygous and was inconsistent with mosaicism. Leukocyte genomic DNA from her mother and father did not contain this mutation, suggesting that the patient’s mutations occurred de novo (Fig. 1C). Direct sequencing of all other exons, splice sites, and 620 bases of 5' flanking DNA did not reveal any other mutations.

View larger version (45K): [in this window] [in a new window]   Figure 1. Mutation of P450scc gene. A-1, Chromatograms of DNA sequences in the proband demonstrating the heterozygous six-base insertion (italic bases) in exon 4. Note the double peaks after the mutation site (denoted by an arrow). Underlines indicate that this mutation is presumably caused by slipped strand mispairing. A-2, Direct sequence of wild type. B, Schematic representation of the mutation sites and part of the amino acid sequence of P450scc. The 6-bp insertion adds two amino acids (Gly and Asp) in frame between Asp271 and Val272. Amino acids numbers follow previous reports (26 27 ). C, Family tree. The half-solid circle in the proband designates a heterozygous mutation of P450scc.

Activity of the P450scc mutant

To determine whether this in-frame insertion altered P450scc enzymatic activity, we created the Gly-Asp insertion mutant by site-directed mutagenesis. To catalyze conversion of cholesterol to pregnenolone, P450scc must receive electrons from NADPH through the intermediacy of a flavoprotein, termed "adrenodoxin reductase," and an iron-sulfur protein, termed "adrenodoxin" (for review see Ref. 2). Because the level of P450scc activity in transfected cells is crucially dependent on the molar ratio of adrenodoxin to P450scc (27, 33), we sought to eliminate this variable by using a vector (termed F2) that expresses the P450scc system as a single, catalytically active fusion protein; H2N-P450scc-adrenodoxin reductase-adrenodoxin-COOH (27). Similarly, P450scc activity as measured by production of pregnenolone normally depends on the StAR protein to deliver the cholesterol substrate into the mitochondria (17). However, we circumvented the action of StAR by providing the cells with 20-hydroxycholesterol, which readily diffuses into mitochondria without StAR’s action (12, 34). The wild-type, but not the mutant, efficiently converted 20-hydroxycholesterol to pregnenolone (Table 3). Because the mutation was found in a heterozygous state, we tested the possibility that it might act as a dominant negative mutant; however, cotransfecting COS-1 cells with both the wild-type and mutant vectors had no significant affect on the wild-type’s enzymatic activity (Table 3).

The differential diagnosis of male pseudohermaphroditism (46 XY sex reversal) includes: 1) errors in testosterone biosynthesis and action (e.g. defects in testosterone biosynthetic enzymes, 5-reductase deficiency, androgen receptor defects); 2) dysgenetic male pseudohermaphroditism (e.g. XY gonadal dysgenesis, XO/XY mosaicism, mutations in SOX9, WT1, SF-1 or other factors involved in testicular development); 3) testicular unresponsiveness to LH/hCG; and iv) defects in the synthesis or action of müllarian-inhibiting substance (35). Our patient’s hyperresponsiveness of LH and FSH to GnRH stimulation and the unmeasurable testosterone response to hCG would normaly implicate an error in testosterone biosynthesis, but because the testes were probably removed at age 2, these are the expected responses. The minimal cortisol concentrations in the face of grossly elevated ACTH concentrations indicate an error in an enzyme or factor affecting both adrenal and gonadal steroidogenesis. Dysgenetic male pseudohermaphroditism cannot be excluded totally because the testes were not available for inspection. However, the karyotype was 46, XY, an SF-1 mutation was inconsistent with the absence of a uterus and was ruled out by sequencing, and defects in WT1 and SOX9, as well as unresponsiveness to LH/hCG and disorders of müllarian-inhibiting substance synthesis and action, would all be inconsistent with adrenal insufficiency. Similarly, mutations in DAX-1 would cause adrenal insufficiency but not cause male pseudohermaphroditism (36). Thus, it is clear that our patient had a combined error in adrenal and gonadal steroidogenesis.

Among the errors in the combined testosterone and cortisol biosynthesis, one might consider defects in 3ßHSD, P450c17, and classical lipoid CAH due to StAR mutations. All described defects in 3ßHSD are in the 3ßHSD II gene and can be either salt-wasting or nonsalt-wasting (37). However, such patients tend to have normal or elevated plasma concentrations of 17-hydroxyprogesterone due to peripheral conversion of 17-hydroxypregnenolone to 17-hydroxyprogesterone by extraglandular 3ßHSDI (37, 38), and 17-hydroxyprogesterone was unmeasurable in our patient. A severe defect in P450c17 would cause cortisol and testosterone deficiency with male pseudohermaphroditism, but would also result in elevated concentrations of DOC and corticosterone (39), which were not seen in our patient. StAR mutations causing lipoid CAH are usually, but not always associated with massively enlarged adrenals (40) but our patient’s StAR gene sequence was normal. Thus, it appeared that our patient had a wholly novel defect in steroidogenesis.

This patient had clinical features similar to patients with lipoid CAH (8, 14, 15, 23) but also differed from the usual phenotype of lipoid CAH in two respects. First, the age of onset of clinical symptoms was at age 4 yr, whereas most patients with lipoid CAH have symptoms of adrenal insufficiency within the first month of life (14, 15). A compound heterozygous patient carrying the StAR mutations A218V and L275P, each of which retains 20–24% of StAR activity, survived 4 months without hormonal replacement (14), and another compound heterozygous patient carrying M225T, which retains 43% of activity, and the wholly inactive Q258x mutation survived 10 months without therapy (15). Thus, our patient clearly had a slower, more insidious onset of adrenal insufficiency. Second, our patient did not have enlarged adrenals detected by computed tomography or ultrasonography. Massive adrenal enlargement is a classical feature of lipoid CAH described in virtually all of these patients (3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15), however, a lack of radiologically demonstrable adrenal hyperplasia has been described in one patient with lipoid CAH caused by StAR mutations (40). Thus, adrenal hyperplasia remains a useful diagnostic feature of classic lipoid CAH.

The heterozygous mutation in our patient’s P450scc gene was found in her peripheral leukocytes and in cells from her urinary sediment and hair follicles, but was not found in leukocyte DNA from either parents. Thus, our patient exhibited a spontaneous mutation that was found in all three tissues examined, as well as in her adrenals and testes. This indicates that the mutation occurred very early, quite possibly during meiosis of a gamate before fertilization, rather than being a somatic cell mutation causing a patchy distribution of abnormal cells as seen in the McCune-Albight syndrome. The sequence of our patient’s mutation, which suggests slipped strand mispairing, also strongly favors a mutation occurring during meiosis rather than a somatic cell mutation occurring during mitosis. The severe phenotype associated with heterozygosity for a P450scc mutation indicates that it is unlikely that persons carrying such mutations could reproduce and thus transmit the mutation. Thus, any individual with lipoid CAH phenotype carrying a P450scc mutation is likely to carry a de novo mutation.

Heterozygotes for other forms of CAH are clinically normal and have minimal, if any hormonal manifestations; hence, we did not anticipate that heterozygotes for P450scc mutations would have an obvious phenotype. By contrast, our patient was severely ill in a heterozygous state, indicating a dominant disease. Many autosomal dominant diseases result from a "dominant negative" mechanism, in which a small number of defective protein monomers disrupt a larger functional complex. However, expression of the P450scc mutant in the same cells transfected with the wild-type P450scc construct did not impair the activity of the wild type. Thus, we sought another explanation for the dominant nature of the mutation in the gene for this enzyme.

The reason why our patient developed incomplete virilization and mild adrenal insufficienty despite retaining 50% of normal enzymatic activity can probably be explained by the same "two-hit" mechanism that accounts for the pathophysiology of lipoid CAH (14) and has been confirmed by studies of human ovarian physiology (23) and by examination of StAR-knockout mice (41, 42). P450scc is the rate-limiting enzyme in steroidogenesis. This is a very slow enzyme, turning over only 1 mole of cholesterol per mole of P450scc per second (43); thus, haploinsufficiency of P450scc may prevent the elaboration of an appropriate steroidogenic response. The insufficient steroidogenesis will lead to increased tropic stimulation of the adrenals by ACTH and of the gonads by gonadotropins, stimulating the uptake of low-density lipoproteins and cholesterol; this cholesterol accumulates, eventually causing cell death (14). The principal difference with lipoid CAH is that haploinsufficiency of P450scc permits more steroidogenesis than the low levels of StAR-independent steroidogenesis seen in StAR deficiency, so the progression from the mutation-induced impairment in steroidogenesis (the first hit) to the loss of steroidogenesis from cell death (the second hit) is slower. Consistent with this view, rabbits with homozygous deletion of P450scc gene have a phenotype that very closely resembles lipoid CAH although, unlike our patient, the heterozygotes are healthy and can reproduce (44), but, unlike a hypothetical human homozygous deletion for P450scc, these rabbits are born normally because the maternal corpus luteum rather than the placenta synthesizes progesterone (19, 20, 21). Thus, while our patient shows that haploinsufficiency of P450scc causes late-onset lipoid CAH, it remains true that complete P450scc deficiency should cause spontaneous abortion at the time of the luteo-placental shift (21).

Lipoid CAH has been studied in at least 57 patients (40), and only one of the initially described patients lacked a StAR mutation (14). However, haploinsufficiency of SF-1 with normal StAR has been reported in one patient with a clinical syndrome resembling lipoid CAH (24), and we now show that haploinsufficiency of P450scc can also produce this phenotype. Thus, lipoid CAH is the common phenotypic manifestation of several genetic disorders in the early steps in steroidogenesis.

Footnotes

This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Science, Education, and Culture of Japan and by NIH Grants DK37922 and HD34449 (to W.L.M.).

T.T., K.F., and N.K. contributed equally to this work.

Abbreviations: lipoid CAH, Congenital adrenal hyperplasia; StAR, steroidogenic acute regulatory; SF-1, steroidogenic factor 1.

Received January 1, 2001.

Accepted April 20, 2001.

References

1. Stone D, Hechter O 1955 Studies on ACTH action in perfused bovine adrenals: aspects of progesterone as an intermediatry in corticosteroidogenesis. Arch Biochem Biophys 54:121–126[CrossRef]
2. Miller WL 1988 Molecular biology of steroid hormone synthesis. Endocr Rev 9:295–318[Abstract/Free Full Text]
3. Prader A, Siebenmann RE 1957 Nebenniereninsuffizienz bie kongenitaler Lipoidhyperplasie der Nebennieren. Helv Paediatr Acta 12:569–595[Medline]
4. Camacho AM, Kowarski A, Migeon CJ, Brough A 1968 Congenital adrenal hyperplasia due to a deficiency of one of the enzymes involved in the biosynthesis of pregnenolone. J Clin Endocrinol Metab 28:153–161[Abstract/Free Full Text]
5. Miller WL 1997 Congenital lipoid adrenal hyperplasia: the human gene knockout of the steroidogenic acute regulatory protein. J Mol Endocrinol 19:227–240[Free Full Text]
6. Degenhart HJ, Visser KHA, Boon H, O’Doherty NJD 1972 Evidence for deficiency of 20 cholesterol hydroxylase activity in adrenal tissue of a patient with lipoid adrenal hyperplasia. Acta Endocrinol 71:512–518
7. Koizumi S, Kyoya S, Miyawaki T, et al. 1977 Cholesterol side-chain cleavage enzyme activity and cytochrome P450 content in adrenal mitochondria of a patient with congenital lipoid adrenal hyperplasia (Prader disease). Clin Chim Acta 77:301–306[CrossRef][Medline]
8. Hauffa BP, Miller WL, Grumbach MM, Conte FA, Kaplan SL 1985 Congenital adrenal hyperplasia due to deficient cholesterol side-chain cleavage activity (20,22 desmolase) in a patient treated for 18 years. Clin Endocrinol 23:481–493[Medline]
9. Lin D, Gitelman SE, Saenger P, Miller WL 1991 Normal genes for the cholesterol side chain cleavage enzyme, P450scc, in congenital lipoid adrenal hyperplasia. J Clin Invest 88:1955–1962
10. Sakai Y, Yanase T, Okabe Y, et al. 1994 No mutation in cytochrome P450 side chain cleavage in a patient with congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab 79:1198–1201[Abstract]
11. Fukami M, Sato S, Ogata T, Matsuo N 1995 Lack of mutations in P450scc gene (CYP11A) in six Japanese patients with congenital lipoid adrenal hyperplasia. Clin Pediatr Endocrinol 4:39–46
12. Lin D, Sugawara T, Strauss III JF, et al. 1995 Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 267:1828–1831[Abstract/Free Full Text]
13. Tee MK, Lin D, Sugawara T, et al. 1995 TA transversion 11 bp from a splice acceptor site in the gene for steroidogenic acute regulatory protein causes congenital lipoid adrenal hyperplasia. Hum Mol Genet 4:2299–2305[Abstract/Free Full Text]
14. Bose HS, Sugawara T, Strauss III JF, Miller WL 1996 The pathophysiology and genetics of congenital lipoid adrenal hyperplasia. N Engl J Med 335:1870–1878[Abstract/Free Full Text]
15. Nakae J, Tajima T, Sugawara T, et al. 1997 Analysis of the steroidogenic acute regulatory protein (StAR) gene in Japanese patients with congenital lipoid adrenal hyperplasia. Hum Mol Genet 6:571–576[Abstract/Free Full Text]
16. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269:28314–28322[Abstract/Free Full Text]
17. Stocco DM, Clark BJ 1996 Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 17:221–244[Abstract/Free Full Text]
18. Sugawara T, Holt JA, Driscoll D, et al. 1995 Human steroidogenic acute regulatory protein (StAR): functional activity in COS-1 cells, tissue expression, mapping of the structural gene to 8p11.2 and expressed pseudogene to chromosome 13. Proc Acad Sci USA 92:4778–4782[Abstract/Free Full Text]
19. Saenger P, Klonari Z, Black SM, et al. 1995 Prenatal diagnosis of congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab 80:200–205[Abstract]
20. Csapo AI, Pulkkinen MO, Wiest WB 1973 Effects of luteectomy and progesterone replacement therapy in early pregnant patients. Am J Obstet Gynecol 115:759–765[Medline]
21. Csapo AI, Pulkkinen MO 1978 Indispensibility of the human corpus luteum in the maintenance of early pregnancy: luteectomy evidence. Obstet Gynecol Surv 83:69–81
22. Miller WL 1998 Why nobody has P450scc (20,22 desmolase) deficiency (Letter). J Clin Endocrinol Metab 83:1399–1400[Free Full Text]
23. Fujieda K, Tajima T, Nakae J, et al. 1997 Spontaneous puberty in two 46,XX patients with congential lipoid adrenal hyperplasia: ovarian steroidogenesis is spared to some extent despite inactivating mutations in the steroidogenic acute regulatory protein (StAR) gene. J Clin Invest 99:1265–1271[Medline]
24. Achermann JC, Ito M, Ito M, Hindmarsh PC, Jameson JL 1999 A mutation in the gene encoding steroidogenic factor-1 causes XY sex reversal and adrenal failure in humans. Nat Genet 22:125–126[CrossRef][Medline]
25. Chung B, Matteson KJ, Voutilainen R, Mohandas TK, Miller WL 1986 Human cholesterol side-chain cleavage enzyme, P450scc: cDNA cloning, assignment of the gene to chromosome 15, and expression in the placenta. Proc Natl Acad Sci USA 83:8962–8966[Abstract/Free Full Text]
26. Morohashi K, Sogawa K, Omura T, Fujii-Kuriyama Y 1987 Gene structure of human cytochrome P450(SCC), cholesterol desmolase. J Biochem 101:879–887[Abstract/Free Full Text]
27. Harikrishna JA, Black SM, Szklarz GD, Miller WL 1993 Construction and function of fusion enzymes of the human cytochrome P450scc system. DNA Cell Biol 12:371–379[Medline]
28. Winqvist O, Karlsson FA, Kampe O 1992 21-hydroxylase, a major autoantigen in idiopathic Addison’s disease. Lancet 339:1559–1562[CrossRef][Medline]
29. Chen S, Sawicka J, Betterle C, et al. 1996 Autoantibodies to steroidogenic enzymes in autoimmune polyglandular syndrome, Addison’s disease, and premature ovarian failure. J Clin Endocrinol Metab 81:1871–1876[Abstract]
30. Levinson G, Gutman GA 1987 Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol Biol Evol 4:203–221[Abstract]
31. Fu GK, Portale AA, Miller WL 1997 Complete structure of the human gene for the vitamin D 1-hydroxylase, P450c1. DNA Cell Biol 16:1449–1507[Medline]
32. Wang JT, Lin CJ, Burridge SM, et al. 1998 Genetics of vitamin D 1-hydroxylase deficiency in 17 families. Am J Hum Genet 63:1694–1702[CrossRef][Medline]
33. Zuber MX, Mason JI, Simpson ER, Waterman MR 1988 Simultaneous transfection of COS-1 cells with mitochondrial and microsomal steroid hydroxylases: incorporation of a steroidogenic pathway into non-steroidogenic cells. Proc Natl Acad Sci USA 85:699–703[Abstract/Free Full Text]
34. Toaff ME, Schleyer H, Strauss III JF 1982 Metabolism of 25-hydroxycholesterol by rat luteal mitochondria and dispersed cells. Endocrinology 111:1785–1790[Abstract/Free Full Text]
35. Grumbach MM, Conte FA 1998 Disorders of sex differentiation. In: Wilson JD, Foster DW, Kronenberg HM, Larsen PR, eds. Williams’ textbook of endocrinology, ed 9. Philadelphia: WB Saunders; 1303–1425
36. Zanaria E, Muscatelli F, Bardoni B, et al. 1994 A novel and unusual member of the nuclear hormone receptor superfamily is responsible for X-linked adrenal hypoplasia congenita. Nature 372:635–641[CrossRef][Medline]
37. Moisan AM, Ricketts ML, Tardy V, et al. 1999 New insights into the molecular basis of 3ß-hydroxysteroid dehydrogenase deficiency: identification of eight mutations in the HSD3ßII gene in eleven patients from seven new families and comparison of the functional properties of twenty-five mutant enzymes. J Clin Endocrinol Metab 84:4410–4425[Abstract/Free Full Text]
38. Cara JF, Moshaug T, Bongiovanni AM, Marx BS 1985 Elevated 17- hydroxyprogeterone and testosterone in a newborn with 3ß-hydroxysteroid dehydrogenase deficiency. N Engl J Med 313:618–621[Medline]
39. Yanase T, Simpson ER, Waterman MR 1991 17-hydroxylase/17,20lyase deficiency: from clinical investigation to molecular definition. Endocr Rev 12: 91–108.
40. Bose HS, Sato S, Aisenberg J, Shalev SA, Matsuo N, Miller WL 2000 Mutations in the steroidogenic acute regulatory protein (StAR) in six patients with congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab 85: 3636–3639
41. Caron K, Soo SC, Westel W, Stocco DM, Clark BJ, Parker KR 1997 Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc Natl Acad Sci USA 94:11540–11545[Abstract/Free Full Text]
42. Hasegawa T, Zhao L, Caron KM, et al. 2000 Developmental roles of the steroidogenc acute regulatory protein (StAR) as revealed by StAR knockout mice. Mol Endocrinol 14:1462–1471[Abstract/Free Full Text]
43. Morisaki M, Duque C, Ikekawa N, Shikita M 1980 Substrate specificity of adrenocortical cytochrome P450scc. Effect of structural modification of cholesterol side-chain on pregnenolone production. J Steroid Biochem 13:545–550[CrossRef][Medline]
44. Pang S, Yang X, Wang M, et al. 1992 Inherited congenital adrenal hyperplasia in the rabbit: absent cholesterol side-chain cleavage cytochrome P450 gene expression. Endocrinology 131:181–186[Abstract/Free Full Text]

This article has been cited by other articles:

				P. Rubtsov, M. Karmanov, P. Sverdlova, P. Spirin, and A. Tiulpakov A Novel Homozygous Mutation in CYP11A1 Gene Is Associated with Late-Onset Adrenal Insufficiency and Hypospadias in a 46,XY Patient J. Clin. Endocrinol. Metab., March 1, 2009; 94(3): 936 - 939. [Abstract] [Full Text] [PDF]

				M.-C. Shih, N.-C. Hsu, C.-C. Huang, T.-S. Wu, P.-Y. Lai, and B.-c. Chung Mutation of Mouse Cyp11a1 Promoter Caused Tissue-Specific Reduction of Gene Expression and Blunted Stress Response without Affecting Reproduction Mol. Endocrinol., April 1, 2008; 22(4): 915 - 923. [Abstract] [Full Text] [PDF]

				C. J. Kim, L. Lin, N. Huang, C. A. Quigley, T. W. AvRuskin, J. C. Achermann, and W. L. Miller Severe Combined Adrenal and Gonadal Deficiency Caused by Novel Mutations in the Cholesterol Side Chain Cleavage Enzyme, P450scc J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 696 - 702. [Abstract] [Full Text] [PDF]

				B. Y. Baker, L. Lin, C. J. Kim, J. Raza, C. P. Smith, W. L. Miller, and J. C. Achermann Nonclassic Congenital Lipoid Adrenal Hyperplasia: A New Disorder of the Steroidogenic Acute Regulatory Protein with Very Late Presentation and Normal Male Genitalia J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 4781 - 4785. [Abstract] [Full Text] [PDF]

				E. Ikonen Mechanisms for cellular cholesterol transport: defects and human disease. Physiol Rev, October 1, 2006; 86(4): 1237 - 1261. [Abstract] [Full Text] [PDF]

				H. al Kandari, N. Katsumata, S. Alexander, and M. A. Rasoul Homozygous Mutation of P450 Side-Chain Cleavage Enzyme Gene (CYP11A1) in 46, XY Patient with Adrenal Insufficiency, Complete Sex Reversal, and Agenesis of Corpus Callosum J. Clin. Endocrinol. Metab., August 1, 2006; 91(8): 2821 - 2826. [Abstract] [Full Text] [PDF]

				I. A. Pikuleva CHOLESTEROL-METABOLIZING CYTOCHROMES P450 Drug Metab. Dispos., April 1, 2006; 34(4): 513 - 520. [Abstract] [Full Text] [PDF]

				A. Bhangoo, W.-X. Gu, S. Pavlakis, H. Anhalt, L. Heier, S. Ten, and J. L. Jameson Phenotypic Features Associated with Mutations in Steroidogenic Acute Regulatory Protein J. Clin. Endocrinol. Metab., November 1, 2005; 90(11): 6303 - 6309. [Abstract] [Full Text] [PDF]

				W. L. Miller Minireview: Regulation of Steroidogenesis by Electron Transfer Endocrinology, June 1, 2005; 146(6): 2544 - 2550. [Abstract] [Full Text] [PDF]

				O. Hiort, P.-M. Holterhus, R. Werner, C. Marschke, U. Hoppe, C.-J. Partsch, F. G. Riepe, J. C. Achermann, and D. Struve Homozygous Disruption of P450 Side-Chain Cleavage (CYP11A1) Is Associated with Prematurity, Complete 46,XY Sex Reversal, and Severe Adrenal Failure J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 538 - 541. [Abstract] [Full Text] [PDF]

				I. Marshall, F. Ugrasbul, F. Manginello, M. P. Wajnrajch, C. H. L. Shackleton, M. I. New, and M. V. Vogiatzi Congenital Hypopituitarism as a Cause of Undetectable Estriol Levels in the Maternal Triple-Marker Screen J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4144 - 4148. [Abstract] [Full Text] [PDF]

				T. Ishii, T. Hasegawa, C.-I Pai, N. Yvgi-Ohana, R. Timberg, L. Zhao, G. Majdic, B.-c. Chung, J. Orly, and K. L. Parker The Roles of Circulating High-Density Lipoproteins and Trophic Hormones in the Phenotype of Knockout Mice Lacking the Steroidogenic Acute Regulatory Protein Mol. Endocrinol., October 1, 2002; 16(10): 2297 - 2309. [Abstract] [Full Text] [PDF]

				N. Katsumata, M. Ohtake, T. Hojo, E. Ogawa, T. Hara, N. Sato, and T. Tanaka Compound Heterozygous Mutations in the Cholesterol Side-Chain Cleavage Enzyme Gene (CYP11A) Cause Congenital Adrenal Insufficiency in Humans J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3808 - 3813. [Abstract] [Full Text] [PDF]

				M.-C. Hu, N.-C. Hsu, N. B. El Hadj, C.-I Pai, H.-P. Chu, C.-K. L. Wang, and B.-c. Chung Steroid Deficiency Syndromes in Mice with Targeted Disruption of Cyp11a1 Mol. Endocrinol., August 1, 2002; 16(8): 1943 - 1950. [Abstract] [Full Text] [PDF]

				S. N. Kalantaridou and G. P. Chrousos Monogenic Disorders of Puberty J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2481 - 2494. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a related Letter to the Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Tajima, T. Articles by Miller, W. L. Search for Related Content PubMed PubMed Citation Articles by Tajima, T. Articles by Miller, W. L.