help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kitazono, M.
Right arrow Articles by Fojo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kitazono, M.
Right arrow Articles by Fojo, T.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 7 3430-3435
Copyright © 2001 by The Endocrine Society


Original Articles

Low Concentrations of the Histone Deacetylase Inhibitor, Depsipeptide (FR901228), Increase Expression of the Na+/I- Symporter and Iodine Accumulation in Poorly Differentiated Thyroid Carcinoma Cells

Masaki Kitazono, Rob Robey, Zhirong Zhan, Nicholas J. Sarlis, Monica C. Skarulis, Takashi Aikou, Susan Bates and Tito Fojo

Medicine Branch (M.K., R.R., Z.Z., S.B., T.F.), DCS, National Cancer Institute, Bethesda, Maryland 20892; Clinical Endocrinology Branch (N.S., M.C.S.), National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892; and First Department of Surgery (T.A.), Faculty of Medicine, Kagoshima University, Sakuragaoka, Kagoshima 890-8520, Japan

Address all correspondence and requests for reprints to: Tito Fojo, M.D., Building 10, NCI, NIH, Room 12N226, 9000 Rockville Pike, Bethesda, Maryland 20892. E-mail: tfojo{at}helix.nih.gov

Abstract

Thyroid carcinoma accounts for the majority of deaths from endocrine cancers. A major cause of treatment failure is the inability to trap iodine. Chemotherapeutic agents with differentiating properties have been tried in an attempt to increase iodine uptake. We examined the ability of the novel histone deacetylase (HDAC) inhibitor, depsipeptide (FR901228), to modulate the expression of thyroid-specific genes. Four cell lines, two derived from follicular thyroid carcinomas (FTC 133 and FTC 236) and two derived from anaplastic thyroid carcinomas (SW-1736 and KAT-4) were used. In these four cell lines, a very low concentration of depsipeptide (1 ng/mL) increased histone acetylation and expression of both thyroglobulin and the Na+/I- symporter messenger RNAs. After 3 days, messenger RNA levels approached those of a normal thyroid control. Depsipeptide induced increases in 125I accumulation indicated that a functional Na+/I- symporter protein was induced. Transient transfections indicate that the effects are mediated at least in part by a trans-activating factor. These in vitro results suggest that depsipeptide or other histone deacetylase inhibitors might be used clinically in thyroid carcinomas that are unable to trap iodine as an adjunct to radioiodine therapy.

THYROID CARCINOMA, THE most common endocrine malignancy, accounts for the majority of deaths from endocrine cancers (1). In the United States, there are approximately 14,000 new cases of thyroid carcinoma diagnosed each year, with 1,200 deaths attributed to this disease (2). Approximately 90% of nonmedullary thyroid cancers are classified as well-differentiated thyroid carcinomas (WDTCs) (3). Conventional therapy for these tumors consists of near-total thyroidectomy and radioiodine (131I) (4, 5). However, some WDTCs eventually lose their ability to concentrate iodine over time and follow a clinically aggressive course because they become insensitive to subsequent 131I therapy (1, 6).

Loss of iodine trapping is also observed in anaplastic thyroid carcinoma (ATC), an undifferentiated tumor that accounts for less than 5% of nonmedullary thyroid cancers but results in a disproportionate number of deaths (7, 8). Existence of concurrent WDTC has been demonstrated in 30–65% of patients with ATC, leading to the hypothesis that its histogenic origin may be a long-standing WDTC, that undergoes rapid dedifferentiation (9, 10, 11). In addition, de novo appearance of ATC is thought to occur in a significant percentage of patients (7).

With both WDTCs that have lost the ability to trap iodine and ATCs, therapeutic options are limited and largely unsuccessful. Palliative or debulking surgery (metastatectomy), external radiation, and chemotherapy have all been tried, with limited success (12, 13, 14, 15, 16, 17). Among experimental options, restoration of iodine trapping has been pursued without convincing efficacy until now (18, 19, 20, 21, 22). In the present study, we describe the use of very low doses of a histone deacetylase (HDAC) inhibitor to increase the expression of thyroid-specific proteins. In four thyroid carcinoma cell lines, including two derived from anaplastic thyroid carcinomas, treatment with the HDAC inhibitor, depsipeptide (FR901228), led to a marked increase in expression of thyroglobulin and the Na+/I- symporter (NIS), with a resultant increase in 125I accumulation. Transient transfection studies indicate this increase is mediated at least in part by trans-activation of these genes.

Materials and Methods

Cell lines and culture conditions

Follicular thyroid carcinoma (FTC) 133 and FTC 236 were derived from cultures obtained from the primary tumor (FTC 133) and a nodal metastasis (FTC 236) of a follicular thyroid carcinoma. The anaplastic thyroid carcinoma cell lines were derived from primary cultures of human ATC tumors. SW-1736 was developed by Drs. Leibowitz and McCombs, III, at the Scott and White Memorial Hospital (Temple, TX) in 1977, was maintained by Nils-Erik Heldin (Uppsala University, Uppsala, Sweden), and provided by Kenneth Ain (University of Kentucky, Lexington, KY). KAT-4 was developed and maintained in RPMI media containing 10% FBS in the laboratory of K. Ain. FTC 133 and FTC 236 were originally maintained in medium containing TSH, but this was discontinued when a difference in growth rate could not be demonstrated in the presence or absence of TSH.

Fluorescein isothiocyanate staining

Cytospins were made from trypsinized cells, and the slides were fixed in 95% ethanol/5% acetic acid for 1 min at room temperature. After fixation, slides were washed twice with PBS for 15 min, blocked in 8% BSA in PBS for 1 h at room temperature, and washed 15 min in PBS before incubating overnight at 4 C with 5 µg/mL anti-{alpha} acetylated Histone H3 (Upstate Biotechnology, Inc. Lake Placid, NY) in 2% BSA in PBS. Subsequently, cells were washed twice with PBS for 5 min at room temperature and then stained with horse antirabbit fluorescein isothiocyanate conjugated secondary antibody (Vector Laboratories, Inc. Burlingame, CA). After staining with secondary antibody, slides were washed three times with PBS for 15 min and then counterstained with DAPI containing antifade compound (Vector Laboratories, Inc.).

Protein collection and Western blot analysis

Cells were scraped into lysis buffer A containing 10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, and 1.5 mM PMSF and centrifuged at 11,000x g for 10 min at 4 C. Pellets thawed in buffer B containing 50 mM HEPES (pH 7.9), 420 mM KCl, 0.1 mM EDTA (pH 8.0), 5 mM MgCl2, 20% glycerol, 0.5 mM DTT, and 1.5 mM PMSF were rotated for 30 min at 4 C, and centrifuged at 11,000 x g for 15 min at 4 C. The supernatants were collected as nuclear extracts. Ten micrograms of protein were separated on an 11% SDS-PAGE gel, and electroblotting to Immobilon-P transfer membrane (Millipore Corp.) was performed. Nonspecific protein binding was blocked using 5% milk in TNE buffer [2 mM Tris (pH 7.4), 2 mM NaCl, 1 mM EDTA, and 0.15% Tween 20] for 30 min. The membrane was incubated for 30 min with a rabbit polyclonal antibody against acetylated histone H3 (Upstate Biotechnology, Inc.), diluted 1:2000 in 5% milk. After washing, antirabbit Ig horseradish peroxidase-linked secondary antibody (Amersham Pharmacia Biotech, Piscataway, NJ) was added and incubated for 30 min. After washing, the membrane was developed in ECL Western blotting detection reagents (Amersham Pharmacia Biotech).

Quantitative PCR amplification of the thyroglobulin and sodium iodide symporter

Quantitative RT-PCR for thyroglobulin (TG) and NIS was performed as previously described (23, 24). Total RNA was extracted using RNA STAT-60 (Tel-Test, Inc., Friendswood, TX). Single-stranded oligo (dT)-primed complementary DNA (cDNA) was generated using MMLV reverse transcriptase (Life Technologies, Inc., Eggenstein, Germany). Oligonucleotide primers, used for analysis of human TG RNA expression, were: TG 5' (sense), 5354GAAATCGTCGTCTTCTCCAC5374; and TG 3' (antisense), 5565CTGTCAGCACAGTGGCAATA5584.

These primers should generate a product that is 219 bp in length. The amplification reaction was carried out for 35 cycles, and each cycle consisted of 94 C for 1 min, 57 C for 1 min, and 72 C for 2 min, followed by a final 10-min elongation at 72 C.

Oligonucleotide primers for human NIS RNA amplification were: NIS (1) 5' (sense), 956CTGCCCCAGACCAGTACATGCC978; and NIS (1) 3' (antisense), 1237TGACGGTGAAGGAGCCCTGAAG1259.

The expected human NIS product from a cDNA template is 303 bp. The amplification reaction was for 30 cycles, and each cycle consisted of 94 C for 20 sec, 64 C for 30 sec, and 72 C for 60 sec, followed by a final 7-min elongation at 72 C. All quantitations were performed by densitometry. Quantitations were based on measured ß-actin levels. Oligonucleotide primers for human ß-actin RNA amplification were: ß-actin 5' (sense), 207TGGGCATGGGTCAGAAGGAT226; and ß-actin 3' (antisense), 488GAGGCGTACAGGGATAGCAC507.

Northern blot analysis of NIS

RNA was electrophoresed on a 1% agarose gel containing 2 M formaldehyde and was transferred overnight in 20x saline-sodium citrate (SSC) to a nylon membrane (Amersham Pharmacia Biotech). The cDNA probes for Northern blot analysis were generated by PCR using a pair of NIS gene-specific primers: NIS (2) 5' (sense), 1184GCTGGCCCTGCTCATCAA1202; and NIS (2) 3' (antisense), 1648GCAGGCCGGCAGGAACATTC1667.

The NIS gene-specific cDNA fragment was radiolabeled with [{alpha}-32P)deoxycytosine-5'-triphosphate by random priming and was used as a hybridization probe. The blot was prehybridized at 42 C in a hybridization mix containing 50% formamide for 2 h, followed by hybridization at 42 C for 12 h. The blot was then rinsed twice in 2x SSC/0.1% SDS at room temperature for 10 min and twice in 0.1x SSC/0.1% SDS at 50 C for 20 min.

Growth inhibition and cell viability

Cells were plated at a density of 3000 per well in 96-well plates in 180 µL medium in triplicate. Drug sensitivity was measured by exposing the cells to graded concentrations of depsipeptide in a final volume of 200 µL. At 72 h viable cells were estimated in a colorimetric assay that measures the formazan reduction product of MTT (3-[4, 5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide), which is produced by mitochondrial activity of viable cells. The reduction product was dissolved in dimethyl sulfoxide, and absorbance was quantitated using a plate reader spectrophotometer.

125I accumulation

Cells (3 x 104) were seeded into 24-well dishes in 1 mL medium. After a 1-day incubation period at 37 C with 5% CO2, the medium was aspirated and fresh medium was added with or without depsipeptide (final concentration 1 ng/mL). Iodide uptake was initiated by adding 0.5 mL HBSS (Life Technologies, Inc.) containing approximately 2 µCi carrier-free Na 125I (NEN Life Science Products, Boston, MA) and 30 µM NaI. Incubations were performed for 10 min. For perchlorate inhibition studies, NaClO4 was added as a 100x solution in HBSS to a final concentration of 30 and 100 µM, immediately after the addition of radiolabeled iodine. Reactions were rapidly terminated by removing the radioactive HBSS and washing the cells twice with ice-cold HBSS. Cells were then solubilized by incubation for 20 min in 0.4 mL of 1.0% Triton X-100 (Sigma, Allentown, PA) in HBSS, and accumulated iodide was measured in a gamma counter. The number of cells per well was determined by harvesting and counting (at the time of experiment) three additional wells of cells.

Construction of reporter plasmids

The promoter of the TG gene was isolated using the PCR and DNA from FTC 236 cells. Primers used were: 5' (sense), -500GAGCTCTAAGAGGTTGTTAGAG-479; and 3' (antisense), +40TTTCCTGGCCCTTCCTGGGAGGAA+17.

The amplified fragment was subcloned into the pCRII TA vector (Invitrogen, Carlsbad, CA), and its sequence was confirmed. After digestion with KpnI and XhoI, the 540-bp promoter fragment was ligated to the pGL3-B luciferase (Luc) vector (Promega Corp., Madison, WI). This construct was designated TG promoter-Luc.

The enhancer element of the TG gene was amplified using the PCR and the following primers: 5' (sense), CGGGGTACC-2698GTTCTCACGAGCTCAGTGGAG-2677; and 3' (antisense), CGGACTAGT-2172CCCATTGCCCTAAAATGCATGC-2193.

KpnI (sense) and SpeI (antisense) restriction sites flanked the TG enhancer sequence. The amplified fragment was inserted into the TG promoter-Luc plasmid digested with KpnI and SpeI. This construct was designated TG enhancer/promoter-Luc.

In addition, the HSV-thymidine kinase (TK) minimum promoter was obtained by digesting pRL-TK (Promega Corp.) with HindIII and BglII; this was subcloned into pGL3-B luciferase vector, and designated TK-Luc. TK-Luc was used as the positive control.

Transfections and luciferase assays

Transient transfections were performed using a liposome-mediated method. For all cell lines, 3 x 104 cells were plated 24 h before transfection, after which 0.5 µg plasmid DNA and 4.5 µL of TransFast (Promega Corp.) mixed with 200 µL of medium were added to each well. After incubating 1 h in the above mixture, cells were cultured in the presence or absence of depsipeptide (1 ng/mL) for 2 days. After harvesting, total protein concentration was measured using the protein assay (Bio-Rad Laboratories, Inc., Hercules, CA). Firefly luciferase activity was assessed using the luciferase assay system (Promega Corp.) and normalized to protein. All transfections were performed in triplicate. In all experiments, TK-Luc was used as the positive control. The result with the TK-Luc vector was assigned a value of 100%, and all other values were expressed relative to this as relative luciferase units.

Results

The experiments described herein evolved from studies attempting to modulate the expression of constructs driven by the TG promoter. The effects of several differentiating agents on the level of expression of constructs containing the TG promoter and on the endogenous TG gene were studied. Preliminary observations indicated that depsipeptide, a novel HDAC inhibitor currently undergoing phase I trials in humans, could modulate expression of TG. This effect was originally observed at concentrations of depsipeptide that were cytotoxic. However, because unpublished observations indicated that inhibition of HDAC could be observed at lower concentrations, the effect of lower doses of depsipeptide on the expression of TG and NIS was investigated in vitro. Figure 1Go demonstrates cytotoxicity curves with depsipeptide in the four cell lines used in the present study. In these experiments, cells were exposed to depsipeptide for 72 h, after which time MTT assays were performed. As can be seen, in the four cell lines, a depsipeptide concentration of 1 ng/mL for 72 h was not cytotoxic or at most minimally cytotoxic. This concentration was chosen for all subsequent experiments.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 1. Depsipeptide cytotoxicity. A concentration of 1 ng/mL was used in all subsequent experiments.

 
Treatment of cells with HDAC inhibitors results in increased chromatin acetylation, and this can be detected using an antibody against acetylated chromatin (25). To confirm that 1 ng/mL depsipeptide could increase histone acetylation in spite of its low to absent cytotoxicity, control cells and cells treated with depsipeptide were stained with an antibody directed against acetylated histones. As shown by the fluorescein isothiocyanate staining and Western blot analysis in Fig. 2Go, the basal level of acetylated histones is higher in the more differentiated FTC 236 and FTC 133 cells, compared with the anaplastic KAT-4 and SW-1736 cells. More importantly, treatment with 1 ng/mL depsipeptide for 72 h resulted in a marked increase in histone acetylation in all cell lines.



View larger version (57K):
[in this window]
[in a new window]
 
Figure 2. A, Untreated cells and cells treated with 1 ng/mL depsipeptide for 72 h were fixed and stained with an FITC-labeled antibody against acetylated histones. Intense nuclear staining is observed after depsipeptide treatment. Exposure times for all photographs were identical. B, Four thyroid cancer cell lines were treated with 1 ng/mL depsipeptide for 72 h, and the expression of acetylated histone H3 was examined by Western blot analysis.

 
Having demonstrated increased histone acetylation following depsipeptide, we next examined the expression of two thyroid-specific genes, TG and NIS. Figure 3AGo and Table 1Go demonstrate the results of RT-PCR analysis examining the expression of TG and NIS in the four cell lines before treatment with depsipeptide and after 1, 2, and 3 days of 1 ng/mL depsipeptide. RNA from normal thyroid tissue is included for comparison. Serial dilutions in the exponential range were performed to determine the levels in Table 1Go. The results of one dilution are shown in Fig. 3AGo for ease of presentation. As can be seen, neither TG nor NIS expression can be detected, even with RT-PCR, in untreated ATC cells (SW-1736 and KAT-4), while levels detectable only by RT-PCR are found in untreated FTC cells (faint bands seen in original photographs). Following the addition of depsipeptide, increased expression is detected after the first day of treatment in the FTC cells, and in the ATC cells, an increase is apparent after 48 h. In both instances, marked increases in TG and NIS expression are observed after 72 h of depsipeptide. Figure 3BGo is a Northern analysis demonstrating increased expression of the 4-kb NIS transcript in both SW-1736 and FTC 236 cells following depsipeptide treatment.



View larger version (69K):
[in this window]
[in a new window]
 
Figure 3. A, RT-PCR of human thyroglobulin and NIS. Cells were treated with 1 ng/mL depsipeptide for the indicated times before harvesting RNA. In untreated FTC 133 and FTC 236 cells, but not in SW-1736 and KAT-4 cells, a faint product can be detected for both TG and NIS. B, Northern blot analysis of mRNA using a 32P-labeled NIS-specific cDNA probe. NIS mRNA expression was detected as a band of approximately 4 kb.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Inducibility of Tg and NIS mRNA by depsipeptide

 
To determine whether the induced NIS messenger RNA (mRNA) yielded a functional Na+/I- symporter, the cellular iodine accumulation studies shown in Fig. 4Go were performed. However, a dose response examining the expression of NIS was first performed so as to measure 125I uptake under optimal conditions. Figure 4AGo shows expression of NIS mRNA increased with increasing depsipeptide concentrations up to 1 ng/mL depsipeptide, with NIS mRNA expression in ATC cells observed only at depsipeptide concentrations of 0.3 and 1.0 ng/mL. Therefore, using 1.0 ng/mL depsipeptide, the accumulation studies shown in Fig. 4Go, B and C, were performed. The results are expressed as 125I cpm per 105 cells. Although differences among cell lines should be interpreted cautiously, the accumulation in the untreated cell lines derived from FTCs is higher than in the cell lines derived from ATCs (Fig. 4BGo, open bars), consistent with the higher levels of basal NIS expression in the former, as shown by the PCR analysis. More remarkably, however, marked increases in iodine accumulation were observed in all four cell lines following the addition of depsipeptide (Fig. 4BGo, hatched bars). The increase was greater after 3 days of depsipeptide and was largely inhibited by sodium perchlorate, indicating the existence of a functional iodine trapping mechanism (Fig. 4C).



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. A, Quantitative RT-PCR of NIS. RNA was harvested from untreated cells or cells treated with either 0.1, 0.3, or 1.0 ng/mL depsipeptide for 3 days. The level in FTC 236 cells after treatment with 1 ng/mL depsipeptide for 3 days was assigned a value of 100 and other values were determined relative to this. B, C, 125I accumulation. Cells were treated with 1 ng/mL depsipeptide for the indicated times. 125I accumulation was performed for 15 min at room temperature. 125I accumulation per cell was higher for untreated FTC 133 and FTC 236 cells than for untreated SW-1736 and KAT-4 cells. B, 125I accumulation in each individual cell line. C, Effect of NaClO4 on 125I accumulation in cells treated with depsipeptide; the results are expressed relative to the value without NaClO4, which is assigned a value of 100%.

 
Figure 5Go shows the luciferase activity in FTC and ATC cells transiently transfected with a reporter plasmid containing a luciferase gene under the control of a TG promoter/enhancer element. This construct has been shown to be highly specific for cells of thyroid origin (data not shown). The activity of this reporter construct is compared with that of a constitutively active TK-Luc reporter. The latter used as the positive control was assigned a value of 100% in each cell line. As can be seen, the activity of the TG promoter/enhancer element, which ranges from 28.6% to 84.5% that of TK-Luc in the absence of depsipeptide, is increased markedly after the addition of depsipeptide. The increase in luciferase activity after depsipeptide treatment is consistent with trans-activation of the reporter plasmid. This increase is observed in all cell lines.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. Luciferase activity. Transient transfections were performed using control cells or cells treated with 1 ng/mL depsipeptide. Three constructs were used: 1) a luciferase construct with no promoter (PGL-3B), 2) a luciferase construct under the control of a TG enhancer/promoter element, and 3) a luciferase construct under the control of the TK promoter. The latter was used as the positive control. The activity of the TK promoter in all cells was assigned a value of 100%, thus controlling for variabilities in transfection efficiencies. The activity of the luciferase construct under the control of the TG enhancer/promoter element is depicted. The results are expressed as relative luciferase activity (TK-Luc = 100%). TG-Luc activity in control cells was less than or similar to that of TK-Luc. Depsipeptide induced a marked increase in all cell lines.

 
Discussion

This study describes the induction of a functional Na+/I- symporter in poorly differentiated thyroid carcinoma cell lines by the HDAC inhibitor, depsipeptide. The induction was observed in four independent cell lines, including two derived from anaplastic thyroid carcinomas, using very low concentrations of depsipeptide. Cellular iodine accumulation studies demonstrated marked increases in iodine accumulation in all four cell lines. While these in vitro studies must be considered preliminary, they provide the hope that iodine accumulation could potentially be increased in WDTCs that have lost the ability to trap iodine and in anaplastic thyroid carcinomas.

Although the current therapeutic modalities for WDTCs, including surgery and radioiodine therapy, are generally very effective, they fail to be curative in up to 15% of cases. A significant proportion of these therapeutic failures are due to the progressive loss of the ability of WDTCs to trap iodine or the lack of this ability at the time of initial diagnosis, as is the case with poorly differentiated FTCs and ATCs. The loss of iodine accumulation properties may also be accompanied by other features of dedifferentiation, such as loss of responsiveness of TG expression to TSH or, more rarely, complete or partial loss of baseline TG expression (26). A therapeutic approach that could redifferentiate malignant thyrocytes, even partially, could potentially lead to reconstitution of their ability to trap radioiodine, which would then be organified and retained in these cells, thus inducing cytotoxicity. In this regard, several "antitumor" agents with differentiating properties such as retinoic acid have been considered for the treatment of noniodine-avid thyroid carcinomas (18). Increased levels of mRNA for the NIS and 5'-deiodinase have been reported after the addition of retinoic acid to thyroid derived cell lines in vitro, and a study using retinoic acid reported restoration of iodine uptake in a small number of patients with poorly differentiated thyroid cancers (19, 20, 21, 22).

Depsipeptide (FR901229) is a novel histone deacetylase inhibitor currently in phase I trials in the United States. As with other HDAC inhibitors, it is thought to act by promoting histone acetylation and in turn gene expression. Pharmacokinetics in patients receiving depsipeptide indicate that approximately 90% of circulating drug is protein bound. However, levels exceeding 500 ng/mL have been achieved without significant toxicity, indicating that the concentrations used in the present study can be seen easily achieved in patients (unpublished observations).

In summary, we report the induction of a functional NIS in four thyroid carcinoma cell lines including two derived independently from ATCs. This was achieved with very low concentrations of depsipeptide, which should be easily achieved in patients without significant toxicity. Carefully designed clinical trials using depsipeptide or other HDAC inhibitors to modulate iodine trapping in selected patients with thyroid carcinoma refractory to radioiodine therapy are supported by these observations.

Received August 4, 2000.

Revised January 11, 2001.

Accepted March 5, 2001.

References

  1. Robbins J, Merino MJ, Boice Jr JD, et al. 1991 Thyroid cancer: a lethal endocrine neoplasm. Ann Intern Med. 115:133–147.
  2. Fraker DL, Skarulis M, Livolsi V. 2001 Thyroid tumors. In: DeVita Jr VT, Hellman S, Rosenberg SA, eds. Cancer: principles and practice of oncology, ed 6. Lippincott-Raven; 1740–1762.
  3. Schlumberger MJ. 1998 Papillary and follicular thyroid carcinoma. N Engl J Med. 338:297–306.[Free Full Text]
  4. Solomon BL, Wartofsky L, Burman KD. 1996 Current trends in the management of well differentiated papillary thyroid carcinoma. J Clin Endocrinol Metab. 81:333–339.[Abstract]
  5. Singer PA, Cooper DS, Daniels GH, et al. 1996 Treatment guidelines for patients with thyroid nodules and well-differentiated thyroid cancer. American Thyroid Association. Arch Intern Med. 156:2165–2172.[Abstract/Free Full Text]
  6. DeGroot LJ. 1994 Long-term impact of initial and surgical therapy on papillary and follicular thyroid cancer. Am J Med. 97:499–500.[CrossRef][Medline]
  7. Sweeney PJ, Haraf DJ, Recant W, Kaplan EL, Vokes EE. 1996 Anaplastic carcinoma of the thyroid. Ann Oncol. 7:739–744.[Free Full Text]
  8. Venkatesh YS, Ordonez NG, Schultz PN, Hickey RC, Goepfert H, Samaan NA. 1990 Anaplastic carcinoma of the thyroid. A clinicopathologic study of 121 cases. Cancer. 66:321–330.[CrossRef][Medline]
  9. Moore Jr JH, Bacharach B, Choi HY. 1985 Anaplastic transformation of metastatic follicular carcinoma of the thyroid. J Surg Oncol. 29:216–221.[Medline]
  10. Nel CJ, van Heerden JA, Goellner JR, et al. 1985 Anaplastic carcinoma of the thyroid: a clinicopathologic study of 82 cases. Mayo Clin Proc. 60:51–58.[Medline]
  11. Hurliman J, Gardiol D, Scazziga B. 1987 Immunohistology of anaplastic thyroid carcinoma. A study of 43 cases. Histopathology. 11:567–578.[Medline]
  12. Niederle B, Roka R, Schemper M, Fritsch A, Weissel M, Ramach W. 1986 Surgical treatment of distant metastases in differentiated thyroid cancer:indication and results. Surgery. 100:1088–1097.[Medline]
  13. Tubiana M, Haddad E, Schlumberger M, Hill C, Rougier P, Sarrazin D. 1985 External radiotherapy in thyroid cancers. Cancer. 55(Suppl 9):2062–2071.
  14. Shimaoka K, Schoenfeld DA, DeWys WD, Creech RH, DeConti R. 1985 A randomized trial of doxorubicin versus doxorubicin plus cisplatin in patients with advanced thyroid carcinoma. Cancer. 56:2155–2160.[CrossRef][Medline]
  15. Williams SD, Birch R, Einhorn LH. 1986 Phase II evaluation of doxorubicin plus cisplatin in advanced thyroid cancer: a Southeastern Cancer Study Group Trial. Cancer Treat Rep. 70:405–407.[Medline]
  16. Ain KB, Tofiq S, Taylor KD. 1996 Antineoplastic activity of taxol against human anaplastic thyroid carcinoma cell lines in vitro and in vivo. J Clin Endocrinol Metab. 81:3650–3653.[Abstract]
  17. Kim JH, Leeper RD. 1983 Treatment of anaplastic giant and spindle cell carcinoma of the thyroid gland with combination Adriamycin and radiation therapy. A new approach. Cancer. 52:954–957.[CrossRef][Medline]
  18. Schmutzler C, Brtko J, Bienert K, Kohrle J. 1996 Effects of retinoids and role of retinoic acid receptors in human thyroid carcinomas and cell lines derived therefrom. Exp Clin Endocrinol Diabetes. 104(Suppl 4):16–19.
  19. Simon D, Kohrle J, Schmutzler C, Mainz K, Reiners C, Roher HD. 1996 Redifferentiation therapy of differentiated thyroid carcinoma with retinoic acid: basics and first clinical results. Exp Clin Endocrinol Diabetes. 104(Suppl 4):13–15.
  20. Borner AR, Simon D, Muller-Gartner HW. 1997 Isotretinoin in metastatic thyroid cancer. Ann Intern Med. 127:246.[Free Full Text]
  21. Schmutzler C, Winzer R, Meissner-Weigl J, Kohrle J. 1997 Retinoic acid increases sodium/iodide symporter mRNA levels in human thyroid cancer cell lines and suppresses expression of functional symporter in nontransformed FRTL-5 rat thyroid cells. Biochem Biophys Res Commun. 240:832–838.[CrossRef][Medline]
  22. Schreck R, Schnieders F, Schmutzler C, Kohrle J. 1994 Retinoids stimulate type I iodothyronine 5'-deiodinase activity in human follicular thyroid carcinoma cell lines. J Clin Endocrinol Metab. 79:791–798.[Abstract]
  23. Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE. 1990 Use of the polymerase chain reaction in the quantitation of mdr-1 gene expression. Biochemistry. 29:10351–10356.[CrossRef][Medline]
  24. Alvarez M, Paull K, Monks A, et al. 1995 Generation of a drug resistance profile by quantitaition of mdr-1/P-glycoprotein in the cell lines of the National Cancer Institute anticancer drug screen. J Clin Invest. 95:2205–2214.
  25. Lin R, Leone JW, Cook RG, Allis CD. 1989 Antibodies specific to acetylated histones document the existence of deposition- and transcription-related histone acetylation in Tetrahymena. J Cell Biol. 108:1577–1588.[Abstract/Free Full Text]
  26. Sarlis NJ. 2000 Expression patterns of cellular growth-controlling genes in non-medullary thyroid cancer: basic aspects. Rev Endocr Metab Disord. 1:183–186.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Endocr Relat CancerHome page
J. A Woyach and M. H Shah
New therapeutic advances in the management of progressive thyroid cancer
Endocr. Relat. Cancer, September 1, 2009; 16(3): 715 - 731.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R. C Smallridge, L. A Marlow, and J. A Copland
Anaplastic thyroid cancer: molecular pathogenesis and emerging therapies
Endocr. Relat. Cancer, March 1, 2009; 16(1): 17 - 44.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. A. Woyach, R. T. Kloos, M. D. Ringel, D. Arbogast, M. Collamore, J. A. Zwiebel, M. Grever, M. Villalona-Calero, and M. H. Shah
Lack of Therapeutic Effect of the Histone Deacetylase Inhibitor Vorinostat in Patients with Metastatic Radioiodine-Refractory Thyroid Carcinoma
J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 164 - 170.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. K.W. To, O. Polgar, L. M. Huff, K. Morisaki, and S. E. Bates
Histone Modifications at the ABCG2 Promoter following Treatment with Histone Deacetylase Inhibitor Mirror Those in Multidrug-Resistant Cells
Mol. Cancer Res., January 1, 2008; 6(1): 151 - 164.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Xing
Gene Methylation in Thyroid Tumorigenesis
Endocrinology, March 1, 2007; 148(3): 948 - 953.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
W. Li, G. M. Venkataraman, and K. B. Ain
Protein Synthesis Inhibitors, in Synergy with 5-Azacytidine, Restore Sodium/Iodide Symporter Gene Expression in Human Thyroid Adenoma Cell Line, KAK-1, Suggesting Trans-Active Transcriptional Repressor
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1080 - 1087.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
G. Riesco-Eizaguirre and P. Santisteban
A perspective view of sodium iodide symporter research and its clinical implications.
Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
T Kogai, K Taki, and G A Brent
Enhancement of sodium/iodide symporter expression in thyroid and breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. W. Robey, Z. Zhan, R. L. Piekarz, G. L. Kayastha, T. Fojo, and S. E. Bates
Increased MDR1 Expression in Normal and Malignant Peripheral Blood Mononuclear Cells Obtained from Patients Receiving Depsipeptide (FR901228, FK228, NSC630176)
Clin. Cancer Res., March 1, 2006; 12(5): 1547 - 1555.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Y. M. Au, C. McBride, K. G. Wilhelm Jr., R. J. Koenig, B. Speller, L. Cheung, M. Messina, J. Wentworth, V. Tasevski, D. Learoyd, et al.
PAX8-Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Disrupts Normal PAX8 or PPAR{gamma} Transcriptional Function and Stimulates Follicular Thyroid Cell Growth
Endocrinology, January 1, 2006; 147(1): 367 - 376.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. B. Bravo, M. E.R. Garcia-Rendueles, R. Seoane, V. Dosil, J. Cameselle-Teijeiro, L. Lopez-Lazaro, J. Zalvide, F. Barreiro, C. M. Pombo, and C. V. Alvarez
Plitidepsin Has a Cytostatic Effect in Human Undifferentiated (Anaplastic) Thyroid Carcinoma
Clin. Cancer Res., November 1, 2005; 11(21): 7664 - 7673.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. S. Rao, P. E. Goretzki, J. Kohrle, and G. Brabant
Letter re: Id1 Gene Expression in Hyperplastic and Neoplastic Thyroid Tissues
J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5906 - 5906.
[Full Text] [PDF]


Home page
EndocrinologyHome page
C. Puppin, F. D'Aurizio, A. V. D'Elia, L. Cesaratto, G. Tell, D. Russo, S. Filetti, E. Ferretti, E. Tosi, T. Mattei, et al.
Effects of Histone Acetylation on Sodium Iodide Symporter Promoter and Expression of Thyroid-Specific Transcription Factors
Endocrinology, September 1, 2005; 146(9): 3967 - 3974.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
W. K. Kelly, O. A. O'Connor, L. M. Krug, J. H. Chiao, M. Heaney, T. Curley, B. MacGregore-Cortelli, W. Tong, J. P. Secrist, L. Schwartz, et al.
Phase I Study of an Oral Histone Deacetylase Inhibitor, Suberoylanilide Hydroxamic Acid, in Patients With Advanced Cancer
J. Clin. Oncol., June 10, 2005; 23(17): 3923 - 3931.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
E. Frohlich, F. Machicao, and R. Wahl
Action of thiazolidinediones on differentiation, proliferation and apoptosis of normal and transformed thyrocytes in culture
Endocr. Relat. Cancer, June 1, 2005; 12(2): 291 - 303.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. S. Mitsiades, V. Poulaki, C. McMullan, J. Negri, G. Fanourakis, A. Goudopoulou, V. M. Richon, P. A. Marks, and N. Mitsiades
Novel Histone Deacetylase Inhibitors in the Treatment of Thyroid Cancer
Clin. Cancer Res., May 15, 2005; 11(10): 3958 - 3965.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Furuya, H. Shimura, H. Suzuki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi
Histone Deacetylase Inhibitors Restore Radioiodide Uptake and Retention in Poorly Differentiated and Anaplastic Thyroid Cancer Cells by Expression of the Sodium/Iodide Symporter Thyroperoxidase and Thyroglobulin
Endocrinology, June 1, 2004; 145(6): 2865 - 2875.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Braga-Basaria and M. D. Ringel
Beyond Radioiodine: A Review of Potential New Therapeutic Approaches for Thyroid Cancer
J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 1947 - 1960.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. Als, P. Gedeon, H. Rosler, C. Minder, P. Netzer, and J. A. Laissue
Survival Analysis of 19 Patients with Toxic Thyroid Carcinoma
J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4122 - 4127.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Furumai, A. Matsuyama, N. Kobashi, K.-H. Lee, M. Nishiyama, H. Nakajima, A. Tanaka, Y. Komatsu, N. Nishino, M. Yoshida, et al.
FK228 (Depsipeptide) as a Natural Prodrug That Inhibits Class I Histone Deacetylases
Cancer Res., September 1, 2002; 62(17): 4916 - 4921.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. M. Richon and J. P. O'Brien
Histone Deacetylase Inhibitors: A New Class of Potential Therapeutic Agents for Cancer Treatment : Commentary re: V. Sandor et al., Phase I Trial of the Histone Deacetylase Inhibitor, Depsipeptide (FR901228, NSC 630176), in Patients with Refractory Neoplasms. Clin. Cancer Res., 8: 718-728, 2002.
Clin. Cancer Res., March 1, 2002; 8(3): 662 - 664.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
V. Sandor, S. Bakke, R. W. Robey, M. H. Kang, M. V. Blagosklonny, J. Bender, R. Brooks, R. L. Piekarz, E. Tucker, W. D. Figg, et al.
Phase I Trial of the Histone Deacetylase Inhibitor, Depsipeptide (FR901228, NSC 630176), in Patients with Refractory Neoplasms
Clin. Cancer Res., March 1, 2002; 8(3): 718 - 728.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Kitazono, M. E. Goldsmith, T. Aikou, S. Bates, and T. Fojo
Enhanced Adenovirus Transgene Expression in Malignant Cells Treated with the Histone Deacetylase Inhibitor FR901228
Cancer Res., September 1, 2001; 61(17): 6328 - 6330.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kitazono, M.
Right arrow Articles by Fojo, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kitazono, M.
Right arrow Articles by Fojo, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals