| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Articles |
Medicine Branch (M.K., R.R., Z.Z., S.B., T.F.), DCS, National Cancer Institute, Bethesda, Maryland 20892; Clinical Endocrinology Branch (N.S., M.C.S.), National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892; and First Department of Surgery (T.A.), Faculty of Medicine, Kagoshima University, Sakuragaoka, Kagoshima 890-8520, Japan
Address all correspondence and requests for reprints to: Tito Fojo, M.D., Building 10, NCI, NIH, Room 12N226, 9000 Rockville Pike, Bethesda, Maryland 20892. E-mail: tfojo{at}helix.nih.gov
Abstract
Thyroid carcinoma accounts for the majority of deaths from endocrine cancers. A major cause of treatment failure is the inability to trap iodine. Chemotherapeutic agents with differentiating properties have been tried in an attempt to increase iodine uptake. We examined the ability of the novel histone deacetylase (HDAC) inhibitor, depsipeptide (FR901228), to modulate the expression of thyroid-specific genes. Four cell lines, two derived from follicular thyroid carcinomas (FTC 133 and FTC 236) and two derived from anaplastic thyroid carcinomas (SW-1736 and KAT-4) were used. In these four cell lines, a very low concentration of depsipeptide (1 ng/mL) increased histone acetylation and expression of both thyroglobulin and the Na+/I- symporter messenger RNAs. After 3 days, messenger RNA levels approached those of a normal thyroid control. Depsipeptide induced increases in 125I accumulation indicated that a functional Na+/I- symporter protein was induced. Transient transfections indicate that the effects are mediated at least in part by a trans-activating factor. These in vitro results suggest that depsipeptide or other histone deacetylase inhibitors might be used clinically in thyroid carcinomas that are unable to trap iodine as an adjunct to radioiodine therapy.
THYROID CARCINOMA, THE most common endocrine malignancy, accounts for the majority of deaths from endocrine cancers (1). In the United States, there are approximately 14,000 new cases of thyroid carcinoma diagnosed each year, with 1,200 deaths attributed to this disease (2). Approximately 90% of nonmedullary thyroid cancers are classified as well-differentiated thyroid carcinomas (WDTCs) (3). Conventional therapy for these tumors consists of near-total thyroidectomy and radioiodine (131I) (4, 5). However, some WDTCs eventually lose their ability to concentrate iodine over time and follow a clinically aggressive course because they become insensitive to subsequent 131I therapy (1, 6).
Loss of iodine trapping is also observed in anaplastic thyroid carcinoma (ATC), an undifferentiated tumor that accounts for less than 5% of nonmedullary thyroid cancers but results in a disproportionate number of deaths (7, 8). Existence of concurrent WDTC has been demonstrated in 3065% of patients with ATC, leading to the hypothesis that its histogenic origin may be a long-standing WDTC, that undergoes rapid dedifferentiation (9, 10, 11). In addition, de novo appearance of ATC is thought to occur in a significant percentage of patients (7).
With both WDTCs that have lost the ability to trap iodine and ATCs, therapeutic options are limited and largely unsuccessful. Palliative or debulking surgery (metastatectomy), external radiation, and chemotherapy have all been tried, with limited success (12, 13, 14, 15, 16, 17). Among experimental options, restoration of iodine trapping has been pursued without convincing efficacy until now (18, 19, 20, 21, 22). In the present study, we describe the use of very low doses of a histone deacetylase (HDAC) inhibitor to increase the expression of thyroid-specific proteins. In four thyroid carcinoma cell lines, including two derived from anaplastic thyroid carcinomas, treatment with the HDAC inhibitor, depsipeptide (FR901228), led to a marked increase in expression of thyroglobulin and the Na+/I- symporter (NIS), with a resultant increase in 125I accumulation. Transient transfection studies indicate this increase is mediated at least in part by trans-activation of these genes.
Materials and Methods
Cell lines and culture conditions
Follicular thyroid carcinoma (FTC) 133 and FTC 236 were derived from cultures obtained from the primary tumor (FTC 133) and a nodal metastasis (FTC 236) of a follicular thyroid carcinoma. The anaplastic thyroid carcinoma cell lines were derived from primary cultures of human ATC tumors. SW-1736 was developed by Drs. Leibowitz and McCombs, III, at the Scott and White Memorial Hospital (Temple, TX) in 1977, was maintained by Nils-Erik Heldin (Uppsala University, Uppsala, Sweden), and provided by Kenneth Ain (University of Kentucky, Lexington, KY). KAT-4 was developed and maintained in RPMI media containing 10% FBS in the laboratory of K. Ain. FTC 133 and FTC 236 were originally maintained in medium containing TSH, but this was discontinued when a difference in growth rate could not be demonstrated in the presence or absence of TSH.
Fluorescein isothiocyanate staining
Cytospins were made from trypsinized cells, and the slides were
fixed in 95% ethanol/5% acetic acid for 1 min at room temperature.
After fixation, slides were washed twice with PBS for 15 min, blocked
in 8% BSA in PBS for 1 h at room temperature, and washed 15 min
in PBS before incubating overnight at 4 C with 5 µg/mL
anti-
acetylated Histone H3 (Upstate Biotechnology, Inc. Lake Placid, NY) in 2% BSA in PBS. Subsequently, cells
were washed twice with PBS for 5 min at room temperature and then
stained with horse antirabbit fluorescein isothiocyanate conjugated
secondary antibody (Vector Laboratories, Inc. Burlingame,
CA). After staining with secondary antibody, slides were washed three
times with PBS for 15 min and then counterstained with DAPI containing
antifade compound (Vector Laboratories, Inc.).
Protein collection and Western blot analysis
Cells were scraped into lysis buffer A containing 10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, and 1.5 mM PMSF and centrifuged at 11,000x g for 10 min at 4 C. Pellets thawed in buffer B containing 50 mM HEPES (pH 7.9), 420 mM KCl, 0.1 mM EDTA (pH 8.0), 5 mM MgCl2, 20% glycerol, 0.5 mM DTT, and 1.5 mM PMSF were rotated for 30 min at 4 C, and centrifuged at 11,000 x g for 15 min at 4 C. The supernatants were collected as nuclear extracts. Ten micrograms of protein were separated on an 11% SDS-PAGE gel, and electroblotting to Immobilon-P transfer membrane (Millipore Corp.) was performed. Nonspecific protein binding was blocked using 5% milk in TNE buffer [2 mM Tris (pH 7.4), 2 mM NaCl, 1 mM EDTA, and 0.15% Tween 20] for 30 min. The membrane was incubated for 30 min with a rabbit polyclonal antibody against acetylated histone H3 (Upstate Biotechnology, Inc.), diluted 1:2000 in 5% milk. After washing, antirabbit Ig horseradish peroxidase-linked secondary antibody (Amersham Pharmacia Biotech, Piscataway, NJ) was added and incubated for 30 min. After washing, the membrane was developed in ECL Western blotting detection reagents (Amersham Pharmacia Biotech).
Quantitative PCR amplification of the thyroglobulin and sodium iodide symporter
Quantitative RT-PCR for thyroglobulin (TG) and NIS was performed as previously described (23, 24). Total RNA was extracted using RNA STAT-60 (Tel-Test, Inc., Friendswood, TX). Single-stranded oligo (dT)-primed complementary DNA (cDNA) was generated using MMLV reverse transcriptase (Life Technologies, Inc., Eggenstein, Germany). Oligonucleotide primers, used for analysis of human TG RNA expression, were: TG 5' (sense), 5354GAAATCGTCGTCTTCTCCAC5374; and TG 3' (antisense), 5565CTGTCAGCACAGTGGCAATA5584.
These primers should generate a product that is 219 bp in length. The amplification reaction was carried out for 35 cycles, and each cycle consisted of 94 C for 1 min, 57 C for 1 min, and 72 C for 2 min, followed by a final 10-min elongation at 72 C.
Oligonucleotide primers for human NIS RNA amplification were: NIS (1) 5' (sense), 956CTGCCCCAGACCAGTACATGCC978; and NIS (1) 3' (antisense), 1237TGACGGTGAAGGAGCCCTGAAG1259.
The expected human NIS product from a cDNA template is 303 bp. The amplification reaction was for 30 cycles, and each cycle consisted of 94 C for 20 sec, 64 C for 30 sec, and 72 C for 60 sec, followed by a final 7-min elongation at 72 C. All quantitations were performed by densitometry. Quantitations were based on measured ß-actin levels. Oligonucleotide primers for human ß-actin RNA amplification were: ß-actin 5' (sense), 207TGGGCATGGGTCAGAAGGAT226; and ß-actin 3' (antisense), 488GAGGCGTACAGGGATAGCAC507.
Northern blot analysis of NIS
RNA was electrophoresed on a 1% agarose gel containing 2 M formaldehyde and was transferred overnight in 20x saline-sodium citrate (SSC) to a nylon membrane (Amersham Pharmacia Biotech). The cDNA probes for Northern blot analysis were generated by PCR using a pair of NIS gene-specific primers: NIS (2) 5' (sense), 1184GCTGGCCCTGCTCATCAA1202; and NIS (2) 3' (antisense), 1648GCAGGCCGGCAGGAACATTC1667.
The NIS gene-specific cDNA fragment was radiolabeled with
[
-32P)deoxycytosine-5'-triphosphate by random
priming and was used as a hybridization probe. The blot was
prehybridized at 42 C in a hybridization mix
containing 50% formamide for 2 h, followed by hybridization at 42
C for 12 h. The blot was then rinsed twice in 2x SSC/0.1% SDS at
room temperature for 10 min and twice in 0.1x SSC/0.1% SDS at 50
C for 20 min.
Growth inhibition and cell viability
Cells were plated at a density of 3000 per well in 96-well plates in 180 µL medium in triplicate. Drug sensitivity was measured by exposing the cells to graded concentrations of depsipeptide in a final volume of 200 µL. At 72 h viable cells were estimated in a colorimetric assay that measures the formazan reduction product of MTT (3-[4, 5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide), which is produced by mitochondrial activity of viable cells. The reduction product was dissolved in dimethyl sulfoxide, and absorbance was quantitated using a plate reader spectrophotometer.
125I accumulation
Cells (3 x 104) were seeded into 24-well dishes in 1 mL medium. After a 1-day incubation period at 37 C with 5% CO2, the medium was aspirated and fresh medium was added with or without depsipeptide (final concentration 1 ng/mL). Iodide uptake was initiated by adding 0.5 mL HBSS (Life Technologies, Inc.) containing approximately 2 µCi carrier-free Na 125I (NEN Life Science Products, Boston, MA) and 30 µM NaI. Incubations were performed for 10 min. For perchlorate inhibition studies, NaClO4 was added as a 100x solution in HBSS to a final concentration of 30 and 100 µM, immediately after the addition of radiolabeled iodine. Reactions were rapidly terminated by removing the radioactive HBSS and washing the cells twice with ice-cold HBSS. Cells were then solubilized by incubation for 20 min in 0.4 mL of 1.0% Triton X-100 (Sigma, Allentown, PA) in HBSS, and accumulated iodide was measured in a gamma counter. The number of cells per well was determined by harvesting and counting (at the time of experiment) three additional wells of cells.
Construction of reporter plasmids
The promoter of the TG gene was isolated using the PCR and DNA from FTC 236 cells. Primers used were: 5' (sense), -500GAGCTCTAAGAGGTTGTTAGAG-479; and 3' (antisense), +40TTTCCTGGCCCTTCCTGGGAGGAA+17.
The amplified fragment was subcloned into the pCRII TA vector (Invitrogen, Carlsbad, CA), and its sequence was confirmed. After digestion with KpnI and XhoI, the 540-bp promoter fragment was ligated to the pGL3-B luciferase (Luc) vector (Promega Corp., Madison, WI). This construct was designated TG promoter-Luc.
The enhancer element of the TG gene was amplified using the PCR and the following primers: 5' (sense), CGGGGTACC-2698GTTCTCACGAGCTCAGTGGAG-2677; and 3' (antisense), CGGACTAGT-2172CCCATTGCCCTAAAATGCATGC-2193.
KpnI (sense) and SpeI (antisense) restriction sites flanked the TG enhancer sequence. The amplified fragment was inserted into the TG promoter-Luc plasmid digested with KpnI and SpeI. This construct was designated TG enhancer/promoter-Luc.
In addition, the HSV-thymidine kinase (TK) minimum promoter was obtained by digesting pRL-TK (Promega Corp.) with HindIII and BglII; this was subcloned into pGL3-B luciferase vector, and designated TK-Luc. TK-Luc was used as the positive control.
Transfections and luciferase assays
Transient transfections were performed using a liposome-mediated method. For all cell lines, 3 x 104 cells were plated 24 h before transfection, after which 0.5 µg plasmid DNA and 4.5 µL of TransFast (Promega Corp.) mixed with 200 µL of medium were added to each well. After incubating 1 h in the above mixture, cells were cultured in the presence or absence of depsipeptide (1 ng/mL) for 2 days. After harvesting, total protein concentration was measured using the protein assay (Bio-Rad Laboratories, Inc., Hercules, CA). Firefly luciferase activity was assessed using the luciferase assay system (Promega Corp.) and normalized to protein. All transfections were performed in triplicate. In all experiments, TK-Luc was used as the positive control. The result with the TK-Luc vector was assigned a value of 100%, and all other values were expressed relative to this as relative luciferase units.
Results
The experiments described herein evolved from studies attempting
to modulate the expression of constructs driven by the TG promoter. The
effects of several differentiating agents on the level of expression of
constructs containing the TG promoter and on the endogenous TG gene
were studied. Preliminary observations indicated that depsipeptide, a
novel HDAC inhibitor currently undergoing phase I trials in humans,
could modulate expression of TG. This effect was originally observed at
concentrations of depsipeptide that were cytotoxic. However, because
unpublished observations indicated that inhibition of HDAC could be
observed at lower concentrations, the effect of lower doses of
depsipeptide on the expression of TG and NIS was investigated in
vitro. Figure 1
demonstrates
cytotoxicity curves with depsipeptide in the four cell lines used in
the present study. In these experiments, cells were exposed to
depsipeptide for 72 h, after which time MTT assays were performed.
As can be seen, in the four cell lines, a depsipeptide concentration of
1 ng/mL for 72 h was not cytotoxic or at most minimally cytotoxic.
This concentration was chosen for all subsequent experiments.
|
|
|
|
|
|
This study describes the induction of a functional Na+/I- symporter in poorly differentiated thyroid carcinoma cell lines by the HDAC inhibitor, depsipeptide. The induction was observed in four independent cell lines, including two derived from anaplastic thyroid carcinomas, using very low concentrations of depsipeptide. Cellular iodine accumulation studies demonstrated marked increases in iodine accumulation in all four cell lines. While these in vitro studies must be considered preliminary, they provide the hope that iodine accumulation could potentially be increased in WDTCs that have lost the ability to trap iodine and in anaplastic thyroid carcinomas.
Although the current therapeutic modalities for WDTCs, including surgery and radioiodine therapy, are generally very effective, they fail to be curative in up to 15% of cases. A significant proportion of these therapeutic failures are due to the progressive loss of the ability of WDTCs to trap iodine or the lack of this ability at the time of initial diagnosis, as is the case with poorly differentiated FTCs and ATCs. The loss of iodine accumulation properties may also be accompanied by other features of dedifferentiation, such as loss of responsiveness of TG expression to TSH or, more rarely, complete or partial loss of baseline TG expression (26). A therapeutic approach that could redifferentiate malignant thyrocytes, even partially, could potentially lead to reconstitution of their ability to trap radioiodine, which would then be organified and retained in these cells, thus inducing cytotoxicity. In this regard, several "antitumor" agents with differentiating properties such as retinoic acid have been considered for the treatment of noniodine-avid thyroid carcinomas (18). Increased levels of mRNA for the NIS and 5'-deiodinase have been reported after the addition of retinoic acid to thyroid derived cell lines in vitro, and a study using retinoic acid reported restoration of iodine uptake in a small number of patients with poorly differentiated thyroid cancers (19, 20, 21, 22).
Depsipeptide (FR901229) is a novel histone deacetylase inhibitor currently in phase I trials in the United States. As with other HDAC inhibitors, it is thought to act by promoting histone acetylation and in turn gene expression. Pharmacokinetics in patients receiving depsipeptide indicate that approximately 90% of circulating drug is protein bound. However, levels exceeding 500 ng/mL have been achieved without significant toxicity, indicating that the concentrations used in the present study can be seen easily achieved in patients (unpublished observations).
In summary, we report the induction of a functional NIS in four thyroid carcinoma cell lines including two derived independently from ATCs. This was achieved with very low concentrations of depsipeptide, which should be easily achieved in patients without significant toxicity. Carefully designed clinical trials using depsipeptide or other HDAC inhibitors to modulate iodine trapping in selected patients with thyroid carcinoma refractory to radioiodine therapy are supported by these observations.
Received August 4, 2000.
Revised January 11, 2001.
Accepted March 5, 2001.
References
This article has been cited by other articles:
![]() |
J. A Woyach and M. H Shah New therapeutic advances in the management of progressive thyroid cancer Endocr. Relat. Cancer, September 1, 2009; 16(3): 715 - 731. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C Smallridge, L. A Marlow, and J. A Copland Anaplastic thyroid cancer: molecular pathogenesis and emerging therapies Endocr. Relat. Cancer, March 1, 2009; 16(1): 17 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Woyach, R. T. Kloos, M. D. Ringel, D. Arbogast, M. Collamore, J. A. Zwiebel, M. Grever, M. Villalona-Calero, and M. H. Shah Lack of Therapeutic Effect of the Histone Deacetylase Inhibitor Vorinostat in Patients with Metastatic Radioiodine-Refractory Thyroid Carcinoma J. Clin. Endocrinol. Metab., January 1, 2009; 94(1): 164 - 170. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K.W. To, O. Polgar, L. M. Huff, K. Morisaki, and S. E. Bates Histone Modifications at the ABCG2 Promoter following Treatment with Histone Deacetylase Inhibitor Mirror Those in Multidrug-Resistant Cells Mol. Cancer Res., January 1, 2008; 6(1): 151 - 164. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing Gene Methylation in Thyroid Tumorigenesis Endocrinology, March 1, 2007; 148(3): 948 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, G. M. Venkataraman, and K. B. Ain Protein Synthesis Inhibitors, in Synergy with 5-Azacytidine, Restore Sodium/Iodide Symporter Gene Expression in Human Thyroid Adenoma Cell Line, KAK-1, Suggesting Trans-Active Transcriptional Repressor J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1080 - 1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban A perspective view of sodium iodide symporter research and its clinical implications. Eur. J. Endocrinol., October 1, 2006; 155(4): 495 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Kogai, K Taki, and G A Brent Enhancement of sodium/iodide symporter expression in thyroid and breast cancer. Endocr. Relat. Cancer, September 1, 2006; 13(3): 797 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Robey, Z. Zhan, R. L. Piekarz, G. L. Kayastha, T. Fojo, and S. E. Bates Increased MDR1 Expression in Normal and Malignant Peripheral Blood Mononuclear Cells Obtained from Patients Receiving Depsipeptide (FR901228, FK228, NSC630176) Clin. Cancer Res., March 1, 2006; 12(5): 1547 - 1555. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. M. Au, C. McBride, K. G. Wilhelm Jr., R. J. Koenig, B. Speller, L. Cheung, M. Messina, J. Wentworth, V. Tasevski, D. Learoyd, et al. PAX8-Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Disrupts Normal PAX8 or PPAR{gamma} Transcriptional Function and Stimulates Follicular Thyroid Cell Growth Endocrinology, January 1, 2006; 147(1): 367 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Bravo, M. E.R. Garcia-Rendueles, R. Seoane, V. Dosil, J. Cameselle-Teijeiro, L. Lopez-Lazaro, J. Zalvide, F. Barreiro, C. M. Pombo, and C. V. Alvarez Plitidepsin Has a Cytostatic Effect in Human Undifferentiated (Anaplastic) Thyroid Carcinoma Clin. Cancer Res., November 1, 2005; 11(21): 7664 - 7673. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Rao, P. E. Goretzki, J. Kohrle, and G. Brabant Letter re: Id1 Gene Expression in Hyperplastic and Neoplastic Thyroid Tissues J. Clin. Endocrinol. Metab., October 1, 2005; 90(10): 5906 - 5906. [Full Text] [PDF] |
||||
![]() |
C. Puppin, F. D'Aurizio, A. V. D'Elia, L. Cesaratto, G. Tell, D. Russo, S. Filetti, E. Ferretti, E. Tosi, T. Mattei, et al. Effects of Histone Acetylation on Sodium Iodide Symporter Promoter and Expression of Thyroid-Specific Transcription Factors Endocrinology, September 1, 2005; 146(9): 3967 - 3974. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. K. Kelly, O. A. O'Connor, L. M. Krug, J. H. Chiao, M. Heaney, T. Curley, B. MacGregore-Cortelli, W. Tong, J. P. Secrist, L. Schwartz, et al. Phase I Study of an Oral Histone Deacetylase Inhibitor, Suberoylanilide Hydroxamic Acid, in Patients With Advanced Cancer J. Clin. Oncol., June 10, 2005; 23(17): 3923 - 3931. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Frohlich, F. Machicao, and R. Wahl Action of thiazolidinediones on differentiation, proliferation and apoptosis of normal and transformed thyrocytes in culture Endocr. Relat. Cancer, June 1, 2005; 12(2): 291 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Mitsiades, V. Poulaki, C. McMullan, J. Negri, G. Fanourakis, A. Goudopoulou, V. M. Richon, P. A. Marks, and N. Mitsiades Novel Histone Deacetylase Inhibitors in the Treatment of Thyroid Cancer Clin. Cancer Res., May 15, 2005; 11(10): 3958 - 3965. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Furuya, H. Shimura, H. Suzuki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi Histone Deacetylase Inhibitors Restore Radioiodide Uptake and Retention in Poorly Differentiated and Anaplastic Thyroid Cancer Cells by Expression of the Sodium/Iodide Symporter Thyroperoxidase and Thyroglobulin Endocrinology, June 1, 2004; 145(6): 2865 - 2875. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Braga-Basaria and M. D. Ringel Beyond Radioiodine: A Review of Potential New Therapeutic Approaches for Thyroid Cancer J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 1947 - 1960. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Als, P. Gedeon, H. Rosler, C. Minder, P. Netzer, and J. A. Laissue Survival Analysis of 19 Patients with Toxic Thyroid Carcinoma J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4122 - 4127. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Furumai, A. Matsuyama, N. Kobashi, K.-H. Lee, M. Nishiyama, H. Nakajima, A. Tanaka, Y. Komatsu, N. Nishino, M. Yoshida, et al. FK228 (Depsipeptide) as a Natural Prodrug That Inhibits Class I Histone Deacetylases Cancer Res., September 1, 2002; 62(17): 4916 - 4921. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Richon and J. P. O'Brien Histone Deacetylase Inhibitors: A New Class of Potential Therapeutic Agents for Cancer Treatment : Commentary re: V. Sandor et al., Phase I Trial of the Histone Deacetylase Inhibitor, Depsipeptide (FR901228, NSC 630176), in Patients with Refractory Neoplasms. Clin. Cancer Res., 8: 718-728, 2002. Clin. Cancer Res., March 1, 2002; 8(3): 662 - 664. [Full Text] [PDF] |
||||
![]() |
V. Sandor, S. Bakke, R. W. Robey, M. H. Kang, M. V. Blagosklonny, J. Bender, R. Brooks, R. L. Piekarz, E. Tucker, W. D. Figg, et al. Phase I Trial of the Histone Deacetylase Inhibitor, Depsipeptide (FR901228, NSC 630176), in Patients with Refractory Neoplasms Clin. Cancer Res., March 1, 2002; 8(3): 718 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kitazono, M. E. Goldsmith, T. Aikou, S. Bates, and T. Fojo Enhanced Adenovirus Transgene Expression in Malignant Cells Treated with the Histone Deacetylase Inhibitor FR901228 Cancer Res., September 1, 2001; 61(17): 6328 - 6330. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |