| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Articles |
Departments of Endocrinology and Metabolism (R.E., C.R., B.C., A.P., F.P.), Oncology (F.B.), and Surgery (P.M.), University of Pisa, Pisa 56124, Italy; and Institute of Radiation Medicine (T.V., E.K.) and Oncology-Pathology Department, State Medical University (E.P.D., V.V.), Minsk 220600, Belarus
Address correspondence and requests for reprints to: Rossella Elisei, M.D., Department of Endocrinology, University of Pisa, Via Paradisa 2, Pisa 56124, Italy.
Abstract
Rearrangements of the RET proto-oncogene may occur in both naturally occurring and radiation-induced papillary thyroid carcinomas. Conflicting results on the frequency and type of RET/PTC rearrangements have been reported in relation to age, radiation exposure, and histological tumor variant.
We designed the present study to evaluate in a single laboratory, using the same methodologies, the pattern of RET/PTC activation in thyroid tumors from different groups of patients (exposed or not exposed to radiation, children or adults, with benign or malignant tumors) in relationship to the above mentioned variables.
We studied 154 patients with benign nodules (n = 65) or papillary thyroid cancer (n = 89). In the last group, 25 were Belarus children exposed to the post-Chernobyl radioactive fallout, 17 were Italian adults exposed to external radiotherapy for benign diseases, and 47 were Italian subjects (25 children and 22 adults) with no history of radiation exposure. Among patients with benign thyroid nodules, 21 were Belarus subjects (18 children and 3 adults) exposed to the post-Chernobyl radioactive fallout, 8 were Italian adults exposed to external radiation on the head and neck, and 36 were Italian adults with naturally occurring benign nodules.
The overall frequency of RET/PTC rearrangements in papillary thyroid cancer was 55%. The highest frequency was found in post-Chernobyl children and was significantly higher (P = 0.02) than that found in Italian children not exposed to radiation, but not significantly higher than that found in adults exposed to external radiation. No difference of RET/PTC rearrangements was found between samples from irradiated (external x-ray) or not irradiated adult patients, as well as between children and adults with naturally occurring, not irradiated, thyroid cancer.
When analyzing the type of RET/PTC rearrangement (RET/PTC1 or RET/PTC3), no major difference was apparent. In addition, eight cases with an unknown RET/PTC rearrangement and three cases with the concomitant expression of RET/PTC1 and RET/PTC3 were found. No significant correlation was observed between the frequency and/or the type of RET/PTC rearrangement and clinical-epidemiological features of the patients such as age at diagnosis, age at exposure, histological variant, gender and tumor-node-metastasis (TNM) categories.
RET/PTC rearrangements were also found in 52.4% of post-Chernobyl benign nodules, in 37.5% of benign nodules exposed to external radiation and in 13.9% of naturally occurring nodules (P = 0.005, between benign post-Chernobyl nodules and naturally occurring nodules). The relative frequency of RET/PTC1 and RET/PTC3 in rearranged benign tumors showed no major difference.
In conclusion, our results indicate that the presence of RET/PTC rearrangements in thyroid tumors is not restricted to the malignant phenotype, is not higher in radiation-induced tumors compared with those naturally occurring, is not different after exposure to radioiodine or external radiation, and is not dependent from young age. Other factors, probably influenced by ethnic or genetic background, may act independently from or in cooperation with radiation, to trigger the DNA damage leading to RET proto-oncogene activation.
REARRANGEMENTS OF THE RET proto-oncogene, mainly in the form of RET/PTC1 and RET/PTC3, are found in papillary thyroid carcinomas and have been shown to play a pathogenic role (1, 2, 3). Several types of rearrangements have been described according to the activating genes involved in the rearrangement with the RET gene (4, 5, 6, 7, 8, 9, 10) with frequencies varying widely among different countries and different age groups (11, 12). Few and controversial data have been reported on the presence of RET/PTC rearrangements in benign thyroid tumors (13, 14).
Ionizing radiation, the only recognized etiological factor in the pathogenesis of papillary thyroid cancer both after external irradiation (15, 16) and after the Chernobyl nuclear disaster in 1986 (17, 18, 19), is responsible for the generation of RET/PTC rearrangements, as supported by in vitro studies (20) and by recent studies in post-Chernobyl thyroid tumors (21, 22).
Conflicting results on the frequency and type of RET/PTC rearrangements in relation to age, radiation exposure, and histological tumor variant have been reported in different series (23, 24, 25, 26, 27). Because the above data were obtained by several groups, using different experimental techniques, we designed the present study to evaluate in a single laboratory, using the same methodologies, the pattern of RET/PTC activation in thyroid tumors in relationship to different factors, such as radiation exposure (irradiated vs. not irradiated), type of radiation (internal vs. external), age (children and adolescents vs. adults) and pathology (benign vs. malignant tumors).
Patients and Methods
Patients
We studied 154 patients submitted to surgical treatment for
benign (n = 65) or malignant (n = 89) thyroid nodules. As
indicated in Table 1
, all malignant
nodules were from patients with papillary thyroid cancer: 25 were
Belarus children exposed to the post-Chernobyl radioactive fallout, 17
were Italian adults exposed to external radiotherapy for benign
diseases mostly during childhood, and 47 were Italian subjects (25
children and 22 adults) with no history of radiation exposure. Age at
diagnosis was comparable in the two groups of childhood thyroid cancer
and in the two groups of adults. Age at radiation exposure was also
similar in most of the Belarus children compared with adult subjects
who received external irradiation during childhood, with the exception
of six Belarus children who were exposed in uterus and of three Italian
patients who received radiation therapy when adults (24, 35, and 47
yr). As expected, the latency period between radiation exposure and
clinical manifestation of the tumor was much shorter in Belarus
children.
|
Histology of all samples was reviewed in our Center to use uniform
criteria of diagnosis. The pathological diagnosis of malignant and
benign cases is reported in Table 2
.
|
Fresh and paraffin-embedded tissues were used in 84 and 70 cases, respectively. In case of fresh tissue, total RNA was extracted from 30100 mg tissue using a commercial kit based on the guanidinium isothiocyanate method (RNAzol B Tel-Test, Friendswood, TX). When using paraffin-embedded tissues, total RNA was isolated from five sections (20 µm thick) immediately adjacent to the diagnostic slides. RNA extraction was performed as described previously (25).
RT
Total RNA was reverse transcribed into complementary DNA (cDNA) using Avian Mieloblastosis Virus reverse transcriptase. In particular, 50% (5 µL) of RNA recovered from paraffin-embedded tissues or 5 µg RNA recovered from fresh tissues were used for the production of cDNA in a mixture containing 10 mM MgCl2, 1 mM dNTP, 0.45 U random hexameres (Amersham Pharmacia Biotech, Uppsala, Sweden), 23 U reverse transcriptase (Promega Corp., Madison, WI), and 80 U recombinant RNasin (Promega Corp.) in a final volume of 100 µL. After a 1-h incubation at 42 C, the enzyme was heat inactivated at 95 C for 5 min.
PCR amplification and Southern blotting
The cDNA quality was tested by the amplification of a 236-bp sequence of c-N-ras (25). All samples included in the study demonstrated detectable levels of N-ras transcript. RET/PTC1 and RET/PTC3 were analyzed in all samples by PCR using primers reported previously (25). In cases positive for RET/PTC1 and/or RET/PTC3, an internal control was introduced to role out the possibility of PCR contamination consisting of the use of a second pair of primers, annealing externally to the previous PCR product (RET/PTC1: ext-F 5'gtcggggggcattgtcatct3', ext-R 5'aagttcttccgagggaattc3'; RET/PTC3: ext-F 5'tggcttatccaaaagcagac3', ext-R 5'gccccatacaatttgatgac3'). Cases positive for both pairs of primers were considered as real positives. To identify types of RET rearrangements other than RET/PTC1 and RET/PTC3, negative samples for both rearrangements were studied for the expression of the tyrosine kinase (TK) and extracellular (EC) domains of the RET gene. All samples showing TK expression not associated to EC expression were considered positive for a RET rearrangement (RET/PTCX) different from RET/PTC1 and RET/PTC3 (25). PCR protocol was the same for each amplified fragment: ten microliters of cDNA were added to a mixture containing 1.5 mM MgCl2, 20 pmol of each primer, 200 µM dNTP, and 0.3 U Taq (Promega Corp.) in a final volume of 30 µL. Thirty-five cycles of denaturation (94 C for 1 min), annealing (55 C for 1 min), and extension (72 C for 1.5 min) were conducted on an automated heat block (DNA thermal cycler; MJ).
Ten microliters of PCR product were electrophoresed in a 1.5% agarose
gel and blotted onto a nylon membrane. Each filter was then hybridized
with internal probes (Table 3
) specific
for each amplified fragment, labeled using a chemoluminescent method
(Gene Images 3'-Oligolabelling and CDP-Star Detection System;
Amersham Pharmacia Biotech).
|
RET/PTC in papillary thyroid carcinomas
The frequency of RET/PTC rearrangements in papillary thyroid
cancer (considering all subjects) was 55% (49 of 89). As shown in Fig. 1
, the highest frequency was found in
post-Chernobyl children (76%) and was significantly higher
(P = 0.02, by X2) when compared
with the group of Italian children not exposed to radiation (40%) and
when compared with all the others groups combined (P =
0.02, by
2). However, when the
post-Chernobyl-positive cases were separately compared with the two
groups of adults (exposed or not exposed to radiation) no significant
difference was found. In particular, no difference was found between
post-Chernobyl-positive cases and the group of adults exposed to
external radiation (52.9%), between samples from irradiated (external
x-ray) or not irradiated adult patients (52.9% vs. 50%,
respectively), and between children and adults with naturally
occurring, not irradiated, thyroid cancer (40.0% vs. 50%,
respectively).
|
|
|
No significant correlation was observed between the frequency and/or the type of RET/PTC rearrangement and clinical-epidemiological features of the patients such as age at diagnosis, age at exposure, histological variant, gender and tumor-node-metastasis (TNM) categories.
RET/PTC in benign thyroid nodules
RET/PTC rearrangements were found in 29.2% (19 of 65) of
benign nodules. As shown in Fig. 3
, RET/PTC rearrangements were found in 52.4% of post-Chernobyl benign
nodules, in 37.5% of benign nodules exposed to external radiation and
in 13.9% of naturally occurring nodules. The difference between benign
post-Chernobyl nodules and naturally occurring nodules was significant
(P = 0.005 by X2), whereas no
difference was found between external irradiated nodules and naturally
occurring nodules. This last result may be due to the quite small
number (n = 8) of patients with benign nodules exposed to external
radiation.
|
|
In this study, we analyzed the frequency and type of RET/PTC rearrangements in a series of irradiated or not irradiated benign (n = 65) and malignant (n = 89) thyroid nodules in relation to the type of irradiation (external vs. internal), age at diagnosis, histology and gender. One by one, these variables have been analyzed in previous reports. The present study differs from the others because, for the first time, all the patients categories have been investigated in the same laboratory, using the same methodology.
According to the current opinion based on the available literature, RET/PTC rearrangements seem to be related to papillary thyroid carcinoma (28), radiation exposure (13, 23, 24, 25), and young age (26).
This assumption is not supported by the present study; in fact, in our series RET/PTC rearrangements were not restricted to papillary thyroid cancer. A relatively high frequency of RET/PTC rearrangements was also found in benign nodular thyroid diseases of patients exposed to post-Chernobyl fallout (52.4%) or external radiation (37.5%), and, albeit less frequently, in patients with benign nodules not exposed to radiation (13.9%). While no RET/PTC rearrangements in benign thyroid lesions have been found by Santoro et al. (28) and Thomas et al. (27), RET mutations have been found by Bounacer et al. (13) in irradiated benign thyroid nodules of French patients and by Ishizaka et al. (14) in sporadic follicular adenomas. Among other possibilities, the occurrence of RET/PTC rearrangements in benign nodules might be explained by the presence of microfoci of papillary thyroid carcinoma, or even of few neoplastic cells within the benign tumor, not easily detectable by histology. This possibility is in keeping with the high frequency of RET/PTC rearrangements found in papillary microcarcinomas: 42.3% in an Italian series (29) and 77% in a Canadian series (30). An alternative explanation is that RET/PTC rearrangement is an early genetic event favoring the transition from benign to malignant phenotype.
In the present study, the effect of post-Chernobyl and external radiation has been compared in children and adults with benign and malignant thyroid lesions. No significant differences have been found in the frequency of RET/PTC rearrangements in both malignant and benign tumors of our series, indicating that these changes are not related to the modality of irradiation. When radiation-induced and naturally occurring thyroid carcinomas have been compared in adults and children, a significantly higher frequency of RET/PTC rearrangements has been only found in Belarus children with respect to Italian children. At variance with our data, no difference has been found by Nikiforov et al. (25) when comparing the frequency of RET/PTC rearrangements in Belarus children with post-Chernobyl cancer and naturally occurring American childhood tumors. The question of whether this difference could be due to different ethnic background is difficult to solve because the lack of the appropriate control (i.e. Belarus children with naturally occurring papillary thyroid carcinoma) in both studies, prevents the possibility to answer this question. It is worth noting that reported frequencies of RET/PTC rearrangements in sporadic papillary thyroid cancer vary widely among different countries, ranging from as low as 2.5% in Saudi Arabia to 59% in the United Kingdom (31, 32, 33, 34, 35, 36, 37, 38, 39).
Age has been advocated as a factor favoring the development of RET/PTC rearrangements. In this respect, it is of interest that when adults and children with naturally occurring papillary thyroid cancer were compared within the same country no significant difference in the frequency of RET/PTC rearrangements has been found in United Kingdom (36) and Japan (40) series as well as in the present study. Moreover, no difference has been reported by Smida et al. (41) between Belarus children and adults with post-Chernobyl thyroid cancer. All together, these data strongly suggest that age does not play a major role in the occurrence of RET/PTC-positive papillary thyroid cancer and indirectly support the relevance of the ethnic role.
A relative higher frequency of RET/PTC3 with respect to RET/PTC1 has been reported in post-Chernobyl thyroid cancer in earlier studies from this (23) and other laboratories (24, 25). In the present study the frequency of RET/PTC3 rearrangements was not different from that of RET/PTC1 in benign and malignant tumors of both children and adults, irrespective of whether irradiated or not irradiated. However, when cumulating the solid and follicular histological variants a prevalence of RET/PTC3 was found in post-Chernobyl tumors.
As in other series (38, 39), we found the concomitant expression of both RET/PTC1 and RET/PTC3 in the same tissue in a significant proportion of cases. Among other possibilities, this finding can be explained by the occurrence of radiation-induced paracentric inversion in both chromosomes 10 of a single cell giving rise to RET/PTC1 in one chromosome and RET/PTC3 in the other one. Alternatively radiations may induce RET/PTC1 and RET/PTC3 tumors in the same gland resulting in a polyclonal thyroid neoplasm. Based on the different quantitative expression of the two rearrangements in the same tumor, the last possibility might be favored. However, the differential expression of RET/PTC1 and RET/PTC3 can also be explained by chromosome 10 inversion in a single cell when RET/PTC1 and RET/PTC3 transcription is driven by different promoters, H4 and ELE1 respectively, with different activities.
As in other series (24, 25) we found several cases of RET/PTCX. The precise nature of these changes requires further studies, but it is interesting to note that in the present series most of the cases of RET/PTCX were found in thyroid tumors of children exposed while in uterus.
In conclusion, our results indicate that the presence of RET/PTC rearrangements in thyroid tumors is not restricted to the malignant phenotype, is not higher in radiation-induced tumors compared with those naturally occurring, is not different after exposure to radioiodine or external radiation and is not dependent from young age. Other factors, probably influenced by ethnic or genetic background, may act independently from or in cooperation with radiations, to trigger the DNA damage leading to RET proto-oncogene activation.
Footnotes
1 Supported in part by a grant from European Communities:
INCO-Copernicus Project (IC15-CT980314) and MURST (ex 40%) 2000. ![]()
Received December 27, 2000.
Revised March 9, 2001.
Accepted March 27, 2001.
References
of cyclic AMP-dependent protein kinase A. Mol Cell Biol. 13:358366.
3 and -4 in Geman papillary thyroid
carcinoma. Br J Cancer. 77:903906.[Medline]
This article has been cited by other articles:
![]() |
C. Romei, R. Ciampi, P. Faviana, L. Agate, E. Molinaro, V. Bottici, F. Basolo, P. Miccoli, F. Pacini, A. Pinchera, et al. BRAFV600E mutation, but not RET/PTC rearrangements, is correlated with a lower expression of both thyroperoxidase and sodium iodide symporter genes in papillary thyroid cancer Endocr. Relat. Cancer, June 1, 2008; 15(2): 511 - 520. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Salajegheh, E B Petcu, R A Smith, and A K-Y Lam Follicular variant of papillary thyroid carcinoma: a diagnostic challenge for clinicians and pathologists Postgrad. Med. J., February 1, 2008; 84(988): 78 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Riesco-Eizaguirre and P. Santisteban New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy Endocr. Relat. Cancer, December 1, 2007; 14(4): 957 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. W Baloch and V. A LiVolsi Our approach to follicular-patterned lesions of the thyroid J. Clin. Pathol., March 1, 2007; 60(3): 244 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhu, R. Ciampi, M. N. Nikiforova, M. Gandhi, and Y. E. Nikiforov Prevalence of RET/PTC Rearrangements in Thyroid Papillary Carcinomas: Effects of the Detection Methods and Genetic Heterogeneity J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3603 - 3610. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al. Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature. Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. E. Nikiforov RET/PTC Rearrangement--A Link between Hashimoto's Thyroiditis and Thyroid Cancer...or Not J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2040 - 2042. [Full Text] [PDF] |
||||
![]() |
K. J. Rhoden, K. Unger, G. Salvatore, Y. Yilmaz, V. Vovk, G. Chiappetta, M. B. Qumsiyeh, J. L. Rothstein, A. Fusco, M. Santoro, et al. RET/Papillary Thyroid Cancer Rearrangement in Nonneoplastic Thyrocytes: Follicular Cells of Hashimoto's Thyroiditis Share Low-Level Recombination Events with a Subset of Papillary Carcinoma J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2414 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
B Jarzab, D Handkiewicz-Junak, and J Wloch Juvenile differentiated thyroid carcinoma and the role of radioiodine in its treatment: a qualitative review Endocr. Relat. Cancer, December 1, 2005; 12(4): 773 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Marx and W. F. Simonds Hereditary Hormone Excess: Genes, Molecular Pathways, and Syndromes Endocr. Rev., August 1, 2005; 26(5): 615 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Xing BRAF mutation in thyroid cancer Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J Di Cristofaro, V Vasko, V Savchenko, S Cherenko, A Larin, M D Ringel, M Saji, M Marcy, J F Henry, P Carayon, et al. ret/PTC1 and ret/PTC3 in thyroid tumors from Chernobyl liquidators: comparison with sporadic tumors from Ukrainian and French patients Endocr. Relat. Cancer, March 1, 2005; 12(1): 173 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Elisei, B. Cosci, C. Romei, V. Bottici, M. Sculli, R. Lari, R. Barale, F. Pacini, and A. Pinchera RET Exon 11 (G691S) Polymorphism Is Significantly More Frequent in Sporadic Medullary Thyroid Carcinoma Than in the General Population J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3579 - 3584. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing, R. P. Tufano, A. P. Tufaro, S. Basaria, M. Ewertz, E. Rosenbaum, P. J. Byrne, J. Wang, D. Sidransky, and P. W. Ladenson Detection of BRAF Mutation on Fine Needle Aspiration Biopsy Specimens: A New Diagnostic Tool for Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2867 - 2872. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sadetzki, R. Calderon-Margalit, B. Modan, S. Srivastava, and R. M. Tuttle Ret/PTC Activation in Benign and Malignant Thyroid Tumors Arising in a Population Exposed to Low-Dose External-Beam Irradiation in Childhood J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2281 - 2289. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Puxeddu, S. Moretti, R. Elisei, C. Romei, R. Pascucci, M. Martinelli, C. Marino, N. Avenia, E. D. Rossi, G. Fadda, et al. BRAFV599E Mutation Is the Leading Genetic Event in Adult Sporadic Papillary Thyroid Carcinomas J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2414 - 2420. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vivaldi, F. Pacini, F. Martini, L. Iaccheri, F. Pezzetti, R. Elisei, A. Pinchera, P. Faviana, F. Basolo, and M. Tognon Simian Virus 40-Like Sequences from Early and Late Regions in Human Thyroid Tumors of Different Histotypes J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 892 - 899. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Collins, G. Chiappetta, A. B. Schneider, M. Santoro, F. Pentimalli, L. Fogelfeld, T. Gierlowski, E. Shore-Freedman, G. Jaffe, and A. Fusco RET Expression in Papillary Thyroid Cancer from Patients Irradiated in Childhood for Benign Conditions J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3941 - 3946. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fusco, G. Chiappetta, P. Hui, G. Garcia-Rostan, L. Golden, B. K. Kinder, D. A. Dillon, A. Giuliano, A. M. Cirafici, M. Santoro, et al. Assessment of RET/PTC Oncogene Activation and Clonality in Thyroid Nodules with Incomplete Morphological Evidence of Papillary Carcinoma : A Search for the Early Precursors of Papillary Cancer Am. J. Pathol., June 1, 2002; 160(6): 2157 - 2167. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |