help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elisei, R.
Right arrow Articles by Pacini, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elisei, R.
Right arrow Articles by Pacini, F.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 7 3211-3216
Copyright © 2001 by The Endocrine Society


Original Articles

RET/PTC Rearrangements in Thyroid Nodules: Studies in Irradiated and Not Irradiated, Malignant and Benign Thyroid Lesions in Children and Adults1

Rossella Elisei, Cristina Romei, Tatiana Vorontsova, Barbara Cosci, Vera Veremeychik, Elvira Kuchinskaya, Fulvio Basolo, Eugeni P. Demidchik, Paolo Miccoli, Aldo Pinchera and Furio Pacini

Departments of Endocrinology and Metabolism (R.E., C.R., B.C., A.P., F.P.), Oncology (F.B.), and Surgery (P.M.), University of Pisa, Pisa 56124, Italy; and Institute of Radiation Medicine (T.V., E.K.) and Oncology-Pathology Department, State Medical University (E.P.D., V.V.), Minsk 220600, Belarus

Address correspondence and requests for reprints to: Rossella Elisei, M.D., Department of Endocrinology, University of Pisa, Via Paradisa 2, Pisa 56124, Italy.

Abstract

Rearrangements of the RET proto-oncogene may occur in both naturally occurring and radiation-induced papillary thyroid carcinomas. Conflicting results on the frequency and type of RET/PTC rearrangements have been reported in relation to age, radiation exposure, and histological tumor variant.

We designed the present study to evaluate in a single laboratory, using the same methodologies, the pattern of RET/PTC activation in thyroid tumors from different groups of patients (exposed or not exposed to radiation, children or adults, with benign or malignant tumors) in relationship to the above mentioned variables.

We studied 154 patients with benign nodules (n = 65) or papillary thyroid cancer (n = 89). In the last group, 25 were Belarus children exposed to the post-Chernobyl radioactive fallout, 17 were Italian adults exposed to external radiotherapy for benign diseases, and 47 were Italian subjects (25 children and 22 adults) with no history of radiation exposure. Among patients with benign thyroid nodules, 21 were Belarus subjects (18 children and 3 adults) exposed to the post-Chernobyl radioactive fallout, 8 were Italian adults exposed to external radiation on the head and neck, and 36 were Italian adults with naturally occurring benign nodules.

The overall frequency of RET/PTC rearrangements in papillary thyroid cancer was 55%. The highest frequency was found in post-Chernobyl children and was significantly higher (P = 0.02) than that found in Italian children not exposed to radiation, but not significantly higher than that found in adults exposed to external radiation. No difference of RET/PTC rearrangements was found between samples from irradiated (external x-ray) or not irradiated adult patients, as well as between children and adults with naturally occurring, not irradiated, thyroid cancer.

When analyzing the type of RET/PTC rearrangement (RET/PTC1 or RET/PTC3), no major difference was apparent. In addition, eight cases with an unknown RET/PTC rearrangement and three cases with the concomitant expression of RET/PTC1 and RET/PTC3 were found. No significant correlation was observed between the frequency and/or the type of RET/PTC rearrangement and clinical-epidemiological features of the patients such as age at diagnosis, age at exposure, histological variant, gender and tumor-node-metastasis (TNM) categories.

RET/PTC rearrangements were also found in 52.4% of post-Chernobyl benign nodules, in 37.5% of benign nodules exposed to external radiation and in 13.9% of naturally occurring nodules (P = 0.005, between benign post-Chernobyl nodules and naturally occurring nodules). The relative frequency of RET/PTC1 and RET/PTC3 in rearranged benign tumors showed no major difference.

In conclusion, our results indicate that the presence of RET/PTC rearrangements in thyroid tumors is not restricted to the malignant phenotype, is not higher in radiation-induced tumors compared with those naturally occurring, is not different after exposure to radioiodine or external radiation, and is not dependent from young age. Other factors, probably influenced by ethnic or genetic background, may act independently from or in cooperation with radiation, to trigger the DNA damage leading to RET proto-oncogene activation.

REARRANGEMENTS OF THE RET proto-oncogene, mainly in the form of RET/PTC1 and RET/PTC3, are found in papillary thyroid carcinomas and have been shown to play a pathogenic role (1, 2, 3). Several types of rearrangements have been described according to the activating genes involved in the rearrangement with the RET gene (4, 5, 6, 7, 8, 9, 10) with frequencies varying widely among different countries and different age groups (11, 12). Few and controversial data have been reported on the presence of RET/PTC rearrangements in benign thyroid tumors (13, 14).

Ionizing radiation, the only recognized etiological factor in the pathogenesis of papillary thyroid cancer both after external irradiation (15, 16) and after the Chernobyl nuclear disaster in 1986 (17, 18, 19), is responsible for the generation of RET/PTC rearrangements, as supported by in vitro studies (20) and by recent studies in post-Chernobyl thyroid tumors (21, 22).

Conflicting results on the frequency and type of RET/PTC rearrangements in relation to age, radiation exposure, and histological tumor variant have been reported in different series (23, 24, 25, 26, 27). Because the above data were obtained by several groups, using different experimental techniques, we designed the present study to evaluate in a single laboratory, using the same methodologies, the pattern of RET/PTC activation in thyroid tumors in relationship to different factors, such as radiation exposure (irradiated vs. not irradiated), type of radiation (internal vs. external), age (children and adolescents vs. adults) and pathology (benign vs. malignant tumors).

Patients and Methods

Patients

We studied 154 patients submitted to surgical treatment for benign (n = 65) or malignant (n = 89) thyroid nodules. As indicated in Table 1Go, all malignant nodules were from patients with papillary thyroid cancer: 25 were Belarus children exposed to the post-Chernobyl radioactive fallout, 17 were Italian adults exposed to external radiotherapy for benign diseases mostly during childhood, and 47 were Italian subjects (25 children and 22 adults) with no history of radiation exposure. Age at diagnosis was comparable in the two groups of childhood thyroid cancer and in the two groups of adults. Age at radiation exposure was also similar in most of the Belarus children compared with adult subjects who received external irradiation during childhood, with the exception of six Belarus children who were exposed in uterus and of three Italian patients who received radiation therapy when adults (24, 35, and 47 yr). As expected, the latency period between radiation exposure and clinical manifestation of the tumor was much shorter in Belarus children.


View this table:
[in this window]
[in a new window]
 
Table 1. Epidemiological data of patients with papillary thyroid cancer and benign neoplasm included in the study

 
Among patients with benign thyroid nodules after radiation exposure, 21 were Belarus subjects (18 children and 3 adults) exposed to the post-Chernobyl radioactive fallout and 8 were Italian adults exposed to external radiation. Age at exposure in these two groups was not comparable. In fact, 17 of the 21 Belarus subjects, as opposed to 3 of the 8 Italian subjects, had been exposed when less than 10 yr old. As a control group, we studied 36 Italian adult patients with naturally-occurring benign thyroid nodules.

Histology of all samples was reviewed in our Center to use uniform criteria of diagnosis. The pathological diagnosis of malignant and benign cases is reported in Table 2Go.


View this table:
[in this window]
[in a new window]
 
Table 2. Pathological features of papillary thyroid cancer and benign neoplasm included in the study

 
RNA isolation from thyroid tissues

Fresh and paraffin-embedded tissues were used in 84 and 70 cases, respectively. In case of fresh tissue, total RNA was extracted from 30–100 mg tissue using a commercial kit based on the guanidinium isothiocyanate method (RNAzol B Tel-Test, Friendswood, TX). When using paraffin-embedded tissues, total RNA was isolated from five sections (20 µm thick) immediately adjacent to the diagnostic slides. RNA extraction was performed as described previously (25).

RT

Total RNA was reverse transcribed into complementary DNA (cDNA) using Avian Mieloblastosis Virus reverse transcriptase. In particular, 50% (5 µL) of RNA recovered from paraffin-embedded tissues or 5 µg RNA recovered from fresh tissues were used for the production of cDNA in a mixture containing 10 mM MgCl2, 1 mM dNTP, 0.45 U random hexameres (Amersham Pharmacia Biotech, Uppsala, Sweden), 23 U reverse transcriptase (Promega Corp., Madison, WI), and 80 U recombinant RNasin (Promega Corp.) in a final volume of 100 µL. After a 1-h incubation at 42 C, the enzyme was heat inactivated at 95 C for 5 min.

PCR amplification and Southern blotting

The cDNA quality was tested by the amplification of a 236-bp sequence of c-N-ras (25). All samples included in the study demonstrated detectable levels of N-ras transcript. RET/PTC1 and RET/PTC3 were analyzed in all samples by PCR using primers reported previously (25). In cases positive for RET/PTC1 and/or RET/PTC3, an internal control was introduced to role out the possibility of PCR contamination consisting of the use of a second pair of primers, annealing externally to the previous PCR product (RET/PTC1: ext-F 5'gtcggggggcattgtcatct3', ext-R 5'aagttcttccgagggaattc3'; RET/PTC3: ext-F 5'tggcttatccaaaagcagac3', ext-R 5'gccccatacaatttgatgac3'). Cases positive for both pairs of primers were considered as real positives. To identify types of RET rearrangements other than RET/PTC1 and RET/PTC3, negative samples for both rearrangements were studied for the expression of the tyrosine kinase (TK) and extracellular (EC) domains of the RET gene. All samples showing TK expression not associated to EC expression were considered positive for a RET rearrangement (RET/PTCX) different from RET/PTC1 and RET/PTC3 (25). PCR protocol was the same for each amplified fragment: ten microliters of cDNA were added to a mixture containing 1.5 mM MgCl2, 20 pmol of each primer, 200 µM dNTP, and 0.3 U Taq (Promega Corp.) in a final volume of 30 µL. Thirty-five cycles of denaturation (94 C for 1 min), annealing (55 C for 1 min), and extension (72 C for 1.5 min) were conducted on an automated heat block (DNA thermal cycler; MJ).

Ten microliters of PCR product were electrophoresed in a 1.5% agarose gel and blotted onto a nylon membrane. Each filter was then hybridized with internal probes (Table 3Go) specific for each amplified fragment, labeled using a chemoluminescent method (Gene Images 3'-Oligolabelling and CDP-Star Detection System; Amersham Pharmacia Biotech).


View this table:
[in this window]
[in a new window]
 
Table 3. Primers and probes used for RET/PTC screening

 
Results

RET/PTC in papillary thyroid carcinomas

The frequency of RET/PTC rearrangements in papillary thyroid cancer (considering all subjects) was 55% (49 of 89). As shown in Fig. 1Go, the highest frequency was found in post-Chernobyl children (76%) and was significantly higher (P = 0.02, by X2) when compared with the group of Italian children not exposed to radiation (40%) and when compared with all the others groups combined (P = 0.02, by {chi}2). However, when the post-Chernobyl-positive cases were separately compared with the two groups of adults (exposed or not exposed to radiation) no significant difference was found. In particular, no difference was found between post-Chernobyl-positive cases and the group of adults exposed to external radiation (52.9%), between samples from irradiated (external x-ray) or not irradiated adult patients (52.9% vs. 50%, respectively), and between children and adults with naturally occurring, not irradiated, thyroid cancer (40.0% vs. 50%, respectively).



View larger version (32K):
[in this window]
[in a new window]
 
Figure 1. Frequency of RET/PTC rearrangements in radiation-induced (post-Chernobyl and external irradiated) and naturally occurring papillary thyroid carcinomas, in children and adults. The post-Chernobyl cases are from Belarus, the others groups are from Italy.

 
When analyzing the type of RET/PTC rearrangement (Table 4Go), no major difference was apparent. Compared with RET/PTC1, RET/PTC3 rearrangement was slightly more frequent in all groups but the one of naturally occurring childhood tumors. The occurrence of tumors characterized by the expression of the TK domain, without the EC domain of RET (RET/PTCX) was found in 8 cases (9.1%). Six of them were found among post-Chernobyl tumors including four of six children who were in uterus at the time of radiation exposure. Representative cases of RET/PTC rearrangements in post-Chernobyl tumors are shown in Fig. 2Go.


View this table:
[in this window]
[in a new window]
 
Table 4. RET/PTC rearrangements in irradiated (post-Chernobyl Belarus children and Italian adults exposed to external radiations) and naturally occurring (Italian children and adults) papillary thyroid carcinomas

 


View larger version (78K):
[in this window]
[in a new window]
 
Figure 2. Representative cases of RET/PTC rearrangements in post-Chernobyl papillary thyroid tumors (lanes 3–12) and negative and positive controls (lanes 1 and 2); the samples in lanes 4–8 are rearranged only for RET/PTC3, sample 12 only for RET/PTC1, 9 and 11 for both RET/PTC1 and RET/PTC3. Sample 10 (RET/PTCX), expressing the TK domain but not the EC fragment of RET, is neither RET/PTC1 and RET/PTC3.

 
Three papillary thyroid carcinomas (two in post-Chernobyl children and one in an adult subject with naturally occurring tumor) showed the simultaneous presence of RET/PTC1 and RET/PTC3 rearrangements. The two rearrangements showed different levels of expression when compared with the expression of c-N-Ras (semiquantitative analysis), suggesting that each rearrangement was in a distinct subpopulation of neoplastic cells (polyclonal pattern).

No significant correlation was observed between the frequency and/or the type of RET/PTC rearrangement and clinical-epidemiological features of the patients such as age at diagnosis, age at exposure, histological variant, gender and tumor-node-metastasis (TNM) categories.

RET/PTC in benign thyroid nodules

RET/PTC rearrangements were found in 29.2% (19 of 65) of benign nodules. As shown in Fig. 3Go, RET/PTC rearrangements were found in 52.4% of post-Chernobyl benign nodules, in 37.5% of benign nodules exposed to external radiation and in 13.9% of naturally occurring nodules. The difference between benign post-Chernobyl nodules and naturally occurring nodules was significant (P = 0.005 by X2), whereas no difference was found between external irradiated nodules and naturally occurring nodules. This last result may be due to the quite small number (n = 8) of patients with benign nodules exposed to external radiation.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Frequency of RET/PTC rearrangements in irradiated (post-Chernobyl and external irradiated) and not irradiated benign thyroid neoplasm. The post-Chernobyl cases are from Belarus, the others groups are from Italy.

 
The relative frequency of RET/PTC1 and RET/PTC3 in rearranged tumors showed no major difference (Table 5Go). A few cases of RET/PTCX were found in benign nodules both exposed and not exposed to external radiation. Two cases of simultaneous expression of RET/PTC1 and RET/PTC3 were found in post-Chernobyl benign nodules.


View this table:
[in this window]
[in a new window]
 
Table 5. RET/PTC rearrangements in irradiated and naturally occurring benign nodular thyroid disease

 
Discussion

In this study, we analyzed the frequency and type of RET/PTC rearrangements in a series of irradiated or not irradiated benign (n = 65) and malignant (n = 89) thyroid nodules in relation to the type of irradiation (external vs. internal), age at diagnosis, histology and gender. One by one, these variables have been analyzed in previous reports. The present study differs from the others because, for the first time, all the patients categories have been investigated in the same laboratory, using the same methodology.

According to the current opinion based on the available literature, RET/PTC rearrangements seem to be related to papillary thyroid carcinoma (28), radiation exposure (13, 23, 24, 25), and young age (26).

This assumption is not supported by the present study; in fact, in our series RET/PTC rearrangements were not restricted to papillary thyroid cancer. A relatively high frequency of RET/PTC rearrangements was also found in benign nodular thyroid diseases of patients exposed to post-Chernobyl fallout (52.4%) or external radiation (37.5%), and, albeit less frequently, in patients with benign nodules not exposed to radiation (13.9%). While no RET/PTC rearrangements in benign thyroid lesions have been found by Santoro et al. (28) and Thomas et al. (27), RET mutations have been found by Bounacer et al. (13) in irradiated benign thyroid nodules of French patients and by Ishizaka et al. (14) in sporadic follicular adenomas. Among other possibilities, the occurrence of RET/PTC rearrangements in benign nodules might be explained by the presence of microfoci of papillary thyroid carcinoma, or even of few neoplastic cells within the benign tumor, not easily detectable by histology. This possibility is in keeping with the high frequency of RET/PTC rearrangements found in papillary microcarcinomas: 42.3% in an Italian series (29) and 77% in a Canadian series (30). An alternative explanation is that RET/PTC rearrangement is an early genetic event favoring the transition from benign to malignant phenotype.

In the present study, the effect of post-Chernobyl and external radiation has been compared in children and adults with benign and malignant thyroid lesions. No significant differences have been found in the frequency of RET/PTC rearrangements in both malignant and benign tumors of our series, indicating that these changes are not related to the modality of irradiation. When radiation-induced and naturally occurring thyroid carcinomas have been compared in adults and children, a significantly higher frequency of RET/PTC rearrangements has been only found in Belarus children with respect to Italian children. At variance with our data, no difference has been found by Nikiforov et al. (25) when comparing the frequency of RET/PTC rearrangements in Belarus children with post-Chernobyl cancer and naturally occurring American childhood tumors. The question of whether this difference could be due to different ethnic background is difficult to solve because the lack of the appropriate control (i.e. Belarus children with naturally occurring papillary thyroid carcinoma) in both studies, prevents the possibility to answer this question. It is worth noting that reported frequencies of RET/PTC rearrangements in sporadic papillary thyroid cancer vary widely among different countries, ranging from as low as 2.5% in Saudi Arabia to 59% in the United Kingdom (31, 32, 33, 34, 35, 36, 37, 38, 39).

Age has been advocated as a factor favoring the development of RET/PTC rearrangements. In this respect, it is of interest that when adults and children with naturally occurring papillary thyroid cancer were compared within the same country no significant difference in the frequency of RET/PTC rearrangements has been found in United Kingdom (36) and Japan (40) series as well as in the present study. Moreover, no difference has been reported by Smida et al. (41) between Belarus children and adults with post-Chernobyl thyroid cancer. All together, these data strongly suggest that age does not play a major role in the occurrence of RET/PTC-positive papillary thyroid cancer and indirectly support the relevance of the ethnic role.

A relative higher frequency of RET/PTC3 with respect to RET/PTC1 has been reported in post-Chernobyl thyroid cancer in earlier studies from this (23) and other laboratories (24, 25). In the present study the frequency of RET/PTC3 rearrangements was not different from that of RET/PTC1 in benign and malignant tumors of both children and adults, irrespective of whether irradiated or not irradiated. However, when cumulating the solid and follicular histological variants a prevalence of RET/PTC3 was found in post-Chernobyl tumors.

As in other series (38, 39), we found the concomitant expression of both RET/PTC1 and RET/PTC3 in the same tissue in a significant proportion of cases. Among other possibilities, this finding can be explained by the occurrence of radiation-induced paracentric inversion in both chromosomes 10 of a single cell giving rise to RET/PTC1 in one chromosome and RET/PTC3 in the other one. Alternatively radiations may induce RET/PTC1 and RET/PTC3 tumors in the same gland resulting in a polyclonal thyroid neoplasm. Based on the different quantitative expression of the two rearrangements in the same tumor, the last possibility might be favored. However, the differential expression of RET/PTC1 and RET/PTC3 can also be explained by chromosome 10 inversion in a single cell when RET/PTC1 and RET/PTC3 transcription is driven by different promoters, H4 and ELE1 respectively, with different activities.

As in other series (24, 25) we found several cases of RET/PTCX. The precise nature of these changes requires further studies, but it is interesting to note that in the present series most of the cases of RET/PTCX were found in thyroid tumors of children exposed while in uterus.

In conclusion, our results indicate that the presence of RET/PTC rearrangements in thyroid tumors is not restricted to the malignant phenotype, is not higher in radiation-induced tumors compared with those naturally occurring, is not different after exposure to radioiodine or external radiation and is not dependent from young age. Other factors, probably influenced by ethnic or genetic background, may act independently from or in cooperation with radiations, to trigger the DNA damage leading to RET proto-oncogene activation.

Footnotes

1 Supported in part by a grant from European Communities: INCO-Copernicus Project (IC15-CT980314) and MURST (ex 40%) 2000. Back

Received December 27, 2000.

Revised March 9, 2001.

Accepted March 27, 2001.

References

  1. Fusco A, Grieco M, Santoro M, et al. 1987 A new oncogene in human thyroid papillary thyroid carcinomas and their lymp-nodal metastases. Nature. 328:170–172.[CrossRef][Medline]
  2. Grieco M, Santoro M, Berlingieri MT, et al. 1990 PTC is a novel rearranged form of the Ret proto-oncogene and is frequently detected in vivo in human thyroid papillary carcinoma. Cell. 60:557–663.[CrossRef][Medline]
  3. Santoro M, Melillo RM, Berlingieri MT, Grieco M, Vecchio G, Fusco A. 1993 The TRK and RET tyrosine-kinase oncogenes cooperate with ras in the neoplastic transformation of rat thyroid epithelial cell line. Cell Growth Difffer. 4:77–84.
  4. Grieco M, Cerrato A, Santoro M, Fusco A, Melillo RM, Vecchio G. 1994 Cloning and characterization of H$ (D10S170), a gene involved in Ret rearrangements in vivo. Oncogene. 9:2531–2535.[Medline]
  5. Pierotti MA, Santoro M, Jenkins RB, et al. 1992 Characterization of an inversion on the long arm of chromosome 10 juxtaposes D10S170 and ret and creating the oncogenic sequence Ret/PTC. Proc Natl Acad Sci USA. 89:1616–1620.[Abstract/Free Full Text]
  6. Bongarzone I, Monzini N, Borrello MG, et al. 1993 Molecular characterization of a thyroid tumor-specific transforming sequence formed by the fusion of Ret tyrosine kinase and the regulatory subunit RI {alpha} of cyclic AMP-dependent protein kinase A. Mol Cell Biol. 13:358–366.[Abstract/Free Full Text]
  7. Jhiang SM, Smanik PA, Mazzaferri EL. 1994 Development of single step duplex in vivo Ret activation in human papillary thyroid carcinoma. Cancer Lett. 78:69–76.[CrossRef][Medline]
  8. Klugbauer S, Demidchik EP, Lengfelder E, Rabes HM. 1997 Detection of a novel type of RET rearrangement (PTC5) in thyroid carcinomas after Chernobyl and analysis of the involved RET-fused gene RFG5. Cancer Res. 58:198–203.[Abstract/Free Full Text]
  9. Klugbauer S, Rabes HM. 1999 The transcription coactivator HTIF1 and a related protein are fused to the RET receptor tyrosine kinase in childhood papillary thyroid carcinomas. Oncogene. 18:4388–4393.[CrossRef][Medline]
  10. Nakata T, Kitamura Y, Shimuzu K, et al. 1999 Fusion of a novel gene, ELKS, to RET due to translocation t(10;12)(q11;p13) in a papillary thyroid carcinoma. Genes Chromosomes Cancer. 25:97–103.[CrossRef][Medline]
  11. Santoro M, Carlomagno F, Melillo RM, Billaud M, Vecchio G, Fusco A. 1999 Molecular mechanisms of RET activation in human neoplasia. J Endocrinol Invest. 22:811–819.[Medline]
  12. Pacini F, Elisei R, Romei C, Pinchera A. 2000 RET/PTC rearrangements in thyroid carcinoma: clinical relevance. J Endocrinol Invest. 23:328–338.[Medline]
  13. Bounacer A, Wicker R, Caillou B, et al. 1997 High prevalence of activating ret proto-oncogene rearrangements in thyroid tumors from patients who had received external radiation. Oncogene. 15:1263–1273.[CrossRef][Medline]
  14. Ishizaka Y, Kobayashi S, Ushijima T, Hirohaschi S, Sugimura T, Nagao M. 1991 Detection of RET/PTC transcripts in thyroid adenomas and adenomatous goiter by an RT-PCR method. Oncogene. 6:1667–1672.[Medline]
  15. Refetoff S, Harrison J, Karanfilski BT, Kaplan EL, DeGroot LJ, Bekerman C. 1975 Continuing occurrence of thyroid carcinoma after irradiation to the neck in infancy and childhood. N Engl J Med. 292:171–177.[Medline]
  16. Ron E, Lubin JH, Shore RE, et al. 1995 Thyroid cancer after exposure to external radiation: a pooled analysis of seven studies. Radiat Res. 141:259–277.[Medline]
  17. Baverstock K, Egloff B, Pinchera A, Ruchti C, Williams D. 1992 Thyroid cancer after Chernobyl. Nature. 359:21–22.[Medline]
  18. Kazakov VS, Demidchik EP, Astakhova LN. 1992 Thyroid cancer after Chernobyl. Nature. 359:21.
  19. Pacini F, Vorontsova T, Demidchik EP, et al. 1997 Post-Chernobyl thyroid carcinoma in Belarus children and adolescents: comparison with naturally occurring thyroid carcinoma in Italy and France. J Clin Endocrinol Metab. 82:3563–3569.[Abstract/Free Full Text]
  20. Mizuno T, Iwamoto KS, Kyoizumi S, et al. 2000 Preferential induction of RET/PTC1 rearrangements by X-ray irradiation. Oncogene. 19:438–443.[CrossRef][Medline]
  21. Nikiforov YE, Koshoffer A, Nikiforova M, Stringer J, Fagin JA. 1999 Chromosomal break point positions suggest a direct role for radiation in inducing illegitimate recombination between the ELE 1 and RET genes in radiation induced thyroid carcinomas. Oncogene. 18:6330–6334.[CrossRef][Medline]
  22. Nikiforov MN, Stringer JR, Blough R, Medvedovic M, Fagin JA, Nikiforov JE. 2000 Proximity of chromosomal loci that participate in radiation-induced rearrangements in human cells. Science. 290:138–141.[Abstract/Free Full Text]
  23. Fugazzola L, Pilotti S, Pinchera A, et al. 1995 Oncogenic rearrangements of the Ret proto-oncogene in papillary thyroid carcinomas from children exposed to the Chernobyl nuclear accident. Cancer Res. 55:5617–5620.[Abstract/Free Full Text]
  24. Klugbauer S, Lengfelder E, Demidchik EP, Rabes HM. 1995 High prevalence of RET rearrangement in thyroid tumors of children from Belarus after Chernobyl reactor accident. Oncogene. 11:2459–2467.[Medline]
  25. Nikiforov YE, Rowland JM, Bove KE, Monforte-Munoz H, Fagin JA. 1997 Distinct pattern of Ret oncogene rearrangements in morphological variants of radiation-induced and sporadic thyroid papillary carcinomas in children. Cancer Res. 57:1690–1694.[Abstract/Free Full Text]
  26. Bongarzone I, Fugazzola L, Vigneri P, et al. 1996 Age-related activation of the tyrosine kinase receptor proto-oncogene ret and ntrk 1 in papillary thyroid carcinoma. J Clin Endocrinol Metab. 81:2006–2009.[Abstract]
  27. Thomas GA, Bunnell H, Cook HA, et al. 1999 High prevalence of RET/PTC rearrangements in Ukrainian and Belarussion post-Chernobyl thyroid papillary carcinomas: a strong correlation between RET/PTC3 and the solid-follicular variant. J Clin Endocrinol Metab. 84:4232–4238.[Abstract/Free Full Text]
  28. Santoro M, Carlomagno F, Hay IH, et al. 1992 Ret oncogene activation in human thyroid neoplasm is restricted to the papillary cancer subtype. J Clin Invest. 89:1517–1522.
  29. Viglietto G, Chiappetta G, Martinez-Tello FJ, et al. 1995 RET/PTC oncogene activation is an early event in thyroid carcinogenesis. Oncogene. 11:1207–1210.[Medline]
  30. Sugg SL, Ezzat S, Rosen IB, Freeman JL, Asa SL. 1998 Distinct multiple RET/PTC gene rearrangements in multifocal papillary thyroid neoplasia. J Clin Endocrinol Metab. 83:4116–4122.[Abstract/Free Full Text]
  31. Bongarzone I, Pierotti MA, Monzini N, et al. 1994 High frequency of activation of tyrosine kinase oncogenes in human papillary thyroid carcinoma. Oncogene. 4:1457–1462.
  32. Wajjwalku W, Nakamura S, Hasegawa Y, et al. 1992 Low frequency of rearrangements of the RET and TRK proto-oncogenes in Japanese thyroid papillary carcinomas. Jpn J Cancer Res. 83:671–675.[CrossRef][Medline]
  33. Zou M, Shi Y, Farid NR. 1994 Low rate of ret proto-oncogene activation (PTC/RET) in papillary thyroid carcinomas from Saudi Arabia. Cancer. 73:176–180.[CrossRef][Medline]
  34. Jhiang SM, Caruso DR, Gilmore E, et al. 1992 Detection of the PTC/retPTC oncogene in human thyroid cancers. Oncogene. 7:1331–1337.[Medline]
  35. Mayr B, Potter E, Goretzki P, et al. 1998 Expression of Ret/PTC1, -2, -3, -{Delta}3 and -4 in Geman papillary thyroid carcinoma. Br J Cancer. 77:903–906.[Medline]
  36. Williams GH, Rooney S, Thomas GA, Cummings G, Williams ED. 1996 RET activation in adult and childhood papillary thyroid carcinoma using a reverse transcriptase-n-polymerase chain reaction approach on archivial-nested material. Br J Cancer. 74:585–589.[Medline]
  37. Lee CH, Hsu LS, Chi CW, Chen GD, Yang AH, Chen JY. 1998 High frequency of rearrangement of the ret proto-oncogene (RET/PTC) in Chinese papillary thyroid carcinomas. J Clin Endocrinol Metab. 83:1629–1632.[Abstract/Free Full Text]
  38. Fenton CL, Lucas Y, Nicholson D, Dinauer CA, Francis GL, Tuttla RM. 2000 The RET/PTC mutations are common in sporadic papillary thyroid carcinoma of children and young adults. J Clin Endocrinol Metab. 85:1170–1175.[Abstract/Free Full Text]
  39. Chua EL, Wu WM, Tran KT, et al. 2000 Prevalence and distribution of RET/PTC 1, 2 and 3 in papillary thyroid carcinoma in New Caledonian and Australia. J Clin Endocrinol Metab. 85:2733–2739.[Abstract/Free Full Text]
  40. Motomura T, Nikiforov YE, Namba H, et al. 1998 Ret rearrangements in Japanese pediatric and adult papillary thyroid cancers. Thyroid. 8:485–489.[Medline]
  41. Smida J, Salassidis K, Hieber L, et al. 1999 Distinct frequency of Ret rearrangements in papillary thyroid cancers. Thyroid. 8:485–489.
  42. Elisei R, Romei C, Soldatenko P, et al. 2000 New breakpoints in both the H4 and RET genes create a variant of PTC-1 in a post-Chernobyl papillary thyroid carcinoma. Clin Endocrinol. 53:131–136.[CrossRef][Medline]



This article has been cited by other articles:


Home page
INT J SURG PATHOLHome page
R. Flavin, G. Jackl, S. Finn, P. Smyth, M. Ring, E. O'Regan, S. Cahill, K. Unger, K. Denning, Jinghuan Li, et al.
RET/PTC Rearrangement Occurring in Primary Peritoneal Carcinoma
International Journal of Surgical Pathology, June 1, 2009; 17(3): 187 - 197.
[Abstract] [PDF]


Home page
Clin. Cancer Res.Home page
Y. C. Henderson, T. D. Shellenberger, M. D. Williams, A. K. El-Naggar, M. J. Fredrick, K. M. Cieply, and G. L. Clayman
High Rate of BRAF and RET/PTC Dual Mutations Associated with Recurrent Papillary Thyroid Carcinoma
Clin. Cancer Res., January 15, 2009; 15(2): 485 - 491.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Hamatani, H. Eguchi, R. Ito, M. Mukai, K. Takahashi, M. Taga, K. Imai, J. Cologne, M. Soda, K. Arihiro, et al.
RET/PTC Rearrangements Preferentially Occurred in Papillary Thyroid Cancer among Atomic Bomb Survivors Exposed to High Radiation Dose
Cancer Res., September 1, 2008; 68(17): 7176 - 7182.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
C. Romei, R. Ciampi, P. Faviana, L. Agate, E. Molinaro, V. Bottici, F. Basolo, P. Miccoli, F. Pacini, A. Pinchera, et al.
BRAFV600E mutation, but not RET/PTC rearrangements, is correlated with a lower expression of both thyroperoxidase and sodium iodide symporter genes in papillary thyroid cancer
Endocr. Relat. Cancer, June 1, 2008; 15(2): 511 - 520.
[Abstract] [Full Text] [PDF]


Home page
Postgrad. Med. J.Home page
A Salajegheh, E B Petcu, R A Smith, and A K-Y Lam
Follicular variant of papillary thyroid carcinoma: a diagnostic challenge for clinicians and pathologists
Postgrad. Med. J., February 1, 2008; 84(988): 78 - 82.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
G. Riesco-Eizaguirre and P. Santisteban
New insights in thyroid follicular cell biology and its impact in thyroid cancer therapy
Endocr. Relat. Cancer, December 1, 2007; 14(4): 957 - 977.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
Z. W Baloch and V. A LiVolsi
Our approach to follicular-patterned lesions of the thyroid
J. Clin. Pathol., March 1, 2007; 60(3): 244 - 250.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Z. Zhu, R. Ciampi, M. N. Nikiforova, M. Gandhi, and Y. E. Nikiforov
Prevalence of RET/PTC Rearrangements in Thyroid Papillary Carcinomas: Effects of the Detection Methods and Genetic Heterogeneity
J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3603 - 3610.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L Fugazzola, E Puxeddu, N Avenia, C Romei, V Cirello, A Cavaliere, P Faviana, D Mannavola, S Moretti, S Rossi, et al.
Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature.
Endocr. Relat. Cancer, June 1, 2006; 13(2): 455 - 464.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. E. Nikiforov
RET/PTC Rearrangement--A Link between Hashimoto's Thyroiditis and Thyroid Cancer...or Not
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2040 - 2042.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
K. J. Rhoden, K. Unger, G. Salvatore, Y. Yilmaz, V. Vovk, G. Chiappetta, M. B. Qumsiyeh, J. L. Rothstein, A. Fusco, M. Santoro, et al.
RET/Papillary Thyroid Cancer Rearrangement in Nonneoplastic Thyrocytes: Follicular Cells of Hashimoto's Thyroiditis Share Low-Level Recombination Events with a Subset of Papillary Carcinoma
J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2414 - 2423.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
B Jarzab, D Handkiewicz-Junak, and J Wloch
Juvenile differentiated thyroid carcinoma and the role of radioiodine in its treatment: a qualitative review
Endocr. Relat. Cancer, December 1, 2005; 12(4): 773 - 803.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
S. J. Marx and W. F. Simonds
Hereditary Hormone Excess: Genes, Molecular Pathways, and Syndromes
Endocr. Rev., August 1, 2005; 26(5): 615 - 661.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
M Xing
BRAF mutation in thyroid cancer
Endocr. Relat. Cancer, June 1, 2005; 12(2): 245 - 262.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
J Di Cristofaro, V Vasko, V Savchenko, S Cherenko, A Larin, M D Ringel, M Saji, M Marcy, J F Henry, P Carayon, et al.
ret/PTC1 and ret/PTC3 in thyroid tumors from Chernobyl liquidators: comparison with sporadic tumors from Ukrainian and French patients
Endocr. Relat. Cancer, March 1, 2005; 12(1): 173 - 183.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Elisei, B. Cosci, C. Romei, V. Bottici, M. Sculli, R. Lari, R. Barale, F. Pacini, and A. Pinchera
RET Exon 11 (G691S) Polymorphism Is Significantly More Frequent in Sporadic Medullary Thyroid Carcinoma Than in the General Population
J. Clin. Endocrinol. Metab., July 1, 2004; 89(7): 3579 - 3584.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Xing, R. P. Tufano, A. P. Tufaro, S. Basaria, M. Ewertz, E. Rosenbaum, P. J. Byrne, J. Wang, D. Sidransky, and P. W. Ladenson
Detection of BRAF Mutation on Fine Needle Aspiration Biopsy Specimens: A New Diagnostic Tool for Papillary Thyroid Cancer
J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2867 - 2872.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Sadetzki, R. Calderon-Margalit, B. Modan, S. Srivastava, and R. M. Tuttle
Ret/PTC Activation in Benign and Malignant Thyroid Tumors Arising in a Population Exposed to Low-Dose External-Beam Irradiation in Childhood
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2281 - 2289.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Puxeddu, S. Moretti, R. Elisei, C. Romei, R. Pascucci, M. Martinelli, C. Marino, N. Avenia, E. D. Rossi, G. Fadda, et al.
BRAFV599E Mutation Is the Leading Genetic Event in Adult Sporadic Papillary Thyroid Carcinomas
J. Clin. Endocrinol. Metab., May 1, 2004; 89(5): 2414 - 2420.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Vivaldi, F. Pacini, F. Martini, L. Iaccheri, F. Pezzetti, R. Elisei, A. Pinchera, P. Faviana, F. Basolo, and M. Tognon
Simian Virus 40-Like Sequences from Early and Late Regions in Human Thyroid Tumors of Different Histotypes
J. Clin. Endocrinol. Metab., February 1, 2003; 88(2): 892 - 899.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. J. Collins, G. Chiappetta, A. B. Schneider, M. Santoro, F. Pentimalli, L. Fogelfeld, T. Gierlowski, E. Shore-Freedman, G. Jaffe, and A. Fusco
RET Expression in Papillary Thyroid Cancer from Patients Irradiated in Childhood for Benign Conditions
J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3941 - 3946.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Fusco, G. Chiappetta, P. Hui, G. Garcia-Rostan, L. Golden, B. K. Kinder, D. A. Dillon, A. Giuliano, A. M. Cirafici, M. Santoro, et al.
Assessment of RET/PTC Oncogene Activation and Clonality in Thyroid Nodules with Incomplete Morphological Evidence of Papillary Carcinoma : A Search for the Early Precursors of Papillary Cancer
Am. J. Pathol., June 1, 2002; 160(6): 2157 - 2167.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Elisei, R.
Right arrow Articles by Pacini, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Elisei, R.
Right arrow Articles by Pacini, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals