| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Endocrine Care |
Neuroendocrine Unit (D.C.D., J.N.S.H., X.Z., L.K., A.K.), Massachusetts General Hospital and Harvard Medical School, Boston Massachusetts 02114; and Biomeasure, Inc. (M.D.C.), Milford, Massachusetts 01757
Address all correspondence and requests for reprints to: Anne Klibanski, M.D., Neuroendocrine Unit, Bulfinch 457B, Massachusetts General Hospital, Boston, Massachusetts 02114.
Abstract
Somatostatin (SST) acts through a family of seven transmembrane domain G protein-coupled receptors to inhibit hormone secretion and cell proliferation in a variety of neuroendocrine tissues. In normal and neoplastic human pituitary somatotroph cells, SST-specific receptor types (SSTR) 1, 2, 3, and 5 are prevalently expressed, and SST and its analogs have been shown to inhibit GH secretion. However, in somatotroph adenomas, little is known regarding: 1) effects of SST and its analogs on pituitary tumor proliferation; 2) the relationship between the effects of SST analogs on GH secretion and tumor cell proliferation; and 3) whether SSTR expression predicts the antiproliferative effects of SST analogs in human somatotroph tumors.
We investigated the effects of SST-14, lanreotide, and SSTR 2 (BIM-23190) and SSTR 5 (BIM-23268) specific analogs in 18 somatotroph pituitary adenomas in primary culture. Our results showed that cell proliferation was significantly inhibited by SST-14, lanreotide, BIM-23190, and BIM-23268 in 4, 7, 3, and 4 tumors, respectively (range of proliferation suppression 5–60%; median, 16%). Tumors that were responsive to SSTR 2- and 5-specific analogs were also responsive to lanreotide. SST-14 inhibited GH secretion in 8 of 13 tumors; lanreotide, BIM-23190, and BIM-23268 inhibited GH secretion in six tumors each (range of GH secretion inhibition 23–43%; median 33%). SSTR 2 and 5 messenger RNA was expressed in all tumors investigated, whereas SSTR 1 and 3 messenger RNA was expressed in 11 and 12 tumors, respectively. We observed a dissociation between the in vitro effects of SST-14 or lanreotide on tumor cell proliferation and the effects on GH secretion in human somatotroph tumors. Although differences in receptor concentration and the presence of other SST receptor subtypes may play a role, the presence of SSTR 2 and/or 5 did not have a predictive value. These data suggest that inhibition of cell proliferation occurs independently of effects on GH secretory pathways. Further studies are needed to clarify the mechanism of SST induced antiproliferative effects.
GROWTH HORMONE, secreted by somatotroph cells, is the major regulator of postnatal growth via modulation of gene transcription and intermediary and liver-specific metabolic effects. Acromegaly is a chronic, debilitating disorder and, in the majority of cases, is caused by GH hypersecretion from a pituitary somatotroph adenoma. The current approved therapeutic options for acromegalic patients are limited (1). Transsphenoidal surgery is the most common primary therapy used, and patients with macroadenomas are often not cured (2). Although radiotherapy can be used to treat residual tumor, it takes years to effectively lower GH levels and may result in hypopituitarism. Adjuvant medical management with somatostatin (SST) or its analogs results in reduction of GH secretion and normalization of insulin-like growth factor (IGF)-I levels in about 50–60% cases (3, 4, 5, 6). Therefore, the development of SST analogs has been an important advance for the medical management of acromegaly.
SST inhibits hormone secretion and cell proliferation in a variety of neuroendocrine tissues (7). The actions of SST are mediated through a family of seven transmembrane domain G protein-coupled receptors (7). In normal and neoplastic human pituitary somatotroph cells, SST-specific receptor types (SSTR) 1, 2, 3, and 5 are prevalently expressed (8, 9, 10). Administration of native SST or SST analogs results in a reduction in GH secretion from normal and neoplastic pituitary somatotroph cells (8, 11, 12), and these GH secretory effects of SST analogs may correlate with the expression of SSTR 2 (7, 13). Administration of SST analogs to patients with somatotroph adenomas may also result in a partial reduction in tumor mass, although changes in tumor size are highly variable and usually modest (1, 14, 15, 16). SST has been shown to have antiproliferative effects in a subset of human tumors (17, 18, 19, 20). Although recent studies suggest that SSTR-selective agonists may have differential effects on GH secretion (21), there are no previous data on the effects of these analogs on proliferation of human somatotroph tumors in vitro. The recent advances in the identification of SSTR-specific analogs permit the study of the role of individual receptor subtypes in regulating cell proliferation.
We therefore investigated the effects of SST-14, lanreotide, and SSTR 2- and 5-specific analogs on cell proliferation in human somatotroph adenomas in primary culture to determine: 1) the effects of SST and its analogs on pituitary tumor proliferation; 2) the relationship between the effects of SST analogs on GH secretion and tumor cell proliferation; and 3) whether SSTR expression predicts the antiproliferative effects of SST analogs in human somatotroph tumors.
Materials and Methods
Tumor tissue was obtained from 18 patients diagnosed with acromegaly, based on the presence of classic clinical features, with biochemical confirmation including the lack of serum GH suppression to less than 1 µg/L during an oral glucose tolerance test and/or an elevated serum IGF-I level for age (1). All tumors were macroadenomas. During transsphenoidal surgery, tumor tissue was placed in 0.9% saline, and a fragment was snap frozen in liquid nitrogen for RNA analysis. The remainder of the tumor was used for primary tumor cell culture studies as described below. Clinical data with regard to the response of serum IGF-I to treatment with SST analogs were obtained when available. Evidence of tumor in vivo responsiveness to medical treatment was defined as normalization of serum IGF-I levels. Treatment with SST analogs was stopped before surgery in all patients for approximately 1 week with the exception of patient 4, who received octreotide 250 µg tid during the perioperative period. Patients who received SST analogs before surgery and had decreased GH secretion with this treatment underwent surgery for decompression of the optic chiasm. One patient (no. 3) could not tolerate the treatment because of gastrointestinal side effects. This study was approved by the Subcommittee on Human Studies of Massachusetts General Hospital.
Primary somatotroph adenoma cell cultures
Effects of SST and its analogs on cell proliferation and GH secretion were studied in primary pituitary cell cultures. Mechanic and enzymatic dispersion of the tumor fragments and tumor cell culture were performed as previously described (22). After overnight incubation, SST analogs were added in fresh medium. SST-14, lanreotide, BIM-23268 (A5, SSTR 5-selective analog), and BIM-23190 (A2, SSTR 2-selective analog) were provided by Biomeasure Inc. (Milford, MA). The structure and specific binding affinities of the compounds for the different human SSTRs have been reported previously (21). For time course experiments, cells were treated with lanreotide at 1 µM for 24, 48, 72, and 96 h. For dose-response experiments, cells were treated with 0.01, 0.1, and 1 µM of each SST analog for 24 h. In our studies with short-term pituitary primary cell cultures, the possibility of fibroblast contamination influencing pituitary tumor cell proliferation data were excluded after each experiment by examining the morphology of the cultured cells for fibroblast contamination, as described previously (22).
Tumor cell proliferation and GH secretion assays
The number of viable cells following treatment with SST analogs was assessed using the Cell Titer 96AQueous One solution cell proliferation assay (MTS assay, Promega Corp., Madison, WI) as described previously (23). Tumor cells were plated in triplicate in 12-well plates at 5 x 104 cells per well in triplicate wells. After treatment, Cell Titer 96AQueous One solution was added to each well for 90 min, and the light absorbance at 490 nm was recorded using a spectrophotometer. In five tumors (1, 2, 16, 17, 18) and rat somatotroph GH3 cells, we compared the effects of SST analog treatment on cell proliferation measured by the colorimetric assay to that measured by the [3H]-thymidine incorporation (an assay for DNA synthesis as a measure of dividing cells) (22, 24).
Following treatment with SST analogs for 24 h, conditioned medium was collected for the measurement of human GH levels by RIA (Nicholas Institute Diagnostics, San Juan Capistrano, CA) in duplicate after appropriate sample dilutions.
RT-PCR
Total RNA from 15 tumor specimens (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15) was extracted with
Trizol reagent (Life Technologies, Inc., Gaithersburg, MD)
and comparative RT-PCR was performed as described previously (22, 25, 26). We used the following sets of primers, described in
5'-3' sequence: SSTR 1, cgaaatgctccagaacgg, and ggtttactaccttggccacg,
SSTR 4, atcgccatcttcgcagacac and gtaggggaagggctcctc; SSTR 2, SSTR 3,
SSTR 5, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
primers were previously described (8, 27). As a positive
control, we included in each reaction complementary DNA from a tumor
previously demonstrated to express SSTR (8). Because SSTR
type 4 messenger RNA (mRNA) has not been detected in human somatotroph
adenomas (8), we included human genomic DNA as a positive
control for these PCR reactions. A negative control with no template
was used to exclude cross-contamination. Reactions were preformed in
the presence of [
-32P] dCTP (100
nCi/reaction), and products were resolved by electrophoresis on a 6%
nondenaturing TBE/polyacrylamide gel and visualized by autoradiography
onto XO-Mat film (Kodak, Rochester, NY) for 2–48
h. The PCR products were sequenced to confirm identities. The amount of
amplification products was compared between samples in parallel with an
equal amount of GAPDH products, as described previously (22, 28, 29).
Statistical analysis
Results are expressed as percent of the control untreated cells, as mean ± SEM. Statistical significance was tested using the two-sample equal variance Student’s t test, and P values less than 0.05 were considered significant.
Results
Clinical characteristics
The clinical characteristics of the 18 patients included in our
study, including serum IGF-I and PRL levels and the in vivo
response to medical treatment, are summarized in Table 1
. The ages of the patients ranged from
24 to 78 yr, median 41 yr. Seven of the 18 patients were treated
in vivo with SST analogs. In four of these seven cases
(patients 4, 5, 6, and 9), medical management with SST analogs
lanreotide or octreotide resulted in a reduction in serum IGF-I levels
into the normal range. In three patients (3, 7, 11), administration
of SST analogs did not result in normalization of serum IGF-I
levels.
|
We assessed proliferation with SST analog treatment using
two techniques, MTS colorimetric assay (Promega Corp.) and
a [3H]-thymidine incorporation assay, in
parallel, in five tumors and GH3 cells. Tumor cell proliferation
responses after 24-h treatment with SST-14 and/or lanreotide (1
µM) in these five tumors are presented in Table 2. There was a significant decrease
(P < 0.05) in proliferation in tumor cells exposed to
SST-14 and/or lanreotide, compared with untreated cells, using the MTS
assay (Promega Corp.) in two tumors (1, 16), whereas in
three tumors (2, 17, 18), exposure to SST-14 and/or lanreotide did
not inhibit cell proliferation. Using the
[3H]-thymidine incorporation assay, SST analog
administration decreased DNA synthesis in the same two tumors (1, 16),but not in the other three tumors (2, 17, 18). Lanreotide and
the A2 and A5 analogs significantly decreased cell proliferation in GH3
cells as measured by both methods. Comparisons between the MTS assay
(left) and [3H]-thymidine
incorporation assay (right) in one responsive tumor (Fig. 1A, tumor 16) and one nonresponsive tumor
(Fig. 1B, tumor 18) after treatment with SST analogs are shown in Fig. 1. GH3 cell proliferation data after treatment with lanreotide and A2
and A5 analogs (1 µM) as measured by both MTS
(Promega Corp.) and [3H]-thymidine
assays are shown in Fig. 1C. These data indicate a direct correlation
between thymidine incorporation and MTS assays for assessing
proliferative responses.
|
|
SST analog effects on cell proliferation after treatment for 24 h
in all tumors are summarized in Table 3.
The percent suppression of cell proliferation during SST analogs
treatment (1 µM) in the responsive tumors ranged between
5% and 60% (median 16%). In two tumors (9, 10), there was a
decrease in cell proliferation following lanreotide and the A2 and A5
analog treatment, despite lack of response to SST-14. There was no
significant increase in cell proliferation in response to SST analogs
in any tumor. Inhibition of cell proliferation with SST, lanreotide,
A2, and A5 treatment for 24 h at a final concentration of 1
µM in tumor 10 is shown in Fig. 2A (open bars). Similar
treatment did not inhibit tumor cell growth in tumor 5 (Fig. 2B). In
contrast, SST-14 and lanreotide, but not A2 or A5 analogs, inhibited
cell proliferation in tumor 3 (Fig. 2C).
|
|
The effects of SST analogs on GH secretion in vitro
were first assessed in a dose titration experiment to determine the
optimum treatment dose. There was a significant reduction in GH
secretion following 24 h exposure to each analog at doses of 0.01, 0.1,
and 1 µM (data not shown). Because of tissue
limitation, we used a single dose (1 µM) of
each analog for subsequent experiments. The effects of SST-14,
lanreotide, and SSTR-specific analogs on GH secretion are shown in
Table 3
. In eight (62%) tumors, administration of SST-14 resulted in a
significant decrease in GH secretion. Similarly, lanreotide, A2, and A5
administration significantly decreased GH secretion in six tumors each.
In responsive tumors, the range of suppression of GH secretion was
23–43% (median 33%). Tumor GH secretion did not increase following
exposure to SST analogs. As shown in Fig. 2, A and B, administration of
each SST analog led to a decrease in GH secretion in tumors 10 and 5,
respectively. However, similar treatment did not inhibit GH secretion
in tumor 3 (Fig. 2C). In one lanreotide unresponsive tumor (no. 15), A2
and A5 analogs decreased GH secretion (Table 3).
SST-specific receptor mRNA expression
As shown in Fig. 3, SSTR types 2 and
5 mRNAs were expressed in all 15 tumors analyzed by RT-PCR, whereas
types 1 and 3 were expressed in 11 and 12 tumors, respectively. SSTR 4
mRNA was not expressed in any somatotroph tumor. In three tumors (4, 7, 10), SSTR type 3 mRNA was not detected. In contrast, in three
tumors (9, 11, 15) decreased levels of SSTR 3 mRNA, compared with
similar levels of GAPDH mRNA expression, were found.
|
As shown in Table 3, there were four tumors (4, 5, 8, 15) with
SST analog-induced antisecretory effects, without antiproliferative
effects. In one tumor (no. 3), SST-14 administration was associated
with antiproliferative effects, without antisecretory effects. In tumor
6, lanreotide, A2, and A5 each had antiproliferative effects without
antisecretory effects. There was no correlation of SSTR 2 or 5 mRNA
expression with secretory or proliferative responses. In two tumors ( 9
and 10), lanreotide administration had an antiproliferative effect,
whereas SST-14 did not. In these two tumors, SSTR 3 mRNA was expressed
at decreased levels (Fig. 3).
In the four subjects with normalization of serum IGF-I levels following octreotide administration in vivo (4, 5, 6, 9), there were antisecretory responses to SST-14 in all four and antisecretory responses to lanreotide in three in vitro. Lanreotide inhibited proliferation in vitro in tumors 6 and 9. In the three tumors (3, 7, 11) resistant to octreotide therapy in vivo, there was no change in GH secretion following administration of SST-14, lanreotide, A2, or A5 in vitro.
Discussion
We have shown that SST-14, lanreotide, SSTR type 2- specific analog BIM-23190, and SSTR type 5-specific analog BIM-23268 have an inhibitory effect on tumor cell proliferation in a subgroup of human somatotroph adenomas in vitro. These are the first data that demonstrate the dissociation between the in vitro effects of SST-14 or lanreotide on tumor cell proliferation and the effects on GH secretion in human somatotroph tumors. Although we could not demonstrate a predictive value of the presence of SSTR 2 and/or 5 on tumor responsiveness, differences in receptor concentration analyzed quantitatively (13, 30, 31) and the presence of other SST receptor subtypes may contribute to responsivity (28, 29, 30, 31). However, further studies are needed to clarify the mechanism of SST-induced antiproliferative effects.
Acromegalic patients who are not cured following surgery require adjuvant medical therapy. Medical therapies that act to arrest pituitary tumor cell growth have proven to be effective in reducing hormone secretion and tumor mass in a subset of patients with secretory tumors (1, 18, 19, 32, 33, 34, 35, 36). The development of SST analogs has greatly improved the management of acromegaly, although, for the most part, SST analogs have had only modest success at somatotroph tumor shrinkage. There is clearly a need for novel SST analogs that have more potent actions in both reducing GH secretion and in inhibiting tumor proliferation, with resultant tumor shrinkage (1, 3). In our in vitro study, SST-14 and lanreotide treatment of neoplastic somatotroph cells inhibited proliferation in 25% (4/16) and 39% (7/18) of these tumors. However, GH secretion was inhibited in 62% (8/13) and 46% (6/13) tumors by SST-14 and lanreotide, respectively. The in vitro inhibitory effect on GH secretion exhibited by the SST analogs observed in our study was closely correlated with the clinical in vivo response to SST analog treatment, as assessed by the normalization of serum IGF-I levels. However, the effects of SST analogs on tumor cell proliferation did not always correlate with similar effects on GH secretion. These in vitro data suggest that inhibition of cell proliferation may occur independent of effects on GH secretory pathways, confirming previous clinical observations of the dissociation between the effects of SST on GH secretion and tumor size in human somatotroph adenomas (37).
The recent development of potent SST-specific receptor activators provides a probe with which to study the differential activation of intracellular signaling pathways, which may mediate SST effects on target tissues (12, 38, 39, 40, 41, 42). Several of the SSTR subtypes have now been clearly demonstrated to be members of the G protein-linked family of receptors (40, 41, 42, 43). Adenylate cyclase activity, which is elevated in association with increased somatotroph cell proliferation (44), is inhibited by SST through Gi proteins (45). The activation of SSTR also affects ionic conductance channels (46), stimulates protein dephosphorylation of serine/threonine and tyrosine residues (38) as well as phospholipase C. Most importantly, SST rapidly induces Ca2+ mobilization (47), which may have potent antiproliferative effects. SST can also have indirect effects on cell growth, and its analogs have been shown to stimulate tyrosine phosphatase activity, which can antagonize the proliferative effects of various growth factors (38). In our study, SSTR type 2 and 5 analogs specifically inhibited cell proliferation and GH secretion at doses similar to lanreotide, which activates both receptors (21). However, SST-14 did not inhibit tumor cell proliferation in two tumors responsive to lanreotide treatment. This finding may be due to the decreased expression of SSTR type 3 in these tumors, although the method used in our study did not quantify precisely SSTR mRNA expression. Synergistic activation of several SSTR may also play a role in the regulation of cell proliferation and hormone secretion. Although SST-14 and lanreotide treatment inhibited tumor cell proliferation in three tumors, SSTR 2- or 5-specific analogs did not decrease cell growth in these tumors. It is possible that we may have underestimated the antiproliferative effects of the SST analogs, because of experimental limitations, including the time course of analog exposure and proliferation assay used. Nevertheless, these data demonstrate the high variability of the response in cell proliferation and GH secretion in human somatotroph tumors to treatment with SST and its analogs.
Our data suggest that SST analogs have an antiproliferative effect in a subset of human pituitary tumors. We observed a dissociation between the in vitro effects of SST-14 or lanreotide on tumor cell proliferation and the effects on GH secretion in human somatotroph tumors. The molecular mechanism of SST-induced growth arrest and the role of specific SSTR in transducing growth inhibitory signals require further studies.
Acknowledgments
We are grateful to Dr. Brooke Swearingen for his kind assistance in completing this study.
Footnotes
1 Supported in part by NIH Grant R01-DK40947 and the Jarislowsky
Foundation. 
Received June 29, 2000.
Revised February 7, 2001.
Accepted March 15, 2001.
References
This article has been cited by other articles:
 |
|
 |
|
  G. F Taboada, R. M Luque, L. V. Neto, E. d. O Machado, B. C Sbaffi, R. C Domingues, J. B Marcondes, L. M C Chimelli, R. Fontes, P. Niemeyer, et al. Quantitative analysis of somatostatin receptor subtypes (1-5) gene expression levels in somatotropinomas and correlation to in vivo hormonal and tumor volume responses to treatment with octreotide LAR Eur. J. Endocrinol., March 1, 2008; 158(3): 295 - 303. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. A. Nolan, H. A. Schmid, and A. Levy Octreotide and the Novel Multireceptor Ligand Somatostatin Receptor Agonist Pasireotide (SOM230) Block the Adrenalectomy-Induced Increase in Mitotic Activity in Male Rat Anterior Pituitary Endocrinology, June 1, 2007; 148(6): 2821 - 2827. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Resmini, P. Dadati, J.-L. Ravetti, G. Zona, R. Spaziante, A. Saveanu, P. Jaquet, M. D. Culler, F. Bianchi, A. Rebora, et al. Rapid Pituitary Tumor Shrinkage with Dissociation between Antiproliferative and Antisecretory Effects of a Long-Acting Octreotide in an Acromegalic Patient J. Clin. Endocrinol. Metab., May 1, 2007; 92(5): 1592 - 1599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Ferone, A. Saveanu, M. D Culler, M. Arvigo, A. Rebora, F. Gatto, F. Minuto, and P. Jaquet Novel chimeric somatostatin analogs: facts and perspectives Eur. J. Endocrinol., April 1, 2007; 156(suppl_1): S23 - S28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Zatelli, M. R. Ambrosio, M. Bondanelli, and E. C d. Uberti Control of pituitary adenoma cell proliferation by somatostatin analogs, dopamine agonists and novel chimeric compounds Eur. J. Endocrinol., April 1, 2007; 156(suppl_1): S29 - S35. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Zatelli, D. Piccin, C. Vignali, F. Tagliati, M. R. Ambrosio, M. Bondanelli, V. Cimino, A. Bianchi, H. A Schmid, M. Scanarini, et al. Pasireotide, a multiple somatostatin receptor subtypes ligand, reduces cell viability in non-functioning pituitary adenomas by inhibiting vascular endothelial growth factor secretion Endocr. Relat. Cancer, March 1, 2007; 14(1): 91 - 102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. F Taboada, R. M Luque, W. Bastos, R. F C Guimaraes, J. B Marcondes, L. M C Chimelli, R. Fontes, P. J P Mata, P. N. Filho, D. P Carvalho, et al. Quantitative analysis of somatostatin receptor subtype (SSTR1-5) gene expression levels in somatotropinomas and non-functioning pituitary adenomas Eur. J. Endocrinol., January 1, 2007; 156(1): 65 - 74. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kidd, G. N Eick, I. M Modlin, R. Pfragner, M. C Champaneria, and J. Murren Further delineation of the continuous human neoplastic enterochromaffin cell line, KRJ-I, and the inhibitory effects of lanreotide and rapamycin J. Mol. Endocrinol., January 1, 2007; 38(1): 181 - 192. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Batista, X. Zhang, R. Gejman, P. J. Ansell, Y. Zhou, S. A. Johnson, B. Swearingen, E. T. Hedley-Whyte, C. A. Stratakis, and A. Klibanski The Effects of SOM230 on Cell Proliferation and Adrenocorticotropin Secretion in Human Corticotroph Pituitary Adenomas J. Clin. Endocrinol. Metab., November 1, 2006; 91(11): 4482 - 4488. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Zatelli, D. Piccin, F. Tagliati, A. Bottoni, A. Luchin, C. Vignali, A. Margutti, M. Bondanelli, G. C. Pansini, M. R. Pelizzo, et al. Selective Activation of Somatostatin Receptor Subtypes Differentially Modulates Secretion and Viability in Human Medullary Thyroid Carcinoma Primary Cultures: Potential Clinical Perspectives J. Clin. Endocrinol. Metab., June 1, 2006; 91(6): 2218 - 2224. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M C Zatelli, D Piccin, F Tagliati, A Bottoni, M R Ambrosio, A Margutti, M Scanarini, M Bondanelli, M D Culler, and E C d. Uberti Dopamine receptor subtype 2 and somatostatin receptor subtype 5 expression influences somatostatin analogs effects on human somatotroph pituitary adenomas in vitro J. Mol. Endocrinol., October 1, 2005; 35(2): 333 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Zatelli, D. Piccin, A. Bottoni, M. R. Ambrosio, A. Margutti, R. Padovani, M. Scanarini, J. E. Taylor, M. D. Culler, L. Cavazzini, et al. Evidence for Differential Effects of Selective Somatostatin Receptor Subtype Agonists on {alpha}-Subunit and Chromogranin A Secretion and on Cell Viability in Human Nonfunctioning Pituitary Adenomas in Vitro J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5181 - 5188. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Zatelli, D. Piccin, F. Tagliati, M. R. Ambrosio, A. Margutti, R. Padovani, M. Scanarini, M. D. Culler, and E. C. degli Uberti Somatostatin Receptor Subtype 1 Selective Activation in Human Growth Hormone (GH)- and Prolactin (PRL)-Secreting Pituitary Adenomas: Effects on Cell Viability, GH, and PRL Secretion J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2797 - 2802. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. U. Freda Somatostatin Analogs in Acromegaly J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3013 - 3018. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
