help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Benyo, D. F.
Right arrow Articles by Conrad, K. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Benyo, D. F.
Right arrow Articles by Conrad, K. P.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 6 2505-2512
Copyright © 2001 by The Endocrine Society


Original Articles: Hormones and Reproductive Health

Expression of Inflammatory Cytokines in Placentas from Women with Preeclampsia1

Deborah Fairchild Benyo, Alexander Smarason, Christopher W. G. Redman, Cynthia Sims and Kirk P. Conrad

Departments of Obstetrics, Gynecology, and Reproductive Sciences (D.F.B., C.S., K.P.C.) and Cell Biology and Physiology (K.P.C.), University of Pittsburgh School of Medicine, and Magee-Womens Research Institute, Pittsburgh, Pennsylvania 15213; and Nuffield Department of Obstetrics and Gynecology, University of Oxford, John Radcliffe Hospital (A.S., C.W.G.R.), Oxford, United Kingdom OX3 9DU

Address all correspondence and requests for reprints to: Dr. Kirk P. Conrad, Magee-Womens Research Institute, 204 Craft Avenue, Pittsburgh, Pennsylvania 15213. E-mail: rsikpc{at}mail.magee.edu

Abstract

It is postulated that inadequate remodeling of the uterine spiral arteries in preeclampsia leads to focal ischemia and generation of inflammatory cytokines, such as tumor necrosis factor (TNF{alpha}) and interleukins (ILs), by the placenta. Our objective was to compare TNF{alpha}, IL-1{alpha}, IL-1ß, and IL-6 levels in placentas from patients with preeclampsia and normal term pregnancies. Because the placenta is a large heterogeneous organ, we analyzed multiple sites per placenta. On the average, there was a 3-fold variation in cytokine protein levels across the eight sites analyzed for each placenta. However, there were no significant overall differences among the normal term, preeclamptic, and preterm placentas from women without preeclampsia. There were also no significant differences in TNF{alpha} messenger ribonucleic acid between the normal term and preeclamptic placentas, although TNF{alpha} messenger ribonucleic acid levels were lower in placentas from preterm patients without diagnosis of preeclampsia than in the normal term placentas. In vitro, hypoxia stimulated the production of TNF{alpha}, IL-1{alpha} and IL-1ß, but not that of IL-6, by placental villous explants from both groups of patients, and this was not exaggerated in preeclampsia. Finally, although peripheral and uterine venous levels of TNF{alpha} were elevated in preeclamptic women compared with normal term patients, the ratio of uterine to peripheral venous TNF{alpha} levels was not significantly different from 1.0 for either patient group. Taken together, these results suggest that sources other than the placenta contribute to the elevated concentrations of TNF{alpha} and IL-6 found in the circulation of preeclamptic women.

PREECLAMPSIA IS A disease of human pregnancy diagnosed by the onset of hypertension and proteinuria in the third trimester (1). Several investigators have suggested that endothelial dysfunction underlies the disease manifestations (reviewed in Ref. 2), and the etiology of preeclampsia relates to deficient physiological remodeling of uterine spiral arteries (3). Without sufficient changes in the uterine vasculature in early pregnancy, the placenta is susceptible to the development of focal regions of ischemia/hypoxia. In turn, reduced oxygen tension in the placental tissue may lead to the production and secretion of cytotoxic factors that have been postulated to affect the maternal vasculature (4). Inflammatory cytokines such as tumor necrosis factor-{alpha} (TNF{alpha}) and interleukin-1ß (IL-1ß) can produce endothelial dysfunction (5), and synthesis of these cytokines as well as IL-6 has been documented in the human placenta (6, 7, 8, 9). Further, we have shown that incubation of human placental explants under reduced oxygen conditions results in the elevated production of TNF{alpha}, IL-1{alpha}, and IL-1ß (9).

We and others (reviewed in Refs. 10 and 11) reported that circulating levels of TNF{alpha} and IL-6 are increased in women with preeclampsia. Given that the placenta produces inflammatory cytokines, some of which can be stimulated by hypoxia in vitro, our objective was to determine whether placental protein and messenger ribonucleic acid (mRNA) levels for TNF{alpha}, IL-1{alpha}, IL-1ß, and IL-6 are elevated in women with preeclampsia. Further, placental tissues from normal pregnant and preeclamptic women were incubated in 21% or 2% oxygen to determine whether there are differences in the magnitude of hypoxia-stimulated cytokine production. A final objective was to compare peripheral circulating levels of TNF{alpha} with those in the uterine vein to directly ascertain whether the uteroplacental unit contributes to the systemic elevation of inflammatory cytokines in women with preeclampsia.

Subjects and Methods

Human subjects

All placentas were obtained from women undergoing cesarian section without labor under approval of the institutional review board at Magee-Womens Hospital. Placentas from nulliparous patients with normal pregnancies were collected at term (38–41 gestational weeks). Placentas were obtained from nulliparous women with preeclampsia at 28–38 gestational weeks. The diagnosis of preeclampsia was made by strict criteria: onset of hypertension during the third trimester (>=140/90 mm Hg on two occasions), detectable urinary protein (>=1+ by dipstick or >=300 mg/24 h), and plasma uric acid levels exceeding 1 SD from the mean for gestational age (in five of six patients). For placental samples used for cytokine protein and mRNA analyses, two preeclamptic patients of less than 35 weeks gestation received ß-methasone, one of whom also had a diagnosis of HELLP syndrome (hemolysis, elevated liver enzymes, and low platelets), and two of the preeclamptic patients had growth-restricted infants. For placental samples used in explant culture, three of the six patients were less than 30 gestational weeks and received ß-methasone, and two had growth-restricted infants.

As an additional control group, six placentas were obtained from nulliparous women with preterm delivery and without preeclampsia (28–32 gestational weeks). These patients with preterm deliveries were also delivered by cesarian section (one with labor), and all neonates were of appropriate size for gestational age. Only one patient had chorioamnionitis, which was reported as mild by the perinatal pathologist.

Patients from whom uterine and peripheral venous blood samples were taken at cesarean delivery were selected in Oxford, using different criteria. All gave their written and informed consent to take part in the study, which was approved by the Central Oxford research ethics committee. Women with preeclampsia (n = 8) had clear documentation of no proteinuria earlier in pregnancy after which at least 2+ protein, as a new development, was detected using dipstick testing. Their diastolic pressures had increased from less than 90 mm Hg before 20 weeks gestational age to more than 90 mm Hg before delivery, recorded on at least two occasions. There was no restriction with regard to parity, and plasma uric acid measurements were not used as selection criteria. Normal pregnant women (n = 8) required cesarean delivery for nonurgent reasons, such as breech presentation or elective repeat cesarean delivery. They never had proteinuria, and at no time during their uncomplicated pregnancies were diastolic pressures of 90 mm Hg or more recorded. None was taking regular medications for any purpose. The cases and controls were not matched in any respect, except for delivery by cesarean section.

Collection of placental samples

Immediately after delivery of the placenta by cesarian section, samples were collected, and the total length of processing time was less than 15 min. As the placenta is a large heterogeneous organ, and sampling bias is a potential hazard (12), a square grid of 16 holes in a 4 x 4 design within a circular template was constructed to overlay the placenta. Templates of various sizes were prepared to best fit placentas of different diameters. After blotting the maternal surface of blood, a sterile nickel cork borer was inserted into each of the 16 holes (~1 cm) to obtain a full thickness biopsy (~0.5 g tissue, which excluded the chorionic plate). Each sample was briefly rinsed 3 times in cold saline, blotted dry, and flash-frozen in individual bags in liquid nitrogen.

Preparation of placental homogenates

The frozen placental sample was pulverized on dry ice, and approximately 100 mg were transferred to 5-mL polypropylene tubes. Each tube had a cocktail of protease inhibitors added (phenylmethylsulfonylfluoride, leupeptin, antipain, pepstatin A, and soybean trypsin inhibitor; Sigma, St. Louis, MO). Placental samples were then homogenized with a Tissumizer (Tekmar, Cincinnati, OH) for 30 s on ice in a 2-fold volume of homogenizing buffer [50 mmol/L Tris (pH 7.4) and 1 mmol/L ethylenediamine tetraacetate; Fisher Scientific, Pittsburgh, PA]. The homogenate was centrifuged at 3,000 x g for 10 min at 4 C, and then the collected supernatant was centrifuged at 10,000 x g for 15 min at 4 C. Two 10-µL aliquots were analyzed for protein concentration by the Lowry method, and the remaining sample was aliquoted and stored at -80 C until enzyme-linked immunosorbent assay (ELISA) analysis.

For ELISA analysis, samples were used from odd-numbered sites, and thus eight samples per placenta were analyzed. Samples were run in duplicate on two separate ELISA plates, and the normal and preeclamptic samples were pipetted into alternating wells. To control for any gestational age effect, homogenates were prepared from a single placental biopsy site from preterm deliveries without preeclampsia (only one sample was available from these patients). In this final study normal term and preeclamptic placental homogenates were prepared as a pool of four sites per placenta and assayed for TNF{alpha} and IL-6 levels in duplicate. Placental homogenates were diluted in the manufacturer’s serum diluent to fall within the linear portion of the respective standard curves as determined in preliminary studies. Results were then normalized per mg protein.

ELISA of placental homogenates

All ELISAs were performed using kits obtained from R\|[amp ]\|D Systems, Inc. (Minneapolis, MN). For TNF{alpha}, IL-1ß, and IL-6, Quantikine High-Sensitivity kits were used, with sensitivities of 0.5, 0.125, and 0.156 pg/mL, respectively, whereas the sensitivity for the IL-1{alpha} assay was 3.9 pg/mL. A limited number of samples were also evaluated for IL-12 by an ELISA that had a sensitivity of 0.781 pg/mL. All assays were conducted according to manufacturer’s protocols.

The cytokine ELISAs of placental homogenates were extensively validated for dilutional parallelism and monitored for recovery of recombinant human cytokine standards in homogenates to assure no interference by substances in the crude samples. Linearity was assessed for TNF{alpha}, IL-1ß, and IL-6 in placental samples (prepared as a pool of homogenates from three each normal and preeclamptic samples), which were assayed in three dilutions. These experiments were performed in duplicate, and the data are expressed as a percentage of the measured values (observed) divided by the calculated value from assay of the initial pooled sample (expected), as shown in Table 1Go. Dilutional analysis was not performed for IL-1{alpha} and IL-12, because the samples were undetectable at dilutions greater than 1:2. Recovery of samples spiked with the respective recombinant human cytokine standard was performed with three concentrations of the standard added to diluted, pooled samples (n = 3 each for normal and preeclamptic placental homogenates).


View this table:
[in this window]
[in a new window]
 
Table 1. ELISA validation: dilutional parallelism

 
Semiquantitative RT-PCR

For determination of TNF{alpha} and ß-actin mRNA expression in the preeclamptic and normal term placentas, total RNA was pooled from four biopsy sites per placenta, and six placentas in each group were analyzed. Only one biopsy site was available for the six placentas from preterm deliveries without preeclampsia. Total RNA was isolated from placental tissues using RNAwiz (Ambion, Inc., Austin, TX). RNA from the four biopsy sites per placenta were then combined, and contaminating genomic DNA was removed using DNA-free (Ambion, Inc.). The concentration of pooled RNA was measured by spectrophotometry. Before performing RT-PCR, we verified that each pool of RNA was of high quality by ethidium bromide staining of total RNA (2.5 µg) separated on a formaldehyde-containing 1.5% agarose gel, and well defined bands were observed for both 18S and 28S RNA with no visible degradation (data not shown).

Human TNF{alpha} and ß-actin primers were purchased from R\|[amp ]\|D Systems, Inc. (Minneapolis, MN), or manufactured by the DNA Synthesis Facility at the University of Pittsburgh. For TNF{alpha}, the forward and reverse sequences were GTGACAAGCCTGTAGCCCA and ACTCGGCAAAGTCGAGATAG, respectively. Using these primers, the RT-PCR fragment was 414 bp, whereas amplification of genomic DNA would have yielded a 714-bp fragment. For ß-actin, the forward and reverse sequences were CTACAATGAGCTGCGTGTGG and AAGGAAGGCTGGAAGAGTGC, respectively. Using these primers, the RT-PCR fragment was 528 bp, whereas amplification of genomic DNA would have yielded a 969-bp fragment.

The semiquantitative RT-PCR technique was modified based on that previously described (13), and all reactions were prepared in an Airclean 600 Workstation with a UV light to prevent contamination (Airclean Systems, Raleigh, NC). Total RNA (5 µg) was annealed with 30 ng of each of the reverse primers in a total volume of 10.5 µL. Using a Genius thermocycler (Techne, Princeton, NJ), the mixture was incubated for 10 min at 75 C, cooled to 42 C at 0.2 C/min, maintained at 42 C for 15 min, and then held at 4 C until further processing. Next, an RT master mix was prepared, and 9.5 µL were added to each annealing reaction consisting of 4 µL RT buffer (5x stock), 2 µL dithiothreitol (100 mmol/L), 2 µL deoxy (d)-NTP (10 mmol/L), 1 µL AMVRT (10 U/µL), and 0.5 µL RNasin (40 U/µL). The mixture was incubated for 45 min at 42 C, heated to 95 C for 5 min, and then held at 4 C until further processing.

Separate PCR master mixes were then prepared containing either the TNF{alpha} or ß-actin primer pairs (kept on ice). One µL of the RT reaction was added to 19 µL of the ß-actin PCR master mix, and 2 µL of the RT reaction was added to 18 µL of the TNF{alpha} master mix. Preliminary experiments were conducted to determine the optimal amount of dNTP and MgCl2 in these master mixes. For ß-actin, the PCR master mix consisted of 1 µL buffer (20x stock), 1.5 µL dNTP (2 mmol/L), 1.2 µL MgCl2 (25 mmol/L), 6 µL enhancer (10x), 5.1 µL nuclease-free water, 0.2 µL Thermus flavus DNA polymerase (1 U/µL), and 4 µL of the ß-actin primer pair (2 µmol/L). For TNF{alpha}, the PCR master mix consisted of 1 µL buffer (20x stock), 1 µL dNTP (2 µmol/L), 0.8 µL MgCl2 (25 mmol/L), 6 µL enhancer (10x), 5 µL nuclease-free water, 0.2 µL Tf1 (1 U/µL), and 4 µL of the TNF{alpha} primer pair (2 µmol/L). The mixtures were titurated and placed in the thermal cycler at 4 C. Then the lid was heated at 94 C for 2 min, followed by heating of the reactions at 94 C for 5 min. Each cycle consisted of 1 min each at 94, 55, and 72 C. After completion of the PCR, the reactions were maintained at 4 C until further processing. To determine the optimal number of PCR cycles for ß-actin and TNF{alpha}, we tested 15–33 cycles in intervals of 3 for ß-actin and 24–42 cycles for TNF{alpha} and used 21 and 31 cycles, respectively, for subsequent analyses (Fig. 1Go). Further, we determined a linear relationship between the input of complementary DNA (cDNA) and the amount of PCR products generated with cDNA equivalent to 2.5, 1.25, and 0.625 µg total RNA (data not shown).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Influence of cycle number on optical density of ß-actin (A) and TNF{alpha} (B) PCR products detected by Southern blotting. cDNA was reversed transcribed from a pool of total RNA from 3 normal term placentas. A: Lane 1, Thirty-three cycles, no RNA; lanes 2–8, 15–33 cycles by increments of 3 cycles each (lane 4, 21 cycles). B: Lane 1, Forty-two cycles, no RNA; lanes 2–8, 24–42 cycles in increments of 3 cycles each (lane 4, 30 cycles).

 
All PCR products were subjected to Southern blotting. cDNA probes were made using 25–50 ng TNF{alpha} (ATCC 39894, American Type Culture Collection, Manassas, VA; PstI fragment of 1.1 kb) or ß-actin (ATCC 65128, EcoRI fragment of 1.1 kb) insert, 50 µCi [32P]dCTP (3000 Ci/mol; NEN Life Science Products-DuPont, Boston, MA), and 2 U Klenow polymerase using the Multiprime DNA labeling kit (Amersham Pharmacia Biotech, Piscataway, NJ). Unincorporated 32P was removed using a spin column (Biospin P30, Bio-Rad Laboratories, Inc., Hercules, CA). After decanting the prehybridization solution, labeled probe and 6 mL High Efficiency Hybridization System with 50% formamide (MRC, Cincinnati, OH) were added, and hybridization was performed overnight at 42 C. For posthybridization, the Washing/Prehyb solution was again used at room temperature and at 50 C as needed. The membranes were exposed to Kodak BioMax MR film (Eastman Kodak Co., Rochester, NY) for 10–20 min. The authenticity of the RT-PCR fragment for TNF{alpha} was verified by restriction enzyme digestion for total RNA from the placental pool and from human monocytic HL-60 cells stimulated with lipopolysaccharide.

Villous explant culture

Villous explant cultures were prepared as previously described (9). Briefly, blunt dissection of placental cotyledons (3–5/placenta) was performed to remove decidual tissue and large blood vessels. This was followed by fine dissection of 5- to 10-mg pieces of villous placenta bathed in 0.9% saline, which were placed into 24-well plates (35–50 mg total tissue) containing 1 mL medium 199 (Mediatech, Herndon, VA) with 10% FCS (Summit Technology, Ft. Collins, CO) and penicillin-streptomycin-gentamicin. Explants were incubated at 37 C with either no preincubation period or a 24-h preincubation. Incubations were carried out on an orbital shaker (60 rpm) under either standard tissue culture conditions of 5% CO2-95% room air or hypoxia (2.1% O2-5% CO2-balance N2). At the end of the experiment, tissue weight was recorded so that cytokine values could be corrected per wet weight, and the conditioned medium was stored at -80 C. The viability of villous explants was monitored at experiment termination by assessment of lactate dehydrogenase release into spent medium as previously described (9).

Peripheral and uterine venous blood samples

TNF{alpha} was measured in plasma or serum using an ELISA kit obtained from R\|[amp ]\|D Systems, Inc., as previously described (11). Blood was taken from a superficial vein on the lower lateral uterine segment. If the placenta was lateralized (as predicted by ultrasonography), the placental side was chosen. The vein was cannulated by a 21-gauge butterfly needle, and up to 20 mL were drawn into standard blood collection vials (Becton Dickinson and Co., Mountain View, CA). Less than 10 min earlier an equivalent blood sample was drawn from a peripheral arm or foot vein and processed in an identical manner. As soon as the samples without anticoagulant had clotted, they were centrifuged at 2500 x g, and the serum or plasma was separated and stored at -80 C. The samples were transported to Pittsburgh, unthawed, on dry ice for assay.

Data analysis

Cytokine protein levels in the multiple samples of normal and preeclamptic placental homogenates were analyzed by two-factor repeated measures ANOVA. For comparison of placental TNF{alpha}/ß-actin mRNA expression in preeclamptic, preterm (without preeclampsia), and term samples, we employed a one-factor randomized block design ANOVA. Differences in cytokine production by villous explants from normal and preeclamptic placentas cultured under standard tissue culture conditions or hypoxia were compared by two-factor randomized block design ANOVA. Fisher’s least significant difference test was used for post-hoc comparisons of individual means. Finally, an unpaired t test and one-sample sign test, respectively, were used to compare TNF{alpha} in blood samples from preeeclamptic and normal term women and to determine whether the ratio of TNF{alpha} in the uterine and peripheral venous blood was different from unity. P < 0.05 was taken as significant.

Results

Placental cytokine protein and mRNA

To test whether the use of crude placental homogenates in cytokine ELISAs would introduce cross-reacting or interfering substances, all assays were validated by dilutional parallelism (Table 1Go) and recovery of spiked recombinant human cytokine standards. All cytokine levels were detectable within a linear portion of the standard curves with appropriate sample dilution. The overall recovery of cytokine standards spiked into pooled placental homogenates ranged from 90–107% for the TNF{alpha}, IL-1{alpha}, IL-1ß, IL-6, and IL-12 assays.

Table 2Go depicts cytokine protein levels in placental homogenates from normal term and preeclamptic placentas after multiple site biopsy. Each of eight biopsies per placenta was analyzed by specific assay, and then the values obtained for the eight sites were averaged for each placenta. There were no significant differences in levels of TNF{alpha}, IL-1ß, IL-1{alpha}, or IL-6 in the placentas from normal term compared with preeclamptic pregnancies. In addition, in a limited number of samples (three sites per placenta, four patients), IL-12 levels did not differ (term, 4.3 ± 1.0 pg/g; preeclamptic, 4.1 ± 1.0 pg/g; mean ± SEM). Within each placenta, there was a 3-fold range in cytokine values obtained over the eight sites assayed (Fig. 2Go). This variation within a placenta was similar between patient groups and was not related to the anatomical location of the biopsy.


View this table:
[in this window]
[in a new window]
 
Table 2. Cytokine protein levels (picograms per mg protein) in placental homogenates

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. Variation in TNF{alpha} protein levels in eight-site biopsies of normal term and preeclamptic placentas. {circ}, TNF{alpha} levels at eight individual sites from normal term and preeclamptic placentas (samples analyzed in duplicate by ELISA).

 
To control for differences in gestational age between the normal term (~39 weeks) and preeclamptic patients (~33.5 weeks), single site biopsies were obtained from a group of preterm patients without preeclampsia, and placental homogenates were assayed for TNF{alpha} and IL-6 levels. Again, there were no significant differences in placental TNF{alpha} and IL-6 concentrations (Table 3Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Cytokine protein levels (picograms per mg protein) in placental homogenates from preterm (without preeclampsia), term, and preeclamptic patients

 
Figure 3Go shows the confirmation of TNF{alpha} mRNA expression in the human placenta by restriction enzyme digestion using HincII. Two fragments of 169 and 245 bp were predicted. This pattern was observed for RT-PCR products in the total RNA pooled from three normal term placentas and in lipopolysaccharide-stimulated HL-60 cells that served as a positive control for TNF{alpha} production. Figure 4Go portrays the results for TNF{alpha} and ß-actin mRNA expression for the normal term and preeclamptic placentas. There were no significant differences between the two groups of placentas. In contrast, normalized TNF{alpha} expression was significantly lower in the preterm placentas without preeclampsia than in the normal term placenta (P < 0.05; Fig. 5Go).



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Restriction enzyme digest of TNF{alpha} PCR products by HincII. Lane 1, 100-bp ladder; lane 2, 414-bp TNF{alpha} RT-PCR product of total RNA pooled from three normal term placentas; lane 3, restriction enzyme digest demonstrating the predicted 245- and 169-bp fragments; lane 4, 414-bp TNF{alpha} RT-PCR product of total RNA from HL-60 cells (positive control); lane 5, restriction enzyme digest demonstrating the predicted 245- and 169-bp fragments.

 


View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. TNF{alpha} gene expression in normal term and preeclamptic placentas (n = 6 each). Total RNA was pooled from four biopsy sites per placenta and reverse transcribed. ß-Actin and TNF{alpha} PCR products were visualized by Southern blotting. Left insets: Lanes 1 and 2, No RNA; lanes 3, 5, and 7, three different normal term placentas; lanes 4, 6, and 8, three different preeclamptic placentas. Right insets: Lanes 1 and 2, No RNA; lanes 3, 5, and 7, three additional, different normal term placentas; lanes 4, 6, and 8, three additional, different preeclamptic placentas. Lanes 9 and 10 are without reverse transcriptase. The data are summarized in the graph (mean ± SEM).

 


View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. TNF{alpha} gene expression in normal term and preterm placentas without preeclampsia (n = 6 each). Total RNA was pooled from four biopsy sites per term placenta and reverse transcribed. Total RNA was prepared from one biopsy site per preterm placenta and reversed transcribed. ß-Actin and TNF{alpha} PCR products were visualized by Southern blotting. Insets: Lanes 1 and 16, No RNA; lanes 2, 4, 6, 8, 10, and 12, the six different normal term placentas; lanes 3, 5, 7,9, 11, and 13, the six different preterm placentas. Lanes 14 and 15 are without reverse transcriptase. The data are summarized in the graph (mean ± SEM). *, P < 0.05 vs. normal pregnancy.

 
Villous placental tissues from normal term and preeclamptic patients were also maintained in explant culture under various conditions to determine whether cytokine production differed in response to oxygen. Cytokine concentrations were first measured in medium after maintaining villous explants (n = 5/group) for 24 h under standard tissue culture conditions. There were no initial differences in TNF{alpha} production between term and preeclamptic placental villous explants (91 ± 12 vs. 97 ± 32 pg/g wt) or in IL-1ß (173 ± 78 vs. 107 ± 27 pg/g wt). After this 24-h incubation, villous explants were placed into fresh medium and incubated for an additional 24 h under standard tissue culture conditions (21% oxygen) or under 2.1% O2 (hypoxia). As presented in Fig. 6Go, exposure to reduced oxygen significantly stimulated the production of TNF{alpha}, IL-1ß, and IL-1{alpha} in villous explants obtained from both normal term and preeclamptic placentas. Hypoxia did not affect IL-6 production by villous explants. IL-6 and TNF{alpha} levels were significantly reduced, however, in villous explants prepared from preeclamptic vs. normal term placenta. Finally, in two placentas from each patient group, decidual basal plate was incubated in a similar fashion; however, no differences in TNF{alpha} or IL-6 levels were observed (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. Cytokine production by villous explants prepared from normal term and preeclamptic placentas. Villous explants were maintained for 24 h under standard tissue culture conditions (21% oxygen; {square}; n = 5) or hypoxia (2% oxygen; {blacksquare}; n = 5). The cytokines evaluated were TNF{alpha} (A), IL-1ß (B), IL-1{alpha} (C), and IL-6 (D). Cytokine concentrations in the conditioned medium were corrected for wet weight of the villous tissue and are expressed as the mean ± SEM. *, Statistical difference between 21% and 2% oxygen; {dagger}, significant difference between incubations of normal term and preeclamptic villous explants (P < 0.05).

 
Last, blood samples were obtained at cesarian section from women with and without preeclampsia. These serum samples were collected from a vein in the antecubital fossa and from the uterine vein. There was an elevation in circulating TNF{alpha} levels in the preeclamptic women, and this difference was maintained across uterine circulation (Table 4Go). To determine whether this elevation in peripheral levels was of uteroplacental origin, uterine venous levels were taken as a ratio of peripheral venous levels. This ratio did not differ significantly from 1.0 in either patient group (term, 1.04 ± 0.05; preeclamptic, 0.98 ± 0.03).


View this table:
[in this window]
[in a new window]
 
Table 4. Peripheral and uterine venous TNF{alpha} serum concentrations (picograms per mL) in normal term and preeclamptic women at delivery (n = 8/group)

 
Discussion

The failure of the uterine vasculature to undergo adequate physiological remodeling in women with preeclampsia has led a number of investigators to postulate that a consequence of reduced placental perfusion is the generation of cytotoxic factors that circulate and injure the maternal endothelium (1, 2, 3, 4). Indeed, we previously reported that the normal human placenta can produce more inflammatory cytokines, including TNF{alpha}, when incubated under low oxygen tension (9). Inflammatory cytokines are notorious for affecting the endothelium in a fashion similar to events reported in preeclamptic women (2, 5), and TNF{alpha} levels are higher in the circulation of women with preeclampsia (11). Therefore, in the present work we investigated whether the placenta is the source of increased circulating TNF{alpha} and IL-6 in preeclampsia. Placental concentrations of other inflammatory cytokines, such as IL-1{alpha}, IL–1ß, and IL-12, were also evaluated.

As the placenta is a large heterogeneous organ, we sampled each placenta in a systematic and unbiased fashion (12). We constructed circular grids, each with 16 holes to fit over a placenta for multiple sampling. This allowed us to obtain punch biopsies without bias toward the condition of the placenta (although if sections were taken near areas of gross infarctions, this was noted), and sample collection was completed within 15 min of delivery. Also, in these studies only placentas obtained after cesarian section in women without labor were used, because others have reported elevated levels of TNF{alpha} and IL-6 in amniotic fluid with labor (14).

Inflammatory cytokines were readily detected in homogenates prepared from all biopsies in the normal term and preterm placentas (with and without preeclampsia). Comparison of cytokine protein levels within a single placenta demonstrated a 3-fold variation among sites that was independent of anatomic location or patient group. In retrospect, our strategy of obtaining multiple biopsies in a systematic and unbiased fashion (as opposed to single sampling) was warranted in view of this highly variable expression. In contrast to a previous report (15), we did not find an elevation in TNF{alpha} protein levels in the preeclamptic placenta, nor did we detect increased TNF{alpha} protein levels in the conditioned media of villous explants from preeclamptic placentas; in fact, significantly lower levels were detected in media from samples incubated under standard tissue culture conditions. Further, our evaluation of TNF{alpha} mRNA using semiquantitative RT-PCR did not demonstrate any significant differences in TNF{alpha} mRNA between normal term and preeclamptic placentas, although differences have been reported by others (15, 16). Clear explanations for the different results obtained in our study and those of others are not readily apparent, although technical considerations such as placental sampling, mode of delivery (15), as well as differences in ELISAs and approaches to semiquantitative RT-PCR are possibilities. Of note is that in our study TNF{alpha} message was detectable in all normal term placentas, whereas in other studies TNF{alpha} mRNA was negligible (15, 16). Furthermore, other studies have shown the normal placenta to be a source of TNF{alpha} (6, 17). Finally, in a study by Opsjon and colleagues of amniotic fluid cytokine levels, it was mentioned (data not shown) that there were no differences in protein levels of TNF{alpha}, IL-1ß, or IL-6 in preeclamptic vs. normal placentas (14).

We have previously shown that incubation of human placental explants under reduced oxygen conditions results in the elevated production of TNF{alpha}, IL-1{alpha}, and IL-1ß (9), and we have postulated that focal ischemia/hypoxia due to insufficient changes in the uterine vasculature may elevate placental inflammatory cytokine production in preeclampsia. Although results from the current study via direct measurement of placental cytokines and uterine venous sampling do not support our original hypothesis, they do not discount the central dogma that reduced placental perfusion may result in the production of cytotoxic factors by the placenta. In fact, our prior work (9) and current studies on placental expression of hypoxia-inducible transcription factors (18) provide evidence that oxygen-sensing pathways are present in the human placenta.

We also assessed TNF{alpha} mRNA and protein levels in preterm placentas from women without a diagnosis of preeclampsia to match gestational age to some of the preeclamptic women. Importantly, TNF{alpha} protein levels did not differ among preterm, preeclamptic, or normal term groups, although TNF{alpha} mRNA was less in the preterm group compared with the normal term placenta.

We investigated IL-1{alpha} and IL-1ß placental protein levels, because the production of these cytokines can be stimulated in villous explants by hypoxia (Ref. 9 and the current study), and placental IL-1ß mRNA was reported to be increased in women with preeclampsia (16). We failed to detect any significant differences in protein levels of these cytokines in placentas obtained from normal term and preeclamptic women, nor were concentrations in the conditioned media from villous explants cultured under 21% oxygen any different between these patient groups. Moreover, circulating IL-1ß is not significantly increased in preeclampsia (11). Because the status of placental IL-12 and its role in preeclampsia are uncertain (19, 20), we also evaluated IL-12 levels using an ELISA that detects both the p35 and p40 subunits of IL-12 in a limited number of samples. Again, our results suggested no differences.

Protein levels of IL-6 were comparable in placentas delivered at term or preterm with or without preeclampsia. At the mRNA level, others have also reported no differences (16, 21). Amniotic fluid levels of IL-6 are reportedly lower in nonlabored, preeclamptic pregnancies (14) and those with small for gestational age fetuses (22). We and others (the current study and Ref. 21) found that IL-6 production by villous placental tissue from preeclamptic women maintained in culture was decreased compared with that by villous explants from normal term placenta. Although IL-6 levels are increased in the circulation from preeclamptic women (11, 23), the source of this IL-6 may be activated leukocytes or the maternal endothelium, which can produce IL-6 upon exposure to stimuli such as TNF{alpha} (5).

As previously mentioned, several investigators have identified elevations in circulating levels of TNF{alpha} in preeclampsia (reviewed in Refs. 10 and 11) and in women early in pregnancy who later developed preeclampsia (24). Serum concentrations of the TNF-p55 soluble receptor are also increased before clinical manifestations (25). As an alternative approach to investigate the placenta as a source of circulating TNF{alpha}, we obtained uterine venous and peripheral blood samples from normal term and preeclamptic women at cesarian section. TNF{alpha} levels were elevated in peripheral circulation in preeclamptic women as previously reported (11). However, the ratio of uterine/peripheral venous TNF{alpha} was not significantly different from 1.0 for both groups of patients. Because the half-life of TNF{alpha} in the circulation is relatively short (<30 min) (26), these results suggest that the placenta does not contribute significantly to the elevated circulating levels in the disease. Other sources for elevated circulating cytokines might include leukocytes, which are at a heightened activation state during preeclampsia (27) and express greater TNF{alpha} mRNA in women with preeclampsia (28).

In conclusion, there were no significant alterations in protein or mRNA expression of TNF{alpha} in placentas from women with preeclampsia, nor was there a gradient for TNF{alpha} across the uteroplacental unit in vivo during the disease. Placental levels of other inflammatory cytokines (IL-1{alpha}, IL-1ß, and IL-6) were not altered in preeclampsia. Based on these results, we suggest that tissues other than the placenta, such as activated leukocytes or the endothelium, may contribute to the elevated concentration of inflammatory cytokines found in the circulation of preeclamptic women.

Acknowledgments

We gratefully acknowledge Theresa Miles for technical assistance with tissue procurement and cytokine ELISAs, Sue Kauffman for the preparation of graphs, Cynthia Schatzmann for patient recruitment, and Drs. Phillip Heine and Deb Draper for providing preterm placental samples.

Footnotes

1 This work was supported by NIH Grants P01-HD-30367 and K04-HD-01098. Back

Received November 2, 2000.

Revised January 19, 2001.

Accepted February 2, 2001.

References

  1. National High Blood Pressure Education Program Working Group. 1990 Report on high blood pressure in pregnancy. Am J Obstet Gynecol. 163:1689–1712.
  2. Taylor RN, Roberts JM. 1999 Endothelial cell dysfunction. In: Lindheimer MD, Roberts JM, Cunningham GF, eds. Chesley’s hypertensive disorders in pregnancy, 2nd Ed. Stamford; Appleton & Lange; 395–429.
  3. Khong TY, Robertson WB. 1992 Spiral artery disease. In: Coulam CB, Faulk WP, McIntyre JA, eds. Immunological obstetrics. New York; Norton; 492–501.
  4. Page EW. 1939 The relation between hydatic moles, relative ischemia of the gravid uterus, and the placental origin of eclampsia. Am J Obstet Gynecol. 37:291–293.
  5. Pober JS, Cotran RS. 1990 Cytokines and endothelial cell biology. Physiol Rev. 70:427–451.[Free Full Text]
  6. Chen H-L, Yang Y, Hu XL, Yelavarthi KK, Fishback JL, Hunt JS. 1991 Tumor necrosis factor {alpha} mRNA and protein are present in human placental and uterine cells at early and late stages of gestation. Am J Pathol. 139:327–335.[Abstract]
  7. Hu X-L, Yang Y, Hunt JS. 1992 Differential distribution of interleukin-1{alpha} and interleukin-1ß proteins in human placentas. J Reprod Immunol. 22:257–268.[CrossRef][Medline]
  8. Kameda TN, Matsuzaki N, Sawai K, et al. 1990 Production of interleukin-6 by normal human trophoblast. Placenta. 11:205–213.[CrossRef][Medline]
  9. Benyo DF, Miles TM, Conrad KP. 1997 Hypoxia stimulates cytokine production by villous explants from the human placenta. J Clin Endocrinol Metab. 82:1582–1588.[Abstract/Free Full Text]
  10. Conrad KP, Benyo DF. 1997 Placental cytokines and the pathogenesis of preeclampsia. Am J Reprod Immunol. 37:240–249.
  11. Conrad KP, Miles TM, Benyo DF. 1998 Circulating levels of immunoreactive cytokines in women with preeclampsia. Am J Reprod Immunol. 40:102–111.
  12. Mayhew TM, Burton GJ. 1988 Methodological problems in placental morphometry: apologia for the use of stereology based on sound sampling practice. Placenta. 9:565–581.[Medline]
  13. Bobadilla NA, Herrera JP, Merino A, Gamba G. 1997 Semi-quantitative PCR: a tool to study low abundance messages in the kidney. Arch Med Res. 28:55–60.[Medline]
  14. Opsjon S-L, Austgulen R, Waage A. 1995 Interleukin-1, interleukin-6 and tumor necrosis factor at delivery in preeclamptic disorders. Acta Obstet Gynecol Scand. 74:19–26.[Medline]
  15. Wang Y, Walsh SW. 1996 TNF{alpha} concentrations and mRNA expression are increased in preeclamptic placentas. J Reprod Immunol. 32:157–169.[CrossRef][Medline]
  16. Rinehart BK, Terrone DA, Lagoo-Deenadayalan, Barber WH, Hale EA, Martin JN, Bennett WA. 1999 Expression of the placental cytokines tumor necrosis factor {alpha}, interleukin 1ß, and interleukin 10 is increased in preeclampsia. Am J Obstet Gynecol. 181:915–920.[CrossRef][Medline]
  17. Jaattela M, Kuusela P, Saksela E. 1988 Demonstration of tumor necrosis factor in human amnionic fluids and supernatants of placental and decidual tissues. Lab Invest. 58:48–52.[Medline]
  18. Rajakumar A, Conrad KP. 2000 Expression, ontogeny, and regulation of hypoxia-inducible transcription factors in the human placenta. Biol Reprod. 63:559–569.[Abstract/Free Full Text]
  19. Dudley DJ, Hunter C, Mitchell MD, Varner MW, Gately M. 1996 Elevations of serum interleukin-12 concentrations in women with severe pre-eclampsia and HELLP syndrome. J Reprod Immunol. 31:97–107.[CrossRef][Medline]
  20. Sacks GP, Scott D, Tivnann H, Mire-Sules T, Sargent IL, Redman CWG. 1997 Interleukin-12 and pre-eclampsia. J Reprod Immunol. 34:155–158.[CrossRef][Medline]
  21. Kauma SW, Wang Y, Walsh SW. 1995 Preeclampsia is associated with decreased placental interleukin-6 production. J Soc Gynecol Invest. 2:614–617.[CrossRef][Medline]
  22. Silver RM, Schwinzer B, McGregor JA. 1993 Interleukin-6 levels in amnionic fluid in normal and abnormal pregnancies: preeclampsia, small-for-gestational age fetus, and premature labor. Am J Obstet Gynecol. 169:1101–1105.[Medline]
  23. Kupferminc MJ, Peaceman AM, Aderka D, Wallach D, Socol ML. 1996 Soluble tumor necrosis factor receptors and interleukin-6 levels in patients with severe preeclampsia. Obstet Gynecol. 88:420–427.[Abstract]
  24. Hamai Y, Fujii T, Yamashita T, Nishina H, Kozuma S, Maikami Y, Taketani Y. 1997 Evidence for an elevation in serum interleukin-2 and tumor necrosis factor-{alpha} levels before the clinical manifestations of preeclampsia. Am J Reprod Immunol. 38:89–93.
  25. Williams MA, Farrand A, Mittendorf R, et al. 1999 Maternal second trimester serum tumor necrosis factor-{alpha}-soluble receptor p55 (sTNFp55) and subsequent risk of preeclampsia. Am J Epidemiol. 149:323–329.[Abstract/Free Full Text]
  26. Saks S, Rosenblum M. 1992 Recombinant human TNF-{alpha}: preclinical studies and results from early clinical trials. Immunol Ser. 56:567–587.[Medline]
  27. Sacks GP, Studena K, Sargent IL, Redman CWG. 1998 Normal pregnancy and preeclampsia both produce inflammatory changes in peripheral blood leukocytes akin to those of sepsis. Am J Ostet Gynecol. 179:80–86.[CrossRef][Medline]
  28. Chen G, Wilson R, Wang SH, Zheng HZ, Walker JJ, McKillop JH. 1996 Tumour necrosis factor-{alpha} (TNF-{alpha}) gene polymorphism and expression in pre-eclampsia. Clin Exp Immunol. 104:154–159.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
C. J. Lockwood, C.-F. Yen, M. Basar, U. A. Kayisli, M. Martel, I. Buhimschi, C. Buhimschi, S. J. Huang, G. Krikun, and F. Schatz
Preeclampsia-Related Inflammatory Cytokines Regulate Interleukin-6 Expression in Human Decidual Cells
Am. J. Pathol., June 1, 2008; 172(6): 1571 - 1579.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
S. GULLER, Y. Y. MA, H.-H. FU, G. KRIKUN, V. M. ABRAHAMS, and G. MOR
The Placental Syncytium and the Pathophysiology of Preeclampsia and Intrauterine Growth Restriction: A Novel Assay to Assess Syncytial Protein Expression
Ann. N.Y. Acad. Sci., April 1, 2008; 1127(1): 129 - 133.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
A. Rajakumar, A. Jeyabalan, N. Markovic, R. Ness, C. Gilmour, and K. P. Conrad
Placental HIF-1{alpha}, HIF-2{alpha}, membrane and soluble VEGF receptor-1 proteins are not increased in normotensive pregnancies complicated by late-onset intrauterine growth restriction
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R766 - R774.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
K. Tsukimori, H. Nakano, and N. Wake
Difference in Neutrophil Superoxide Generation During Pregnancy Between Preeclampsia and Essential Hypertension
Hypertension, June 1, 2007; 49(6): 1436 - 1441.
[Abstract] [Full Text] [PDF]


Home page
CLIN APPL THROMB HEMOSTHome page
D. M. Paternoster, S. Fantinato, A. Stella, K. N. Nanhorngue, M. Milani, M. Plebani, U. Nicolini, and A. Girolami
C-reactive protein in hypertensive disorders in pregnancy.
Clinical and Applied Thrombosis/Hemostasis, July 1, 2006; 12(3): 330 - 337.
[Abstract] [PDF]


Home page
HypertensionHome page
J. M. Roberts and H. S. Gammill
Preeclampsia: Recent Insights
Hypertension, December 1, 2005; 46(6): 1243 - 1249.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
C. Lam, K.-H. Lim, and S. A. Karumanchi
Circulating Angiogenic Factors in the Pathogenesis and Prediction of Preeclampsia
Hypertension, November 1, 2005; 46(5): 1077 - 1085.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
N. Soleymanlou, I. Jurisica, O. Nevo, F. Ietta, X. Zhang, S. Zamudio, M. Post, and I. Caniggia
Molecular Evidence of Placental Hypoxia in Preeclampsia
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4299 - 4308.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
D. J. Freeman, F. McManus, E. A. Brown, L. Cherry, J. Norrie, J. E. Ramsay, P. Clark, I. D. Walker, N. Sattar, and I. A. Greer
Short- and Long-Term Changes in Plasma Inflammatory Markers Associated With Preeclampsia
Hypertension, November 1, 2004; 44(5): 708 - 714.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
J. M. Davison, V. Homuth, A. Jeyabalan, K. P. Conrad, S. A. Karumanchi, S. Quaggin, R. Dechend, and F. C. Luft
New Aspects in the Pathophysiology of Preeclampsia
J. Am. Soc. Nephrol., September 1, 2004; 15(9): 2440 - 2448.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
J. Novak, A. Rajakumar, T. M. Miles, and K. P. Conrad
Nitric Oxide Synthase Isoforms in the Rat Kidney During Pregnancy
Reproductive Sciences, July 1, 2004; 11(5): 280 - 288.
[Abstract] [PDF]


Home page
Am. J. Pathol.Home page
T.-H. Hung, D. S. Charnock-Jones, J. N. Skepper, and G. J. Burton
Secretion of Tumor Necrosis Factor-{alpha} from Human Placental Tissues Induced by Hypoxia-Reoxygenation Causes Endothelial Cell Activation in Vitro: A Potential Mediator of the Inflammatory Response in Preeclampsia
Am. J. Pathol., March 1, 2004; 164(3): 1049 - 1061.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
R. Thadhani, W. P. Mutter, M. Wolf, R. J. Levine, R. N. Taylor, V. P. Sukhatme, J. Ecker, and S. A. Karumanchi
First Trimester Placental Growth Factor and Soluble Fms-Like Tyrosine Kinase 1 and Risk for Preeclampsia
J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 770 - 775.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
J. M. Orshal and R. A. Khalil
Reduced Endothelial NO-cGMP-Mediated Vascular Relaxation and Hypertension in IL-6-Infused Pregnant Rats
Hypertension, February 1, 2004; 43(2): 434 - 444.
[Abstract] [Full Text] [PDF]


Home page
Obstet GynecolHome page
S. Kauma, P. Takacs, C. Scordalakes, S. Walsh, K. Green, and T. Peng
Increased Endothelial Monocyte Chemoattractant Protein-1 and Interleukin-8 in Preeclampsia
Obstet. Gynecol., October 1, 2002; 100(4): 706 - 714.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
R. A. Khalil and J. P. Granger
Vascular mechanisms of increased arterial pressure in preeclampsia: lessons from animal models
Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2002; 283(1): R29 - R45.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Ito, A. Itakura, Y. Ohno, M. Nomura, T. Senga, T. Nagasaka, and S. Mizutani
Possible Activation of the Renin-Angiotensin System in the Feto-Placental Unit in Preeclampsia
J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1871 - 1878.
[Abstract] [Full Text] [PDF]


Home page
Obstet GynecolHome page
M. Wolf, E. Kettyle, L. Sandler, J. L. Ecker, J. Roberts, and R. Thadhani
Obesity and Preeclampsia: The Potential Role of Inflammation
Obstet. Gynecol., November 1, 2001; 98(5): 757 - 762.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal