help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ottolenghi, C.
Right arrow Articles by McElreavey, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ottolenghi, C.
Right arrow Articles by McElreavey, K.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 6 2465-2469
Copyright © 2001 by The Endocrine Society


Original Articles: Hormones and Reproductive Health

Absence of Mutations Involving the Lim Homeobox Domain Gene LHX9 in 46,XY Gonadal Agenesis and Dysgenesis

Chris Ottolenghi1, Carlos Moreira-Filho, Berenice B. Mendonça, Marcello Barbieri, Marc Fellous, Gary D. Berkovitz and Ken McElreavey

Immunogénétique Humaine, INSERM E0025, Institut Pasteur (C.O., M.F., K.M.), 75724 Paris, France; Dipartimento di Morfologia ed Embriologia, Università di Ferrara (C.O., M.B.), 44100 Ferrara, Italy; Department of Immunology, Institute of Biomedical Sciences, University of Sao Paulo (C.M.-F.), and Hospital das Clinicas-FMUSP, University of Sao Paulo School of Medicine (B.B.M.), 05508 Sao Paulo, Brazil; and Division of Pediatric Endocrinology, University of Miami School of Medicine (G.D.B.), Miami, Florida 33136

Address all correspondence and requests for reprints to: Dr. Ken McElreavey, INSERM, U-276, Immunogenetique Humaine, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex, France.

Abstract

The etiology of most cases of 46,XY gonadal dysgenesis in the absence of extragenital anomalies is not accounted for by mutations in the genes known to date to be involved in sex determination. We have investigated the possibility that mutations in the gene LHX9, whose murine ortholog causes isolated gonadal agenesis when inactivated, might be responsible for gonadal dysgenesis and agenesis in humans. We isolated a human LHX9 complementary DNA (cDNA), mapped the gene to the long arm of human chromosome 1, and determined its genomic structure. We found that LHX9 is highly conserved between species, sharing in particular over 98% amino acid identity. A mutational screen was performed in a sample of patients with a range of gonadal maldevelopment, including bilateral gonadal agenesis in two sisters with an opposite sex karyotype. We did not detect mutations in the open reading frame of LHX9 in the patients studied. However, the extent of between-species structural conservation suggests that LHX9 deserves further consideration as a determinant of gonadal function in humans.

IN HUMANS, mutations in the master sex regulator gene SRY are harbored by less than 20% of sex-reversed patients with complete 46,XY gonadal dysgenesis (1). Mutations in all other genes known to be involved in 46,XY gonadal dysgenesis are systematically associated with extragenital anomalies (2, 3). This involves mutations on such genes as WT-1, SOX-9, SF-1 (2, 3). In addition, no intragenic mutations or rearrangements have been detected in three genes related to the invertebrate sex regulators doublesex and mab-3 positioned in the region on 9p that is known to be deleted in some patients with isolated 46,XY gonadal dysgenesis (Refs. 4, 5, 6, 7 and references therein). Therefore, the etiology of the majority of cases of isolated 46,XY gonadal dysgenesis is still undetermined 10 yr after the discovery of SRY.

46,XY bilateral agonadism in the presence of normal female genitalia and no other anomalies represents an exceptional clinical finding. A patient was described by De Marchi et al. (8), and we have previously reported two sisters with normal female phenotype but bilateral agonadism, one having a 46,XY and the other a 46,XX karyotype, who were born to a consanguineous marriage (9). In these patients, involution of gonads must have preceded the time of sex determination. This contrasts with the condition associating a normal 46,XY male phenotype with unilateral or bilateral agonadism, as normal masculinization is highly suggestive of gonadal loss occurring at later developmental stages. Here, mechanical causes, particularly intrauterine torsion of the spermatic cords, may represent the underlying mechanism (10). However, in other patients masculinization has been found to be incomplete. These individuals present with 46,XY bilateral agonadism or associating 46,XY unilateral gonadal loss with a dysgenetic gonad on the other side of the body (11). In such patients, gonads must have been functionally abnormal before their disappearance. This suggests that in some cases, 46,XY gonadal agenesis and 46,XY gonadal dysgenesis may have a common origin, referred to as embryonic testicular regression sequence (11). As indirect evidence in favor of this, one may also consider that heterozygous mutations of two genes responsible for gonadal agenesis in the mouse when homozygously inactivated (Wt-1, Sf-1) are associated with 46,XY gonadal dysgenesis in human patients (Refs. 12 and 13 and references therein).

Recently, targeted disruption of a mouse LIM homeobox, Lhx9, was found to induce gonadal agenesis onto both sex karyotypes and was accompanied by XY male to female sex reversal in the absence of other anomalies (14), making it an interesting candidate gene for isolated 46,XY gonadal agenesis or dysgenesis in presence of a normal SRY gene. We have determined the genomic structure, chromosomal location, and expression pattern of human LHX9 and performed a mutational screen of 58 patients with a 46,XY karyotype and various forms of gonadal dysfunction. Although we did not detect mutations in this screen, we emphasize that LHX9 deserves further study on the basis of its high structural conservation with its murine counterpart.

Subjects and Methods

Subjects and human embryos

All clinical reports indicated that extragenital anomalies (except for an ectopic kidney in a fetus) were absent, and homogeneous 46,XY karyotype was recorded. The clinical findings, the number of cells counted per karyotype, and the heights of the patients analyzed in this study are summarized in Tables 1–3GoGoGo. The following genital phenotypes were represented: 1) 46,XY complete gonadal dysgenesis, as defined in Ref. 15 (Table 1Go shows data for 14 patients of 27 tested, as cell counts and heights were not available for the remaining patients), is characterized by streak gonads (fibrous tissue and ovarian-like stroma; n = 49 gonads) and/or immature gonads (undifferentiated cords, in two fetal gonads and three additional adult gonads) in the absence of testicular tissue, whereas the phenotype is a normal female; 2) 46,XY partial gonadal dysgenesis, as also defined in Ref. 15 (n = 17; Table 2Go), is characterized by the presence of dysgenetic testicular tissue (disorganized seminiferous tubules or dispersed single Sertoli cells in at least one gonad in association, or not, with fibrous tissue and ovarian-like stroma in the same or in the other gonad) and female or ambiguous genitalia; 3) 46,XY female agonadism (one of the sisters with opposite sex karyotypes previously described by us (9) and two additional, unrelated 46,XY agonadic female patients (see Table 3Go, patients AG1–3); 4) testicular regression syndrome (n = 7; see Table 3Go, patients 225–242 and TR1–3) is characterized by 46,XY karyotype in the presence of unilateral agonadism with partial phenotypical masculinization or bilateral agonadism with either partial or complete phenotypical masculinization (four cases were described by one of us in Ref. 11); and 5) 46,XY pseudohermaphroditism is characterized by histologically normal testes and ambiguous external genitalia, in presence of Mullerian derivatives (n = 3). The anti-Mullerian hormone was undetectable, suggesting gonadal dysfunction.


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of the clinical findings recognized in patients with 46,XY complete gonadal dysgenesis screened for LHX9 mutations (see text for details)

 

View this table:
[in this window]
[in a new window]
 
Table 2. Summary of the clinical findings recognized in patients with 46,XY partial gonadal dysgenesis screened for LHX9 mutations

 

View this table:
[in this window]
[in a new window]
 
Table 3. Summary of the clinical findings recognized in patients with 46,XY gonadal agenesis (AG1-3) and testicular regression syndrome (225-242, TR1-3) screened for LHX9 mutations

 
All patients were selected for the absence of mutations in the entire SRY-coding region as determined by DNA sequencing. Human embryos were collected according to the recommendations of the comité consultatif national d’ethique of France; techniques of ribonucleic acid (RNA) extraction and cDNA synthesis are discussed in Ref. 7 .

Genomic structure and sequence analysis

In silico analysis was performed by standard nucleotide identity searches (BLASTN) against public sequence databases (nr, dbest, and htgs divisions of GenBank).

Adult tissue samples used for cDNA amplification were purchased from Life Technologies, Inc. (cloned testis library), and CLONTECH Laboratories, Inc. (human normalized cDNA panel II, Palo Alto, CA). The membrane used for Northern blot hybridization was purchased from CLONTECH Laboratories, Inc. (MTN H2). The probe, spanning from exons 2–5, was synthesized from testis cDNA by PCR amplification (58 C annealing temperature and 1-min extension time per PCR cycle over 35 cycles; primer sequences, ccgctcagcccggagaagcccgcc and ctcttgccgcaaaaggttccttct). The temperature and time of the denaturation step were 94 C and 30 s in all PCR reactions using PTC-100 and PTC-200 thermal cycler machines provided with a hot lid (MJ Research, Inc., Cambridge, MA). The same primers and PCR conditions were used to study LHX9 messenger RNA expression in human embryos (Fig. 2BGo). Primers and PCR conditions for amplification of exons 1 and 2 in adult tissues (Fig. 2DGo) were as follows: ggcatcatggaggagatggagcgc (forward), aagcaggtgagctcggactcgagg (reverse), 60 C annealing temperature, and 1-min extension time. Northern blot hybridization was performed overnight at 65 C in standard Church hybridization buffer. Amplification of major LHX9 isoforms (Fig. 2CGo) was obtained by nested PCR. The following primers were used in primary PCR: gtgatccactccttttcctgtaag and ctgcagatgctacacaccaagctg for exon 1–5 amplification; and gtgatccactccttttcctgtaag and tcactgcagtggatttccgatca for exon 1–6 amplification. Products of primary PCR were diluted 1:25, and an aliquot was used for secondary PCR (final dilution, 1:250; primer sequences, taagaatgctgaacggtaccactc and gggcctcagtcttggatctgcgctc). PCR conditions were as follows: 55 C annealing temperature and 6-min extension time per cycle for primary PCR, and 65 C annealing temperature and 3-min extension time for secondary PCR. All PCR reactions performed on cDNA were designed to produce amplicons spanning one or more introns, thus excluding any genomic DNA amplification.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 2. Expression pattern of human LHX9. A, Northern blot hybridization of a panel of normalized adult human tissues (membrane from CLONTECH Laboratories, Inc.). B, RT-PCR of LHX 9 (over exons 2–5) in human embryos. SRY amplification is given for comparison (7 ). N. C., Negative control (no reverse transcriptase; pooled template RNA). C, Nested PCR amplification of major LHX9 isoforms spanning exons 1–5 vs. exons 1–6 in adult human gonadal tissues. N. C., No template. D, PCR of LHX9 (over exons 1–2) in normalized cDNA preparations from human adult tissues.

 
Multiple 5'-cDNA ends were obtained by rapid amplification of 5'-cDNA ends (5'RACE) PCR on several human adaptor-ligated cDNA preparations (Marathon, CLONTECH Laboratories, Inc.) by nested PCR performed according to the manufacturer’s instructions (LHX9-specific primers sequences were gccgttgagctgggcgcctttggc and gggcctcagtcttggatctgcgctc).

The primers and PCR conditions for amplification and sequencing of patient DNA samples are indicated in Table 4Go. PCR amplification products were sequenced on an automated capillary electrophoresis system (ABI PRISM 3700, Perkin-Elmer Corp., Foster City, CA).


View this table:
[in this window]
[in a new window]
 
Table 4. Primers used to sequence the exons of LHX9 in the patients, and the sequence polymorphisms detected in this study

 
Results

Genomic structure and expression pattern of human LHX9

We determined the cDNA sequence of human LHX9 partially in silico by comparing two ESTs in public databases with the sequence of mouse Lhx9 (GenBank accession no. AA316988, AA382798, and AF116518, respectively). This allowed us to design primers for direct PCR amplification of a full-length cDNA from a testis library (cDNA sequence deposited in public database; EMBL accession no. AJ277915). The putative protein encoded by this cDNA was over 98% identical to the mouse counterpart at the amino acid level (Fig. 1Go). We found by RT-PCR that the abdominal region of human embryos of both sexes expresses LHX9 at the time of gonadal formation (Fig. 2BGo), consistent with in situ hybridization studies performed in mice (14, 17, 18). Expression in adult tissues was widespread, as determined by Northern blot hybridization (Fig. 2AGo) and by PCR on normalized cDNA preparations (Fig. 2DGo). Several bands were detected by Northern blot hybridization, the longest one (size of about 4.7 kb) being stronger in testis than ovary. In addition, we obtained several distinct transcripts of human LHX9 by 5'RACE-PCR experiments in four tissues, suggesting the existence of multiple transcription initiation sites and alternatively spliced exons in 5'-untranslated regions (data not shown). Particularly, one 5'-untranslated exon (indicated by -1 in Fig. 1BGo) was detected by RT-PCR in testis and not in ovary or other tissues (data not shown; accession no. AJ296272). We also verified that the counterparts of the two isoforms described in the mouse, characterized by use of exon 5 vs. exon 6 as alternative 3'-terminal exons, are expressed in human gonads (Fig. 2CGo). Interestingly, we observed that their relative levels of expression differ between testis and ovary (Fig. 2CGo and data not shown; EMBL accession no. AJ277914 for human exon 6-containing 3'-end). These preliminary data suggest that expression of human LHX9 is subject to complex, partly sex-specific, regulatory events involving transcription initiation and alternative splicing. Detailed investigations of the differential expression patterns of LHX9 transcripts are under way.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 1. A, ClustalW alignment of the conceptual translations of human and murine LHX9 (isoform containing exons 1–5). Horizontal lines are depicted over the amino acids contained in known (two LIM and one homeobox) protein domains. {blacktriangleup}, Intron positions. Asterisks mark amino acid identities. B, Schematic representation of the genomic structure of human LHX9, showing two 5'-untranslated exons (boxes labeled -1 and -2) and the protein-encoding exons 1–6 (see text). LIM domain and homeobox domains are shown in gray, and the alternative N-terminus-encoding motif upstream of exon 1 is in black. V-Shaped lines indicate messenger RNA splicing events removing introns, and vertical bars show the positions of the two putative, translation initiation sites.

 
The exon-intron structure of human LHX9 can be deduced presently by comparing our cDNA sequence (EMBL accession no. AJ277915) with the sequences available for BAC AC026278. A high degree of conservation is apparent with the murine ortholog, including all exon-intron junctions from exons 1–6 as determined by comparison to the data in Ref. 20 (all exon-intron junctions defined by us experimentally, and later confirmed in silico, are deposited; see EMBL accession no. AJ277916–20). It should be noted that exon 1 as described in Ref. 20 actually is composed of two exons, separated by an intron spanning 5 kb in human genomic DNA (as determined by PCR amplification and sequencing on BAC AC026278). This intron contains the untranslated exon mentioned above, which is spliced-in specifically in human testis (indicated as -1 in Fig. 1BGo; accession no. AJ296272). We verified that an intron exists in the same position in the mouse (data not shown) and observed that its 3' portion is conserved over a short distance from chick to mammals (compare GenBank accession no. L35566 in the chick with AC026278 in the human). Conservation in this region is likely to reflect a short extension of the open reading frame immediately 5' of exon 1. Accordingly, transcripts comprising the 3'-region of intron 1 joined to exon 1 could be amplified by 5'RACE-PCR (data not shown). They are predicted to encode an additional 19-amino acid-long peptide, which may be added N-terminal to some LHX9 isoforms (depicted as a black box in Fig. 1BGo). We maintain the term exon 1 to designate the 3' part of former exon 1 (18), as it contains the first ATG of the conceptual translation, whereas the 5' part of former exon 1 corresponds to one of multiple untranslated exons detected upstream of the ATG-encoding exon (indicated by -2 in Fig. 1BGo).

Mapping of LHX9

Mapping information for human LHX9 was determined in silico by searching the GenBank database for long stretches of over 97% nucleotide identity shared with the human LHX9 sequences. LHX9 sequences were detected in one BAC currently being sequenced (GenBank accession no. AC026278), which contains the marker D1S3146. This indicates that LHX9 maps to chromosome bands 1q25-q31 (htt:/ace/tree/1ace?name = stD1S3146&class = STS&squash = RH_data#RH_data). In addition, we found that BAC AC026278 overlaps with the sequence of a second BAC deposited in public databases (GenBank accession no. AL136136). The latter contains another marker (stSG33087FS/AL009995) that allows us to confirm the chromosomal localization to 1q25-q31.

Mutational screen

We restricted our study to patients with homogeneous 46,XY karyotypes in the absence of extragenital anomalies, particularly Turner syndrome, as autosomal LHX9 is not a candidate for clinical conditions involving aneuploidy of sex chromosomes. However, hidden 46,XY/45,X0 mosaicism cannot be excluded in some patients because of the incompleteness of clinical data.

Primers were designed to amplify exons 1–6, including stretches of adjacent intronic sequences and the conserved motif that is located immediately 5' of exon 1 (Table 2Go). Exons and exon-intron junctions were screened for mutations in the 58 46,XY female or sexually ambiguous patients described above, with the partial exception of exons 1 and 6. The latter were screened in a smaller number of patients (Table 2Go), as the encoded amino acid sequences are not predicted to fold into domains of known function.

Intronic single nucleotide polymorphisms were detected immediately 5' and 3' of exon 3 (G/C at -12 from start of exon 3, C/T at +13 from end of exon 3). In addition, a synonymous change in an asparagine-encoding triplet was observed in exon 4 (C/T at +8 from start of exon 4; Table 2Go). However, we were unable to detect mutations in over 2 kb of sequences analyzed in these patients.

Discussion

The LIM homeobox gene family is characterized by the presence of two N-terminal LIM domains, predominantly involved in protein-protein interactions, followed by a DNA-binding homeobox domain (reviewed in Ref. 19). One subgroup includes the vertebrate genes Lhx2 and Lhx9, which are highly homologous to the genes apterous in Drosophila and ttx-3 in Caenorhabditis. Most LIM homeobox genes studied to date are required for various developmental processes (19). Particularly, the Lhx2 knockout phenotype involves embryonically lethal malformations of the central nervous system in mice (16). Murine Lhx9 was recently isolated in mice by a degenerate RT-PCR cloning strategy based on homology with Lhx2 (17, 18) and was shown to cause gonadal agenesis when both LIM domains were homozygously deleted (14). Mouse Lhx9 is expressed in the developing brain, limb buds, and urogenital ridge (14, 17, 20).

We cloned the cDNA and determined the genomic structure of human LHX9, showing that it is highly similar to its murine counterpart in sequence, genomic organization, and expression pattern. Particularly, LHX9 displays conserved exon-intron junctions, including an intron that was missed by a previous study in the mouse (18). In addition, we provide evidence suggesting that the human gene encodes several differentially expressed transcripts, some with distinct untranslated 5'-ends. Our data indicate that LHX9 is subject to complex, partly sex-specific, regulatory events and are consistent with the hypothesis that this gene may have a role relevant to human gonadogenesis. The gene maps to a region on the long arm of human chromosome 1 that was not known to contain loci involved in sex determination. The absence of mutations in our screen indicates that mutation of the coding region of LHX9 is not a frequent cause of 46,XY sex reversal with gonadal dysfunction in humans. Nevertheless, the extent of evolutionary conservation suggests that potential mutations in this gene should be evaluated in all patients with isolated 46,XY gonadal agenesis or dysgenesis in presence of normal SRY sequences. We cannot exclude the possibility that the patients in this screen have mutations in the promoter region of LHX9. Future studies should also investigate the role of LHX9 in 46,XX individuals with gonadal maldevelopment.

Acknowledgments

We are indebted to the Obstetrics Department of the Hospital Corentin Celton (Issy-les-Moulineaux, France), headed by Dr. Elisabeth Fourrier, for kindly permitting collection of human embryos.

Footnotes

1 Supported by a fellowship from the University of Ferrara and an Italian grant under intergovernmental agreement of a Ph.D. thesis cotutorship between Italy and France (February 13, 1998). Back

Received July 18, 2000.

Revised November 3, 2000.

Accepted January 7, 2001.

References

  1. McElreavey K, Vilain E, Barbaux S, et al. 1993 A regulatory cascade hypothesis for mammalian sex determination: SRY represses a negative regulator of male development. Proc Natl Acad Sci USA. 90:3368–3372.[Abstract/Free Full Text]
  2. Kwok C, Goodfellow PN, Hawkins JR. 1996 Evidence to exclude SOX9 as a candidate gene for XY sex reversal without skeletal malformation. J Med Genet. 33:800–801.[Abstract/Free Full Text]
  3. Nordenskjold A, Fricke G, Anvret M. 1995 Absence of mutations in the WT1 gene in patients with XY gonadal dysgenesis. Hum Genet. 96:102–104.[CrossRef][Medline]
  4. Veitia RA, Nunes M, Quintana-Murci L, et al. 1998 Swyer syndrome and 46,XY partial gonadal dysgenesis associated with 9p deletions in the absence of monosomy-9p syndrome. Am J Hum Genet. 63:901–905.[CrossRef][Medline]
  5. Raymond CS, Parker ED, Kettlewell JR, et al. 1999 A region of human chromosome 9p required for testis development contains two genes related to known sexual regulators. Hum Mol Genet. 8:989–996.[Abstract/Free Full Text]
  6. Ottolenghi C, Veitia R, Quintana-Murci L, et al. 2000 The region on 9p associated with 46,XY sex reversal contains several transcripts expressed in the urogenital system and a novel doublesex-related domain. Genomics. 64:170–178.[CrossRef][Medline]
  7. Ottolenghi C, Veitia R, Barbieri M, Fellous M, McElreavey K. 2000 The human doublesex-related gene, DMRT2, is homologous to a gene involved in somitogenesis and encodes a potential bicistronic transcript. Genomics. 64:179–186.[CrossRef][Medline]
  8. De Marchi M, Campagnoli C, Ghiringhello B, Ponzio G, Carbonara A. 1981 Gonadal agenesis in a phenotypically normal female with positive H-Y antigen. Hum Genet. 56:417–419.[CrossRef][Medline]
  9. Mendonça BB, Barbosa AS, Arnhold IJ, McElreavey K, Fellous M, Moreira-Filho CA. 1994 Gonadal agenesis in XX and XY sisters: evidence for the involvement of an autosomal gene. Am J Med Genet. 52:39–43.[CrossRef][Medline]
  10. Smith NM, Byard RW, Bourne AJ. 1991 Testicular regression syndrome–a pathological study of 77 cases. Histopathology. 19:269–272.[Medline]
  11. Marcantonio SM, Fechner PY, Migeon CJ, Perlman EJ, Berkovitz GD. 1994 Embryonic testicular regression sequence: a part of the clinical spectrum of 46,XY gonadal dysgenesis. Am J Med Genet. 49:1–5.[CrossRef][Medline]
  12. Achermann JC, Ito M, Ito M, Hindmarsh PC, Jameson JL. 1999 A mutation in the gene encoding steroidogenic factor-1 causes XY sex reversal and adrenal failure in humans. Nat Genet. 22:125–126.[CrossRef][Medline]
  13. Little M, Wells C. 1997 A clinical overview of WT1 gene mutations. Hum Mutat. 9:209–225.[CrossRef][Medline]
  14. Birk OS, Casiano DE, Wassif CA, et al. 2000 The LIM homeobox gene Lhx9 is essential for mouse gonad formation. Nature. 403:909–913.[CrossRef][Medline]
  15. Berkovitz GD. 1992 Abnormalities of gonadal determination and differentiation. Semin Perinatol. 16:289–298.[Medline]
  16. Porter FD, Drago J, Xu Y, et al. 1997 Lhx2, a LIM homeobox gene, is required for eye, forebrain, and definitive erythrocyte development. Development. 124:2935–2944.[Abstract]
  17. Bertuzzi S, Porter FD, Pitts A, Kumar M, Agulnick A, Wassif C, Westphal H. 1999 Characterization of Lhx9, a novel LIM/homeobox gene expressed by the pioneer neurons in the mouse cerebral cortex. Mech Dev. 81:193–198.[CrossRef][Medline]
  18. Failli V, Rogard M, Mattei MG, Vernier P, Retaux S. 2000 Lhx9 and lhx9{alpha} LIM-homeodomain factors: genomic structure, expression patterns, chromosomal localization, and phylogenetic analysis. Genomics. 64:307–317.[CrossRef][Medline]
  19. Hobert O, Westphal H. 2000 Functions of LIM-homeobox genes. Trends Genet. 16:75–83.[CrossRef][Medline]
  20. Retaux S, Rogard M, Bach I, Failli V, Besson MJ. 1999 Lhx9: a novel LIM-homeodomain gene expressed in the developing forebrain. J Neurosci. 19:783–793.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
T. Hasegawa, M. Fukami, N. Sato, N. Katsumata, G. Sasaki, K. Fukutani, K.-I. Morohashi, and T. Ogata
Testicular Dysgenesis without Adrenal Insufficiency in a 46,XY Patient with a Heterozygous Inactive Mutation of Steroidogenic Factor-1
J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 5930 - 5935.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Vinci, M.-N. Anjot, C. Trivin, H. Lottmann, R. Brauner, and K. McElreavey
An Analysis of the Genetic Factors Involved in Testicular Descent in a Cohort of 14 Male Patients with Anorchia
J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 6282 - 6285.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ottolenghi, C.
Right arrow Articles by McElreavey, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ottolenghi, C.
Right arrow Articles by McElreavey, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals