| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Articles: Hormones and Reproductive Health |
Immunogénétique Humaine, INSERM E0025, Institut Pasteur (C.O., M.F., K.M.), 75724 Paris, France; Dipartimento di Morfologia ed Embriologia, Università di Ferrara (C.O., M.B.), 44100 Ferrara, Italy; Department of Immunology, Institute of Biomedical Sciences, University of Sao Paulo (C.M.-F.), and Hospital das Clinicas-FMUSP, University of Sao Paulo School of Medicine (B.B.M.), 05508 Sao Paulo, Brazil; and Division of Pediatric Endocrinology, University of Miami School of Medicine (G.D.B.), Miami, Florida 33136
Address all correspondence and requests for reprints to: Dr. Ken McElreavey, INSERM, U-276, Immunogenetique Humaine, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex, France.
Abstract
The etiology of most cases of 46,XY gonadal dysgenesis in the absence of extragenital anomalies is not accounted for by mutations in the genes known to date to be involved in sex determination. We have investigated the possibility that mutations in the gene LHX9, whose murine ortholog causes isolated gonadal agenesis when inactivated, might be responsible for gonadal dysgenesis and agenesis in humans. We isolated a human LHX9 complementary DNA (cDNA), mapped the gene to the long arm of human chromosome 1, and determined its genomic structure. We found that LHX9 is highly conserved between species, sharing in particular over 98% amino acid identity. A mutational screen was performed in a sample of patients with a range of gonadal maldevelopment, including bilateral gonadal agenesis in two sisters with an opposite sex karyotype. We did not detect mutations in the open reading frame of LHX9 in the patients studied. However, the extent of between-species structural conservation suggests that LHX9 deserves further consideration as a determinant of gonadal function in humans.
IN HUMANS, mutations in the master sex regulator gene SRY are harbored by less than 20% of sex-reversed patients with complete 46,XY gonadal dysgenesis (1). Mutations in all other genes known to be involved in 46,XY gonadal dysgenesis are systematically associated with extragenital anomalies (2, 3). This involves mutations on such genes as WT-1, SOX-9, SF-1 (2, 3). In addition, no intragenic mutations or rearrangements have been detected in three genes related to the invertebrate sex regulators doublesex and mab-3 positioned in the region on 9p that is known to be deleted in some patients with isolated 46,XY gonadal dysgenesis (Refs. 4, 5, 6, 7 and references therein). Therefore, the etiology of the majority of cases of isolated 46,XY gonadal dysgenesis is still undetermined 10 yr after the discovery of SRY.
46,XY bilateral agonadism in the presence of normal female genitalia and no other anomalies represents an exceptional clinical finding. A patient was described by De Marchi et al. (8), and we have previously reported two sisters with normal female phenotype but bilateral agonadism, one having a 46,XY and the other a 46,XX karyotype, who were born to a consanguineous marriage (9). In these patients, involution of gonads must have preceded the time of sex determination. This contrasts with the condition associating a normal 46,XY male phenotype with unilateral or bilateral agonadism, as normal masculinization is highly suggestive of gonadal loss occurring at later developmental stages. Here, mechanical causes, particularly intrauterine torsion of the spermatic cords, may represent the underlying mechanism (10). However, in other patients masculinization has been found to be incomplete. These individuals present with 46,XY bilateral agonadism or associating 46,XY unilateral gonadal loss with a dysgenetic gonad on the other side of the body (11). In such patients, gonads must have been functionally abnormal before their disappearance. This suggests that in some cases, 46,XY gonadal agenesis and 46,XY gonadal dysgenesis may have a common origin, referred to as embryonic testicular regression sequence (11). As indirect evidence in favor of this, one may also consider that heterozygous mutations of two genes responsible for gonadal agenesis in the mouse when homozygously inactivated (Wt-1, Sf-1) are associated with 46,XY gonadal dysgenesis in human patients (Refs. 12 and 13 and references therein).
Recently, targeted disruption of a mouse LIM homeobox, Lhx9, was found to induce gonadal agenesis onto both sex karyotypes and was accompanied by XY male to female sex reversal in the absence of other anomalies (14), making it an interesting candidate gene for isolated 46,XY gonadal agenesis or dysgenesis in presence of a normal SRY gene. We have determined the genomic structure, chromosomal location, and expression pattern of human LHX9 and performed a mutational screen of 58 patients with a 46,XY karyotype and various forms of gonadal dysfunction. Although we did not detect mutations in this screen, we emphasize that LHX9 deserves further study on the basis of its high structural conservation with its murine counterpart.
Subjects and Methods
Subjects and human embryos
All clinical reports indicated that extragenital anomalies
(except for an ectopic kidney in a fetus) were absent, and homogeneous
46,XY karyotype was recorded. The clinical findings, the number of
cells counted per karyotype, and the heights of the patients analyzed
in this study are summarized in Tables 1–3
. The following genital
phenotypes were represented: 1) 46,XY complete gonadal dysgenesis, as
defined in Ref. 15 (Table 1
shows data for 14 patients of 27 tested, as cell counts and heights
were not available for the remaining patients), is characterized by
streak gonads (fibrous tissue and ovarian-like stroma; n = 49
gonads) and/or immature gonads (undifferentiated cords, in two fetal
gonads and three additional adult gonads) in the absence of testicular
tissue, whereas the phenotype is a normal female; 2) 46,XY partial
gonadal dysgenesis, as also defined in Ref. 15 (n =
17; Table 2), is characterized by the
presence of dysgenetic testicular tissue (disorganized seminiferous
tubules or dispersed single Sertoli cells in at least one gonad in
association, or not, with fibrous tissue and ovarian-like stroma in the
same or in the other gonad) and female or ambiguous genitalia; 3) 46,XY
female agonadism (one of the sisters with opposite sex karyotypes
previously described by us (9) and two additional,
unrelated 46,XY agonadic female patients (see Table 3, patients AG1–3); 4) testicular
regression syndrome (n = 7; see Table 3, patients 225–242 and
TR1–3) is characterized by 46,XY karyotype in the presence of
unilateral agonadism with partial phenotypical masculinization or
bilateral agonadism with either partial or complete phenotypical
masculinization (four cases were described by one of us in Ref.
11); and 5) 46,XY pseudohermaphroditism is characterized
by histologically normal testes and ambiguous external genitalia, in
presence of Mullerian derivatives (n = 3). The anti-Mullerian
hormone was undetectable, suggesting gonadal dysfunction.
|
|
|
Genomic structure and sequence analysis
In silico analysis was performed by standard nucleotide identity searches (BLASTN) against public sequence databases (nr, dbest, and htgs divisions of GenBank).
Adult tissue samples used for cDNA amplification were purchased from
Life Technologies, Inc. (cloned testis library), and
CLONTECH Laboratories, Inc. (human normalized cDNA panel
II, Palo Alto, CA). The membrane used for Northern blot hybridization
was purchased from CLONTECH Laboratories, Inc. (MTN H2).
The probe, spanning from exons 2–5, was synthesized from testis cDNA
by PCR amplification (58 C annealing temperature and 1-min extension
time per PCR cycle over 35 cycles; primer sequences,
ccgctcagcccggagaagcccgcc and ctcttgccgcaaaaggttccttct). The temperature
and time of the denaturation step were 94 C and 30 s in all PCR
reactions using PTC-100 and PTC-200 thermal cycler machines provided
with a hot lid (MJ Research, Inc., Cambridge, MA). The
same primers and PCR conditions were used to study LHX9
messenger RNA expression in human embryos (Fig. 2B). Primers and PCR
conditions for amplification of exons 1 and 2 in adult tissues (Fig. 2D) were as follows: ggcatcatggaggagatggagcgc (forward),
aagcaggtgagctcggactcgagg (reverse), 60 C annealing temperature, and
1-min extension time. Northern blot hybridization was performed
overnight at 65 C in standard Church hybridization buffer.
Amplification of major LHX9 isoforms (Fig. 2C) was obtained
by nested PCR. The following primers were used in primary PCR:
gtgatccactccttttcctgtaag and ctgcagatgctacacaccaagctg for exon 1–5
amplification; and gtgatccactccttttcctgtaag and tcactgcagtggatttccgatca
for exon 1–6 amplification. Products of primary PCR were diluted 1:25,
and an aliquot was used for secondary PCR (final dilution, 1:250;
primer sequences, taagaatgctgaacggtaccactc and
gggcctcagtcttggatctgcgctc). PCR conditions were as follows: 55 C
annealing temperature and 6-min extension time per cycle for primary
PCR, and 65 C annealing temperature and 3-min extension time for
secondary PCR. All PCR reactions performed on cDNA were designed to
produce amplicons spanning one or more introns, thus excluding any
genomic DNA amplification.
|
The primers and PCR conditions for amplification and sequencing of
patient DNA samples are indicated in Table 4. PCR amplification products were
sequenced on an automated capillary electrophoresis system (ABI PRISM
3700, Perkin-Elmer Corp., Foster City, CA).
|
Genomic structure and expression pattern of human LHX9
We determined the cDNA sequence of human LHX9 partially
in silico by comparing two ESTs in public databases with the
sequence of mouse Lhx9 (GenBank accession no. AA316988,
AA382798, and AF116518, respectively). This allowed us to design
primers for direct PCR amplification of a full-length cDNA from a
testis library (cDNA sequence deposited in public database; EMBL
accession no. AJ277915). The putative protein encoded by this cDNA was
over 98% identical to the mouse counterpart at the amino acid level
(Fig. 1). We found by RT-PCR that the
abdominal region of human embryos of both sexes expresses
LHX9 at the time of gonadal formation (Fig. 2B
), consistent with in situ
hybridization studies performed in mice (14, 17, 18).
Expression in adult tissues was widespread, as determined by Northern
blot hybridization (Fig. 2A) and by PCR on normalized cDNA preparations
(Fig. 2D). Several bands were detected by Northern blot hybridization,
the longest one (size of about 4.7 kb) being stronger in testis than
ovary. In addition, we obtained several distinct transcripts of human
LHX9 by 5'RACE-PCR experiments in four tissues, suggesting
the existence of multiple transcription initiation sites and
alternatively spliced exons in 5'-untranslated regions (data not
shown). Particularly, one 5'-untranslated exon (indicated by -1 in
Fig. 1B) was detected by RT-PCR in testis and not in ovary or other
tissues (data not shown; accession no. AJ296272). We also verified that
the counterparts of the two isoforms described in the mouse,
characterized by use of exon 5 vs. exon 6 as alternative
3'-terminal exons, are expressed in human gonads (Fig. 2C).
Interestingly, we observed that their relative levels of expression
differ between testis and ovary (Fig. 2C and data not shown; EMBL
accession no. AJ277914 for human exon 6-containing 3'-end). These
preliminary data suggest that expression of human LHX9 is
subject to complex, partly sex-specific, regulatory events involving
transcription initiation and alternative splicing. Detailed
investigations of the differential expression patterns of
LHX9 transcripts are under way.
|
;
accession no. AJ296272). We verified that an intron exists in the same
position in the mouse (data not shown) and observed that its 3' portion
is conserved over a short distance from chick to mammals (compare
GenBank accession no. L35566 in the chick with AC026278 in the human).
Conservation in this region is likely to reflect a short extension of
the open reading frame immediately 5' of exon 1. Accordingly,
transcripts comprising the 3'-region of intron 1 joined to exon 1 could
be amplified by 5'RACE-PCR (data not shown). They are predicted to
encode an additional 19-amino acid-long peptide, which may be added
N-terminal to some LHX9 isoforms (depicted as a black box in
Fig. 1B). We maintain the term exon 1 to designate the 3' part
of former exon 1 (18), as it contains the first ATG of the
conceptual translation, whereas the 5' part of former exon 1
corresponds to one of multiple untranslated exons detected upstream of
the ATG-encoding exon (indicated by -2 in Fig. 1B). Mapping of LHX9
Mapping information for human LHX9 was determined in silico by searching the GenBank database for long stretches of over 97% nucleotide identity shared with the human LHX9 sequences. LHX9 sequences were detected in one BAC currently being sequenced (GenBank accession no. AC026278), which contains the marker D1S3146. This indicates that LHX9 maps to chromosome bands 1q25-q31 (htt:/ace/tree/1ace?name = stD1S3146&class = STS&squash = RH_data#RH_data). In addition, we found that BAC AC026278 overlaps with the sequence of a second BAC deposited in public databases (GenBank accession no. AL136136). The latter contains another marker (stSG33087FS/AL009995) that allows us to confirm the chromosomal localization to 1q25-q31.
Mutational screen
We restricted our study to patients with homogeneous 46,XY karyotypes in the absence of extragenital anomalies, particularly Turner syndrome, as autosomal LHX9 is not a candidate for clinical conditions involving aneuploidy of sex chromosomes. However, hidden 46,XY/45,X0 mosaicism cannot be excluded in some patients because of the incompleteness of clinical data.
Primers were designed to amplify exons 1–6, including stretches of
adjacent intronic sequences and the conserved motif that is located
immediately 5' of exon 1 (Table 2). Exons and exon-intron junctions
were screened for mutations in the 58 46,XY female or sexually
ambiguous patients described above, with the partial exception of exons
1 and 6. The latter were screened in a smaller number of patients
(Table 2), as the encoded amino acid sequences are not predicted to
fold into domains of known function.
Intronic single nucleotide polymorphisms were detected immediately 5'
and 3' of exon 3 (G/C at -12 from start of exon 3, C/T at +13 from end
of exon 3). In addition, a synonymous change in an asparagine-encoding
triplet was observed in exon 4 (C/T at +8 from start of exon 4; Table 2). However, we were unable to detect mutations in over 2 kb of
sequences analyzed in these patients.
Discussion
The LIM homeobox gene family is characterized by the presence of two N-terminal LIM domains, predominantly involved in protein-protein interactions, followed by a DNA-binding homeobox domain (reviewed in Ref. 19). One subgroup includes the vertebrate genes Lhx2 and Lhx9, which are highly homologous to the genes apterous in Drosophila and ttx-3 in Caenorhabditis. Most LIM homeobox genes studied to date are required for various developmental processes (19). Particularly, the Lhx2 knockout phenotype involves embryonically lethal malformations of the central nervous system in mice (16). Murine Lhx9 was recently isolated in mice by a degenerate RT-PCR cloning strategy based on homology with Lhx2 (17, 18) and was shown to cause gonadal agenesis when both LIM domains were homozygously deleted (14). Mouse Lhx9 is expressed in the developing brain, limb buds, and urogenital ridge (14, 17, 20).
We cloned the cDNA and determined the genomic structure of human LHX9, showing that it is highly similar to its murine counterpart in sequence, genomic organization, and expression pattern. Particularly, LHX9 displays conserved exon-intron junctions, including an intron that was missed by a previous study in the mouse (18). In addition, we provide evidence suggesting that the human gene encodes several differentially expressed transcripts, some with distinct untranslated 5'-ends. Our data indicate that LHX9 is subject to complex, partly sex-specific, regulatory events and are consistent with the hypothesis that this gene may have a role relevant to human gonadogenesis. The gene maps to a region on the long arm of human chromosome 1 that was not known to contain loci involved in sex determination. The absence of mutations in our screen indicates that mutation of the coding region of LHX9 is not a frequent cause of 46,XY sex reversal with gonadal dysfunction in humans. Nevertheless, the extent of evolutionary conservation suggests that potential mutations in this gene should be evaluated in all patients with isolated 46,XY gonadal agenesis or dysgenesis in presence of normal SRY sequences. We cannot exclude the possibility that the patients in this screen have mutations in the promoter region of LHX9. Future studies should also investigate the role of LHX9 in 46,XX individuals with gonadal maldevelopment.
Acknowledgments
We are indebted to the Obstetrics Department of the Hospital Corentin Celton (Issy-les-Moulineaux, France), headed by Dr. Elisabeth Fourrier, for kindly permitting collection of human embryos.
Footnotes
1 Supported by a fellowship from the University of Ferrara and an
Italian grant under intergovernmental agreement of a Ph.D. thesis
cotutorship between Italy and France (February 13, 1998). 
Received July 18, 2000.
Revised November 3, 2000.
Accepted January 7, 2001.
References
LIM-homeodomain factors: genomic structure,
expression patterns, chromosomal localization, and phylogenetic
analysis. Genomics. 64:307–317.[CrossRef][Medline]
This article has been cited by other articles:
 |
|
 |
|
  T. Hasegawa, M. Fukami, N. Sato, N. Katsumata, G. Sasaki, K. Fukutani, K.-I. Morohashi, and T. Ogata Testicular Dysgenesis without Adrenal Insufficiency in a 46,XY Patient with a Heterozygous Inactive Mutation of Steroidogenic Factor-1 J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 5930 - 5935. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Vinci, M.-N. Anjot, C. Trivin, H. Lottmann, R. Brauner, and K. McElreavey An Analysis of the Genetic Factors Involved in Testicular Descent in a Cohort of 14 Male Patients with Anorchia J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 6282 - 6285. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
,
Intron positions. Asterisks mark amino acid identities.
B, Schematic representation of the genomic structure of human
LHX9, showing two 5'-untranslated exons (boxes labeled
-1 and -2) and the protein-encoding exons 1–6 (see text). LIM domain
and homeobox domains are shown in gray, and the
alternative N-terminus-encoding motif upstream of exon 1 is in
black. V-Shaped lines indicate messenger RNA splicing
events removing introns, and vertical bars show the
positions of the two putative, translation initiation sites.