help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busuttil, B. E.
Right arrow Articles by Frauman, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Busuttil, B. E.
Right arrow Articles by Frauman, A. G.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 5 2315-2319
Copyright © 2001 by The Endocrine Society


Original Studies

Extrathyroidal Manifestations of Graves’ Disease: The Thyrotropin Receptor Is Expressed in Extraocular, But Not Cardiac, Muscle Tissues1

Bridget E. Busuttil and Albert G. Frauman

Clinical Pharmacology and Therapeutics Unit, Department of Medicine, Austin and Repatriation Medical Center, University of Melbourne, Heidelberg, Victoria 3084, Australia

Address all correspondence and requests for reprints to: Dr. Albert G. Frauman, Clinical Pharmacology and Therapeutics Unit, Department of Medicine, Austin and Repatriation Medical Center, University of Melbourne, Austin Campus, Heidelberg, Victoria 3084, Australia. E-mail: nicola{at}austin.unimelb.edu.au


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The existence of an autoantigen common to Graves’ disease and its associated extrathyroidal manifestations has been proposed. As the TSH receptor (TSHR) is the primary target for autoimmunity against the thyroid in Graves’ disease, much effort has gone into investigating the role of TSHR messenger ribonucleic acid (mRNA) transcripts in extrathyroidal tissue, particularly in the orbit. A high stringency RT-PCR technique had previously been employed by our laboratory to demonstrate the presence of full-length and splice variant TSHR mRNA in extraocular muscle (EOM). This technique demonstrated selective amplification of TSHR mRNA transcripts in thyroid and EOM, but not in abdominal muscle, kidney, or brain tissue. We used this technique in the present study to investigate the reported presence of TSHR mRNA transcripts in cardiac tissue. After removal of all visible fat from muscle tissues, high stringency RT-PCR was performed, and we found no TSHR transcripts in the muscle of any chamber of the normal human heart. In addition, in situ hybridization on fresh-frozen and paraffin-embedded sections confirmed the presence of TSHR transcripts in thyroid and EOM, but not in abdominal or cardiac muscle. These findings support the hypothesis that the TSHR is a shared antigen in the thyroid and EOM, but not in cardiac muscle.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE DEVELOPMENT of Graves’ ophthalmopathy (GO) usually occurs about the time that Graves’ disease (GD) is present and is believed to be a related autoimmune phenomenon (1, 2, 3). The existence of an autoantigen common to GD and GO has been proposed; however, its identity has not been convincingly established. It is generally accepted that the TSH receptor (TSHR) is the primary target for autoimmune attack in the thyroid of GD patients (4). There is some functional (5) and molecular evidence (6, 7, 8, 9, 10, 11, 12, 13) that the TSHR is also present in orbital tissue. The IgG fraction from the sera of patients with GO preferentially stimulates porcine extraocular myoblasts compared with nonocular myoblasts (5). In addition, extraocular muscle (EOM) (8, 9, 10), orbital fat (7, 11, 13), and fibroblasts residing in the orbital connective tissue (9, 12, 13) have all been shown to express TSHR messenger ribonucleic acid (mRNA).

Studies using PCR techniques have also detected the presence of TSHR mRNA in human (14, 15) and porcine (16) cardiac tissue. One of these studies examined a myocardial biopsy from a 25-yr-old man with GD, who developed cardiomyopathy with severe heart failure (15). Lymphocytic infiltration and degenerative changes were observed in the biopsy. This suggested that the development of cardiac manifestations in association with GD may also have an direct autoimmune etiology and perhaps share an antigen common to heart and thyroid. The objective of the present study was to confirm the expression of TSHR mRNA in thyroid, EOM, and normal human heart using high stringency RT-PCR and in situ hybridization.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue specimens

Fresh frozen. Approval was obtained from the human research ethics committee of the Austin and Repatriation Medical Center to collect human heart muscle from left and right ventricles and atria (~1 g of each), EOM (~1 g superior rectus), abdominal muscle (~1 g), and thyroid at autopsy from aged male subjects not suffering from thyroidal, cardiac, or skeletal muscle disorders, within 12 h of death. Muscle samples were carefully stripped of all visible fat, were placed immediately into sterile thick-walled polypropylene tubes, frozen, and stored at -70 C until required. Sections were cut 10 µm thick and placed onto 2% silane-coated slides.

Paraffin embedded. Tissues were collected at the time of autopsy and fixed in 10% formalin, then embedded in paraffin. Tissue sections were cut 4 µm thick and placed onto 2% silane-coated sides.

RNA extraction

Total RNA was extracted from fresh-frozen tissues using the guanidium thiocyanate method described by Chomczynski and Sacchi (17).

RT

Total RNA (100 ng) was reverse transcribed using a previously described method (10).

High stringency PCR

A single round of a modified "touchdown" PCR method was used to detect mRNA transcripts under conditions of high hybridization stringency (10, 18). This method has been described in full previously (10), but in brief this procedure involved a "hot start" of 3 min at 94 C, followed by five cycles of 94, 70, and 74 C for 30 sec each, then 35 cycles of 94, 55, and 74 C for 30 sec each, with a final 5-min incubation at 74 C. The primers used are listed in Table 1Go. The PCR products were blotted onto nylon membrane (Hybond N+, Amersham Pharmacia Biotech, Sydney, Australia) after electrophoresis.


View this table:
[in this window]
[in a new window]
 
Table 1. Primer sequences used for high stringency RT-PCR (5'-3')

 
Southern blotting and hybridization analysis

A probe complementary to bases 493–476 (5'-3') of the TSHR complementary DNA (cDNA; CATGTAAGGGTTGTCTGT) as well as probes to bases 398–324 of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (TTCACCACCATGGAGAAGGCTGGGGCT) and bases 1155–1176 of the angiotensinogen gene (CTGCAAGGATCTTATGACCTGC) were 32P 5'-end labeled for use as a probe in Southern analysis. Each probe (50 ng) was incubated in a final volume of 10 µL containing 50 mmol/L Tris (pH 7.6), 10 mmol/L MgCl2, 10 mmol/L 2-mercaptoethanol, 50 µCi [{gamma}-32P]ATP, and 20 U T4 polynucleotide kinase (Amersham Pharmacia Biotech) for 45 min in a 37 C water bath. Membranes containing transferred PCR products were prehybridized in Rapid-Hyb solution (Amersham Pharmacia Biotech) for 10 min at 42 C. After prehybridization, the radiolabeled probe was added and hybridized to membranes at 42 C for 1.5 h. Membranes were then washed twice in 2x SSC (standard saline citrate) containing 0.1% SDS for 10 min at 42 C and once with 1x SSC containing 0.1% SDS for 10 min at 42 C. Membranes were then wrapped in polypropylene film and exposed to photographic film (X-OMAT AR, Kodak, Integrated Sciences, Kew, Australia) for autoradiography.

In situ hybridization

Pretreatment of fresh-frozen specimens. After sectioning, the slides were incubated for 2 min in PBS buffer, for 2 min in 70% ethanol, for 5 min in absolute ethanol, and for 15 min in chloroform, then rinsed in absolute ethanol and stored at 4 C in absolute ethanol. Slides were removed from the ethanol and allowed to dry at room temperature before hybridization.

Pretreatment of paraffin-embedded specimens. Before in situ hybridization, sections were deparaffinized in xylene (7.5 min, twice) and rehydrated in graded ethanol. Sections were then rinsed in 2 changes of diethylpyrocarbonate-treated distilled water and rinsed in 10 mmol/L citrate buffer, pH 6.0. Sections were placed in glass racks (20 slides/rack) and submerged in approximately 250 mL citrate buffer in covered glass tubs. Sections were then microwaved in a 900-watt microwave (Panasonic Matsushita Electric, Danville, MA) 3 times for 5 min each time at full power, topped up with additional citrate buffer to compensate for evaporation. Slides were allowed to cool slightly, then were rinsed in 2 changes of diethylpyrocarbonate-treated distilled water, dehydrated in graded ethanol, and dried.

Oligonucleotide labeling and hybridization. Two nonoverlapping 39-mer oligonucleotide probes complementary to bases 680–718 and 2172–2210 of the human TSHR gene were synthesized (Life Technologies, Inc., Melbourne, Australia) and used to detect TSHR mRNA in fresh-frozen sections. Five nonoverlapping 39-mer oligonucleotide probes complementary to bases 88–126, 680–718, 1262–1300, 1526–1564, and 2172–2210 of the human TSHR gene were used to detect TSHR mRNA in the paraffin-embedded sections. The sequence specificities of the probes were investigated using a gene sequence database (NIH Blast Email Network Service) and were shown not to cross-react with any known human gene in the database. The 3'-end labeling of the probes and hybridization of the labeled probes to the tissue sections was carried out using a previously described method (19).

Analysis

Semiquantitative analysis of TSHR mRNA levels in the various tissues was conducted using computer-assisted densitometry of x-ray film autoradiographs (MCID image analysis system, Imaging Research, Inc., Toronto, Canada). The films were scanned, and the intensity of each image was converted, by the MCID software, into a colored scale (blue was least intense, red to black was most intense). For each image, 10 areas of the same sample size and approximately equal tissue density were measured (against standards) to give a numerical value for the intensity of binding. These 10 readings were averaged to give a numeral value (in disintegrations per min) of labeling intensity for each tissue. The results for each tissue were then compared by one-way ANOVA (Tukey’s test), followed by Student-Newman-Keuls test; P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RT-PCR and Southern blot analysis

High stringency RT-PCR using primers specific for the full-length and the splice variant TSHR cDNA (Table 1Go) demonstrated amplification of PCR fragments of the expected size in both the EOM (n = 5) and thyroid (n = 1), but not in the abdominal muscle (Abd; n = 5) or any of the four chambers of the normal human heart (n = 5). The water control was consistently negative. These results were consistent for both the ethidium bromide-stained gels of the RT-PCR products and the Southern blot (Fig. 1Go). High stringency RT-PCR and Southern blotting for GAPDH and angiotensinogen were also preformed in all tissues tested to verify both the integrity of the RNA preparations and the success of the RT step. The possibility of genomic contamination was eliminated by designing the PCR primers to span exons (Table 1Go).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. High stringency RT-PCR (left) and Southern blot (right) results. GAPDH and angiotensinogen are present in all tissue types tested. TSHR mRNA transcripts are present in thyroid and EOM only. Exons 1–7 of the TSHR are represented above; the other exons investigated gave the same results. The water blank was consistently negative. 1, Left ventricle; 2, right ventricle; 3, left atrium; 4, right atrium; 5, extraocular muscle; 6, abdominal muscle; 7, thyroid; 8, water blank.

 
In situ hybridization film autoradiographs

High levels of specific hybridization were observed for both thyroid and EOM tissues (Fig. 2Go, A–D). Follicular shapes were discernible on the film for the thyroid, and nonspecific binding appeared minimal for all tissues. Labeling in all chambers of the normal human heart and abdominal muscle tissue appeared to be at background levels (Fig. 2Go, E–N). Densitometric measurements from the autoradiographs using MCID image analysis gave mean (±SD) specific counts of 1024 ± 232 dpm for thyroid (n = 5) vs. 333 ± 228 dpm for EOM (n = 4) and 96 ± 82 dpm for abdominal muscle (n = 3). Measurements for individual chambers of the heart had mean values of 86–150 dpm for each of the four cardiac chambers.



View larger version (168K):
[in this window]
[in a new window]
 
Figure 2. Representative in situ hybridization film autoradiographs showing the degree of hybridization in each tissue. The results shown were produced by probing fresh-frozen tissues with two radioactively labeled TSHR-specific oligonucleotides. Specific binding and nonspecific binding in the thyroid (A and B, respectively), extraocular muscle (C and D, respectively), abdominal muscle (E and F, respectively), left ventricle (G and H, respectively), right ventricle (I and J, respectively), left atrium (K and L, respectively ), and right atrium (M and N, respectively) are shown. High levels of hybridization are present in both thyroid and EOM; nonspecific binding appears minimal. Specific labeling in all chambers of normal human heart and in abdominal muscle tissue appeared to be at background levels.

 
Statistical analysis using ANOVA followed by Student-Newman-Keuls test showed that only labeling in the thyroid and EOM was significantly above background, whereas labeling in all other tissues was comparable to background (P < 0.05).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Using high stringency RT-PCR we identified both the full-length (20) and the 1.3-kb splice variant (21) TSHR mRNA in thyroid and EOM tissues, but not in abdominal muscle or in the muscle of any of the four chambers of the normal human heart. The possibility that RT-PCR products too faint to be visible on the ethidium bromide-stained gels may have been present in the apparently negative tissues was addressed by performing Southern blot analysis. No such bands were detected using this sensitive technique. In situ hybridization demonstrated probe hybridization only in those tissues that were positive for high stringency RT-PCR, thereby adding further support to the PCR results. These observations are seemingly in contrast to the findings of other groups (14, 15).

Drvota and co-workers reported the presence of exons 9 and 10 of the TSHR gene in human cardiac tissue using a single round of a conventional PCR protocol (the number of specimens investigated was not reported) (14). Koshiyama and co-workers attempted to amplify a fragment of the TSHR from a normal human heart cDNA library, spanning exons 7–10 using a single round of PCR, but were unable to produce a product of the correct size (15). A second PCR reaction amplified a sequence internal to the first PCR product, which spanned exons 9 and 10 (i.e. nested PCR) and was of the expected size (n = 1). This group also investigated the presence of the TSHR mRNA in porcine cardiac tissue (n = 2) using a technique similar to that described for the human investigation (16). This latter study found differential expression of TSHR mRNA in the heart, with the highest expression levels in the right atrium, coronary artery, and epicardial fat and the lowest levels in the ventricular myocardium (16).

Conventional RT-PCR and nested RT-PCR are extremely powerful techniques with the sensitivity to amplify templates in very low abundance. Although this sensitivity is useful in detecting low levels of transcription, it has previously been reported to amplify "illegitimate transcripts," which are produced as a result of "leaky" transcription (22), i.e. transcription that presumably occurs incidentally rather than intentionally. Because illegitimate transcripts exhibit the same characteristics as legitimate transcripts, care must be taken not to amplify them. However, these transcripts also exhibit the same mutations as "legitimate" transcripts and have been used to study inherited diseases (23).

By including positive and negative controls and by limiting the number of amplification cycles, the detection of illegitimate transcripts may be avoided. None of the earlier reports on the presence of TSHR mRNA in the heart (14, 15, 16) included negative control tissues, and all of these reports had small or unreported sample sizes. The possibility that these earlier studies amplified illegitimate transcripts or a contaminant (such as fat, which has been demonstrated to express TSHR mRNA) therefore cannot be excluded.

The present study used a modified hot start-touchdown PCR method (18), which included an initial incubation at 94 C (hot start), followed by 5 cycles with an elevated primer hybridization temperature (70 C) and then an additional 35 cycles with a step down to a standard primer hybridization temperature (55 C). This protocol had previously been demonstrated to give sensitive and specific amplification of PCR products, with discrimination between tissues (10, 18). Using this protocol TSHR cDNA was identified in thyroid and EOM tissues, but not in abdominal muscle [as previously reported (10)] or cardiac tissue (see Fig. 1Go).

The possibility that the negative tissue results observed were due to degraded mRNA or ineffective RT was also addressed. PCR for the housekeeping gene GAPDH and the angiotensin precursor, angiotensinogen [previously demonstrated to be expressed in the normal human heart (24)] were performed concurrently on the same RT products used to investigate the presence of TSHR mRNA. These control PCRs gave strong positive results (Fig. 1Go), indicating good quality mRNA and successful RT.

The in situ hybridization study showed significant TSHR mRNA labeling in thyroid and EOM tissue sections, but not in abdominal or cardiac muscle. The oligonucleotide sequences chosen were screened against a sequence database using a BLAST search to ensure that the probes would not recognize any known human gene sequences other than the TSHR. The insignificant level of binding in the nonspecific controls suggests that the oligonucleotide probes were specific and that cross-reactivity with other mRNA species did not occur.

The observation in the present studies that TSHR mRNA hybridization only occurred in thyroid and EOM tissues reflects results observed using RT-PCR. Examination of the in situ hybridization autoradiographic films suggests that the localization of labeling in the thyroid occurs in the tissue making up the follicular epithelium, whereas the lumen appears to be void of label. Microscopic analysis of these tissues was not possible, as the emulsion-dipped slides did not produce sufficient silver grains for analysis. This does leave open the possibility that the TSHR mRNA detected in the EOM might be located within the fibroblast or fat cells residing within the muscle bundles. Although both of these cell types have been shown to express TSHR mRNA, the amount of TSHR mRNA expression in normal adipose tissue of orbital and intestinal origin has been reported to be very low (11). If fat cells were responsible for the TSHR mRNA observed in the EOM tissue of the present study, then comparable levels of labeling might also be expected in abdominal muscle. In addition, although it may be argued that orbital fibroblasts might selectively express TSHR mRNA compared with abdominal fibroblasts, thereby accounting for the differential expression observed, the density of fibroblasts in EOM would not be sufficient (when contiguous hematoxylin- eosin-stained tissues were examined under the microscope; data not shown) to account for the extent of labeling observed with in situ hybridization. Therefore, although adipose tissue and fibroblasts might conceivably contribute to the amount of TSHR mRNA observed in the EOM, they do not appear to account for all of it, suggesting that EOM fibers are a source of additional transcripts. Taken together, the present findings support the hypothesis that the TSHR is shared between thyroid and EOM, but not cardiac muscle, and may be a common autoantigen for GO.


    Acknowledgments
 
We thank Dr. J. Ireton and the staff of the Department of Anatomical Pathology, Austin and Repatriation Medical Center, for autopsy specimens and paraffin-embedded sections.


    Footnotes
 
1 This work was supported by an Australian Postgraduate Award (Industry)/Australian Research Council Scholarship and funds from the Austin Hospital Medical Research Foundation. Back

Received March 13, 2000.

Revised January 22, 2001.

Accepted January 29, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Perros P, Kendall-Taylor P. 1993 Pathogenesis of thyroid-associated ophthalmopathy. Trends Endocrinol Metab. 4:270–275.[CrossRef][Medline]
  2. Burch H, Wartofsky L. 1993 Graves’ ophthalmopathy: current concepts regarding pathogenesis and management. Endocr Rev. 14:747–793.[Abstract/Free Full Text]
  3. Bahn R, Heufelder A. 1993 Mechanisms of disease: pathogenesis of Graves’ ophthalmopathy. N Engl J Med. 329:1468–1475.[Free Full Text]
  4. Burman KD, Baker JR. 1985 Immune mechanisms in Graves’ disease. Endocr Rev. 6:183–232.[Abstract/Free Full Text]
  5. Perros P, Kendall-Taylor P. 1992 Biological activity of autoantibodies from patients with thyroid-associated ophthalmopathy: in vitro effects on porcine extraocular myoblasts. Q J Med. 84:691–706.[Abstract/Free Full Text]
  6. Heufelder AE, Dutton CM, Sarkar G, Donovan KA, Bahn RS. 1993 Detection of TSH receptor RNA in cultured fibroblasts from patients with Graves’ ophthalmopathy and pretibial dermopathy. Thyroid. 3:297–300.[Medline]
  7. Feliciello A, Porcellini A, Ciullo I, Bonavolonta G, Avvedimento EV, Fenzi G. 1993 Expression of thyrotropin-receptor mRNA in healthy and Graves’ disease retro-orbital tissue. Lancet. 342:337–338.[CrossRef][Medline]
  8. Paschke R, Metcalfe A, Alcalde L, Vassart G, Weetman A, Ludgate M. 1994 Presence of nonfunctional thyrotropin receptor variant transcripts in retroocular and other tissues. J Clin Endocrinol Metab. 79:1234–1238.[Abstract]
  9. Hiromatsu Y, Sato M, Inoue Y, et al. 1996 Localization and clinical significance of thyrotropin receptor mRNA expression in orbital fat and eye muscle tissues from patients with thyroid-associated ophthalmopathy. Thyroid. 6:553–562.[Medline]
  10. Major BJ, Cures A, Frauman AG. 1997 The full length and splice variant thyrotropin receptor is expressed exclusively in skeletal muscle of extraocular origin: a link to the pathogenesis of Graves’ ophthalmopathy. Biochem Biophys Res Commun. 230:493–496.[CrossRef][Medline]
  11. Crisp MS, Lane C, Halliwell M, Wynford-Thomas D, Ludgate M. 1997 Thyrotropin receptor transcripts in human adipose tissue. J Clin Endocrinol Metab. 82:2003–2005.
  12. Spitzweg C, Joba W, Hunt N, Heufelder AE. 1997 Analysis of human thyrotropin receptor gene expression and immunoreactivity in human orbital tissue. Eur J Endocrinol. 136:599–607.[Abstract/Free Full Text]
  13. Bahn R, Dutton CM, Natt N, Joba W, Spitzweg C, Heufelder AE. 1998 Thyrotropin receptor expression in Graves’ orbital adipose/connective tissues: potential autoantigen in Graves’ ophthalmopathy. J Clin Endocrinol Metab. 83:998–1002.[Abstract/Free Full Text]
  14. Drvota V, Janson A, Norman C, et al. 1995 Evidence for the presence of functional thyrotropin receptor in cardiac muscle. Biochem Biophys Res Commun. 211:426–431.[CrossRef][Medline]
  15. Koshiyama H, Sellitti DF, Akamizu T, et al. 1996 Cardiomyopathy associated with Graves’ disease. Clin Endocrinol (Oxf). 45:111–116.[CrossRef][Medline]
  16. Sellitti DF, Hill R, Doi SQ, et al. 1997 Differential expression of thyrotropin receptor mRNA in the porcine heart. Thyroid. 7:641–646.[Medline]
  17. Chomczynski P, Sacchi N. 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 162:156–159.[Medline]
  18. Hecker KH, Roux KH. 1996 High and low annealing temperatures increase both specificity and yield in touchdown and stepdown PCR. BioTechniques. 20:478–485.[Medline]
  19. Burazin TCD, Gundlach AL. 1998 Inducible galanin and GalR2 receptor system in motor neuron injury and regeneration. J Neurochem. 71:879–882.[Medline]
  20. Libert F, Lefort A, Gerard C, et al. 1989 Cloning, sequencing and expression of the human thyrotropin (TSH) receptor: evidence for binding of autoantibodies. Biochem Biophys Res Commun. 165:1250–1255.[CrossRef][Medline]
  21. Graves PN, Tomer Y, Davies TF. 1992 Cloning and sequencing of a 1.3kb variant of human thyrotropin receptor mRNA lacking the transmembrane domain. Biochem Biophys Res Commun. 187:1135–1143.[CrossRef][Medline]
  22. Chelly J, Concordet JP, Kaplan JC, Kahn A. 1989 Illegitimate transcription: transcription of any gene in any cell type. Proc Natl Acad Sci USA. 86:2617–2621.[Abstract/Free Full Text]
  23. Kaplan JC, Kahn A, Chelly J. 1992 Illegitimate transcription: its use in the study of inherited disease. Hum Mut. 1:357–360.[CrossRef][Medline]
  24. Kawaguchi H, Kitabatake A. 1995 Renin-angiotensin system in failing heart. J Mol Cell Cardiol. 27:201–209.[Medline]



This article has been cited by other articles:


Home page
J EndocrinolHome page
A. de Lloyd, J. Bursell, J. W Gregory, D A. Rees, and M. Ludgate
TSH receptor activation and body composition
J. Endocrinol., January 1, 2010; 204(1): 13 - 20.
[Abstract] [Full Text] [PDF]


Home page
Br J OphthalmolHome page
A Boschi, C. Daumerie, M Spiritus, C Beguin, M Senou, D Yuksel, M Duplicy, S Costagliola, M Ludgate, and M C Many
Quantification of cells expressing the thyrotropin receptor in extraocular muscles in thyroid associated orbitopathy
Br J Ophthalmol, June 1, 2005; 89(6): 724 - 729.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Biondi, E. A. Palmieri, L. Pagano, M. Klain, G. Scherillo, M. Salvatore, G. Fenzi, G. Lombardi, and S. Fazio
Cardiovascular Safety of Acute Recombinant Human Thyrotropin Administration to Patients Monitored for Differentiated Thyroid Cancer
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 211 - 214.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. E. Busuttil and A. G. Frauman
TSH Receptor Expression in Cardiac Muscle Tissue
J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2994 - 2994.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. F. Sellitti, S. Q. Doi, T. Akamizu, and H. Koshiyama
Comment on "Thyrotropin Receptor Expression in Cardiac Muscle Tissue"
J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 946 - 946.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Busuttil, B. E.
Right arrow Articles by Frauman, A. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Busuttil, B. E.
Right arrow Articles by Frauman, A. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals