| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Clinical Pharmacology and Therapeutics Unit, Department of Medicine, Austin and Repatriation Medical Center, University of Melbourne, Heidelberg, Victoria 3084, Australia
Address all correspondence and requests for reprints to: Dr. Albert G. Frauman, Clinical Pharmacology and Therapeutics Unit, Department of Medicine, Austin and Repatriation Medical Center, University of Melbourne, Austin Campus, Heidelberg, Victoria 3084, Australia. E-mail: nicola{at}austin.unimelb.edu.au
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Studies using PCR techniques have also detected the presence of TSHR mRNA in human (14, 15) and porcine (16) cardiac tissue. One of these studies examined a myocardial biopsy from a 25-yr-old man with GD, who developed cardiomyopathy with severe heart failure (15). Lymphocytic infiltration and degenerative changes were observed in the biopsy. This suggested that the development of cardiac manifestations in association with GD may also have an direct autoimmune etiology and perhaps share an antigen common to heart and thyroid. The objective of the present study was to confirm the expression of TSHR mRNA in thyroid, EOM, and normal human heart using high stringency RT-PCR and in situ hybridization.
| Materials and Methods |
|---|
|
|
|---|
Fresh frozen. Approval was obtained from the human research
ethics committee of the Austin and Repatriation Medical Center to
collect human heart muscle from left and right ventricles and atria
(
1 g of each), EOM (
1 g superior rectus), abdominal muscle (
1
g), and thyroid at autopsy from aged male subjects not suffering from
thyroidal, cardiac, or skeletal muscle disorders, within 12 h of
death. Muscle samples were carefully stripped of all visible fat, were
placed immediately into sterile thick-walled polypropylene tubes,
frozen, and stored at -70 C until required. Sections were cut 10 µm
thick and placed onto 2% silane-coated slides.
Paraffin embedded. Tissues were collected at the time of autopsy and fixed in 10% formalin, then embedded in paraffin. Tissue sections were cut 4 µm thick and placed onto 2% silane-coated sides.
RNA extraction
Total RNA was extracted from fresh-frozen tissues using the guanidium thiocyanate method described by Chomczynski and Sacchi (17).
RT
Total RNA (100 ng) was reverse transcribed using a previously described method (10).
High stringency PCR
A single round of a modified "touchdown" PCR method was used
to detect mRNA transcripts under conditions of high hybridization
stringency (10, 18). This method has been described in
full previously (10), but in brief this procedure involved
a "hot start" of 3 min at 94 C, followed by five cycles of 94, 70,
and 74 C for 30 sec each, then 35 cycles of 94, 55, and 74 C for
30 sec each, with a final 5-min incubation at 74 C. The primers
used are listed in Table 1
. The PCR
products were blotted onto nylon membrane (Hybond
N+, Amersham Pharmacia Biotech,
Sydney, Australia) after electrophoresis.
|
A probe complementary to bases 493476 (5'-3') of the TSHR
complementary DNA (cDNA; CATGTAAGGGTTGTCTGT) as well as probes to bases
398324 of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene
(TTCACCACCATGGAGAAGGCTGGGGCT) and bases 11551176 of the
angiotensinogen gene (CTGCAAGGATCTTATGACCTGC) were
32P 5'-end labeled for use as a probe in Southern
analysis. Each probe (50 ng) was incubated in a final volume of 10 µL
containing 50 mmol/L Tris (pH 7.6), 10 mmol/L
MgCl2, 10 mmol/L 2-mercaptoethanol, 50 µCi
[
-32P]ATP, and 20 U T4 polynucleotide kinase
(Amersham Pharmacia Biotech) for 45 min in a 37 C water
bath. Membranes containing transferred PCR products were prehybridized
in Rapid-Hyb solution (Amersham Pharmacia Biotech) for 10
min at 42 C. After prehybridization, the radiolabeled probe was added
and hybridized to membranes at 42 C for 1.5 h. Membranes were then
washed twice in 2x SSC (standard saline citrate) containing 0.1% SDS
for 10 min at 42 C and once with 1x SSC containing 0.1% SDS for 10
min at 42 C. Membranes were then wrapped in polypropylene film and
exposed to photographic film (X-OMAT AR, Kodak, Integrated
Sciences, Kew, Australia) for autoradiography.
In situ hybridization
Pretreatment of fresh-frozen specimens. After sectioning, the slides were incubated for 2 min in PBS buffer, for 2 min in 70% ethanol, for 5 min in absolute ethanol, and for 15 min in chloroform, then rinsed in absolute ethanol and stored at 4 C in absolute ethanol. Slides were removed from the ethanol and allowed to dry at room temperature before hybridization.
Pretreatment of paraffin-embedded specimens. Before in situ hybridization, sections were deparaffinized in xylene (7.5 min, twice) and rehydrated in graded ethanol. Sections were then rinsed in 2 changes of diethylpyrocarbonate-treated distilled water and rinsed in 10 mmol/L citrate buffer, pH 6.0. Sections were placed in glass racks (20 slides/rack) and submerged in approximately 250 mL citrate buffer in covered glass tubs. Sections were then microwaved in a 900-watt microwave (Panasonic Matsushita Electric, Danville, MA) 3 times for 5 min each time at full power, topped up with additional citrate buffer to compensate for evaporation. Slides were allowed to cool slightly, then were rinsed in 2 changes of diethylpyrocarbonate-treated distilled water, dehydrated in graded ethanol, and dried.
Oligonucleotide labeling and hybridization. Two nonoverlapping 39-mer oligonucleotide probes complementary to bases 680718 and 21722210 of the human TSHR gene were synthesized (Life Technologies, Inc., Melbourne, Australia) and used to detect TSHR mRNA in fresh-frozen sections. Five nonoverlapping 39-mer oligonucleotide probes complementary to bases 88126, 680718, 12621300, 15261564, and 21722210 of the human TSHR gene were used to detect TSHR mRNA in the paraffin-embedded sections. The sequence specificities of the probes were investigated using a gene sequence database (NIH Blast Email Network Service) and were shown not to cross-react with any known human gene in the database. The 3'-end labeling of the probes and hybridization of the labeled probes to the tissue sections was carried out using a previously described method (19).
Analysis
Semiquantitative analysis of TSHR mRNA levels in the various tissues was conducted using computer-assisted densitometry of x-ray film autoradiographs (MCID image analysis system, Imaging Research, Inc., Toronto, Canada). The films were scanned, and the intensity of each image was converted, by the MCID software, into a colored scale (blue was least intense, red to black was most intense). For each image, 10 areas of the same sample size and approximately equal tissue density were measured (against standards) to give a numerical value for the intensity of binding. These 10 readings were averaged to give a numeral value (in disintegrations per min) of labeling intensity for each tissue. The results for each tissue were then compared by one-way ANOVA (Tukeys test), followed by Student-Newman-Keuls test; P < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
High stringency RT-PCR using primers specific for the full-length
and the splice variant TSHR cDNA (Table 1
) demonstrated amplification
of PCR fragments of the expected size in both the EOM (n = 5) and
thyroid (n = 1), but not in the abdominal muscle (Abd; n = 5)
or any of the four chambers of the normal human heart (n = 5). The
water control was consistently negative. These results were consistent
for both the ethidium bromide-stained gels of the RT-PCR products and
the Southern blot (Fig. 1
). High
stringency RT-PCR and Southern blotting for GAPDH and angiotensinogen
were also preformed in all tissues tested to verify both the integrity
of the RNA preparations and the success of the RT step. The possibility
of genomic contamination was eliminated by designing the PCR primers to
span exons (Table 1
).
|
High levels of specific hybridization were observed for both
thyroid and EOM tissues (Fig. 2
, AD). Follicular shapes were discernible on the film for the
thyroid, and nonspecific binding appeared minimal for all tissues.
Labeling in all chambers of the normal human heart and abdominal muscle
tissue appeared to be at background levels (Fig. 2
, EN).
Densitometric measurements from the autoradiographs using MCID image
analysis gave mean (±SD) specific counts of 1024 ±
232 dpm for thyroid (n = 5) vs. 333 ± 228 dpm for
EOM (n = 4) and 96 ± 82 dpm for abdominal muscle (n =
3). Measurements for individual chambers of the heart had mean values
of 86150 dpm for each of the four cardiac chambers.
|
| Discussion |
|---|
|
|
|---|
Drvota and co-workers reported the presence of exons 9 and 10 of the TSHR gene in human cardiac tissue using a single round of a conventional PCR protocol (the number of specimens investigated was not reported) (14). Koshiyama and co-workers attempted to amplify a fragment of the TSHR from a normal human heart cDNA library, spanning exons 710 using a single round of PCR, but were unable to produce a product of the correct size (15). A second PCR reaction amplified a sequence internal to the first PCR product, which spanned exons 9 and 10 (i.e. nested PCR) and was of the expected size (n = 1). This group also investigated the presence of the TSHR mRNA in porcine cardiac tissue (n = 2) using a technique similar to that described for the human investigation (16). This latter study found differential expression of TSHR mRNA in the heart, with the highest expression levels in the right atrium, coronary artery, and epicardial fat and the lowest levels in the ventricular myocardium (16).
Conventional RT-PCR and nested RT-PCR are extremely powerful techniques with the sensitivity to amplify templates in very low abundance. Although this sensitivity is useful in detecting low levels of transcription, it has previously been reported to amplify "illegitimate transcripts," which are produced as a result of "leaky" transcription (22), i.e. transcription that presumably occurs incidentally rather than intentionally. Because illegitimate transcripts exhibit the same characteristics as legitimate transcripts, care must be taken not to amplify them. However, these transcripts also exhibit the same mutations as "legitimate" transcripts and have been used to study inherited diseases (23).
By including positive and negative controls and by limiting the number of amplification cycles, the detection of illegitimate transcripts may be avoided. None of the earlier reports on the presence of TSHR mRNA in the heart (14, 15, 16) included negative control tissues, and all of these reports had small or unreported sample sizes. The possibility that these earlier studies amplified illegitimate transcripts or a contaminant (such as fat, which has been demonstrated to express TSHR mRNA) therefore cannot be excluded.
The present study used a modified hot start-touchdown PCR method
(18), which included an initial incubation at 94 C (hot
start), followed by 5 cycles with an elevated primer hybridization
temperature (70 C) and then an additional 35 cycles with a step down to
a standard primer hybridization temperature (55 C). This protocol had
previously been demonstrated to give sensitive and specific
amplification of PCR products, with discrimination between tissues
(10, 18). Using this protocol TSHR cDNA was identified in
thyroid and EOM tissues, but not in abdominal muscle [as previously
reported (10)] or cardiac tissue (see Fig. 1
).
The possibility that the negative tissue results observed were due to
degraded mRNA or ineffective RT was also addressed. PCR for the
housekeeping gene GAPDH and the angiotensin precursor, angiotensinogen
[previously demonstrated to be expressed in the normal human heart
(24)] were performed concurrently on the same RT products
used to investigate the presence of TSHR mRNA. These control PCRs gave
strong positive results (Fig. 1
), indicating good quality mRNA and
successful RT.
The in situ hybridization study showed significant TSHR mRNA labeling in thyroid and EOM tissue sections, but not in abdominal or cardiac muscle. The oligonucleotide sequences chosen were screened against a sequence database using a BLAST search to ensure that the probes would not recognize any known human gene sequences other than the TSHR. The insignificant level of binding in the nonspecific controls suggests that the oligonucleotide probes were specific and that cross-reactivity with other mRNA species did not occur.
The observation in the present studies that TSHR mRNA hybridization only occurred in thyroid and EOM tissues reflects results observed using RT-PCR. Examination of the in situ hybridization autoradiographic films suggests that the localization of labeling in the thyroid occurs in the tissue making up the follicular epithelium, whereas the lumen appears to be void of label. Microscopic analysis of these tissues was not possible, as the emulsion-dipped slides did not produce sufficient silver grains for analysis. This does leave open the possibility that the TSHR mRNA detected in the EOM might be located within the fibroblast or fat cells residing within the muscle bundles. Although both of these cell types have been shown to express TSHR mRNA, the amount of TSHR mRNA expression in normal adipose tissue of orbital and intestinal origin has been reported to be very low (11). If fat cells were responsible for the TSHR mRNA observed in the EOM tissue of the present study, then comparable levels of labeling might also be expected in abdominal muscle. In addition, although it may be argued that orbital fibroblasts might selectively express TSHR mRNA compared with abdominal fibroblasts, thereby accounting for the differential expression observed, the density of fibroblasts in EOM would not be sufficient (when contiguous hematoxylin- eosin-stained tissues were examined under the microscope; data not shown) to account for the extent of labeling observed with in situ hybridization. Therefore, although adipose tissue and fibroblasts might conceivably contribute to the amount of TSHR mRNA observed in the EOM, they do not appear to account for all of it, suggesting that EOM fibers are a source of additional transcripts. Taken together, the present findings support the hypothesis that the TSHR is shared between thyroid and EOM, but not cardiac muscle, and may be a common autoantigen for GO.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received March 13, 2000.
Revised January 22, 2001.
Accepted January 29, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. de Lloyd, J. Bursell, J. W Gregory, D A. Rees, and M. Ludgate TSH receptor activation and body composition J. Endocrinol., January 1, 2010; 204(1): 13 - 20. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Boschi, C. Daumerie, M Spiritus, C Beguin, M Senou, D Yuksel, M Duplicy, S Costagliola, M Ludgate, and M C Many Quantification of cells expressing the thyrotropin receptor in extraocular muscles in thyroid associated orbitopathy Br J Ophthalmol, June 1, 2005; 89(6): 724 - 729. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Biondi, E. A. Palmieri, L. Pagano, M. Klain, G. Scherillo, M. Salvatore, G. Fenzi, G. Lombardi, and S. Fazio Cardiovascular Safety of Acute Recombinant Human Thyrotropin Administration to Patients Monitored for Differentiated Thyroid Cancer J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 211 - 214. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Busuttil and A. G. Frauman TSH Receptor Expression in Cardiac Muscle Tissue J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2994 - 2994. [Full Text] [PDF] |
||||
![]() |
D. F. Sellitti, S. Q. Doi, T. Akamizu, and H. Koshiyama Comment on "Thyrotropin Receptor Expression in Cardiac Muscle Tissue" J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 946 - 946. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |