help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masi, L.
Right arrow Articles by Brandi, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masi, L.
Right arrow Articles by Brandi, M. L.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 5 2263-2269
Copyright © 2001 by The Endocrine Society


Original Studies

Polymorphism of the Aromatase Gene in Postmenopausal Italian Women: Distribution and Correlation with Bone Mass and Fracture Risk1

Laura Masi, Lucia Becherini, Luigi Gennari, Antonietta Amedei, Emanuela Colli, Alberto Falchetti, Maria Farci, Sandra Silvestri, Stefano Gonnelli and Maria Luisa Brandi

Department of Clinical Physiopathology, University of Florence, 50132 Florence, Italy

Address all correspondence and requests for reprints to: Maria Luisa Brandi, M.D., Ph.D., Department of Clinical Physiopathology, Viale Pieraccini 6, 50132 Florence, Italy. E-mail: m.brandi{at}dfc.unifi.it


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Conversion of C19 steroids to estrogens is catalyzed by the aromatase enzyme. Inactivating mutations of the aromatase gene are associated with decreased bone mineral density in both men and women. Genetic studies suggest that several genes contribute to the regulation of bone mass via interaction with the modeling and remodeling processes. Among these genes, the aromatase gene is a potential candidate to be evaluated for segregation with bone metabolism and bone mass. A tetranucleotide simple tandem repeat polymorphism in intron 4 at the human aromatase cytochrome P-450 gene has been recently described. In the present study we evaluated the distribution of this polymorphism in a cohort of Italian postmenopausal women, both normal and osteoporotic. We observed that the NN genotype was significantly more frequent in nonosteoporotic women than in osteoporotic women (72.7% vs. 27.2%), whereas the DN genotype was significantly more represented in osteoporotic women (90.48% vs. 9.5%; Pearson’s {chi}2 test = 42.8; df = 10; P = <0.01). The allele containing the longer TTTA repeats was statistically more represented in nonosteoporotic women (Pearson’s {chi}2 test = 19.14; df = 2; P = 0.00007). In addition, women with a high number of TTTA repeats had a significantly higher lumbar bone mineral density than women with alleles containing 8–11 TTTA repeats (P = 0.03). Finally, considering the spine fractures, a significantly higher incidence was observed in women with shorter TTTA repeats than in those with longer TTTA repeats (Pearson’s {chi}2 test = 7.3; df = 2; P = 0.02), equivalent to a relative risk of 4.1 (95% confidence interval, 1.19–13.87). In conclusion, the aromatase gene can be one of the several genes potentially involved in the maintenance of bone mass and in the regulation of bone mass loss.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ANDROGENS AND estrogens are both important regulators of bone physiology (1). They account in part for sexual dimorphism of the skeleton influencing both growth and bone maintenance (1). Although estrogens and androgens are both believed to have direct effects on bone (2, 3), some androgens are aromatized to estrogens, raising the possibility that skeletal effects considered previously to be due to androgens may actually be due to estrogens. The enzyme complex aromatase comprises a specific form of cytochrome P450 and flavoprotein NADPH-reductase. It catalyzes the conversion of the {Delta}4 -3-one A ring of androgens to the corresponding phenolic A ring typical of estrogens (4, 5, 6). Aromatase enzyme activity and its corresponding messenger ribonucleic acid (mRNA) have been shown in cultures of human osteoblast-like cells from adult and fetal bone, suggesting that estrogens are produced locally in bone (7, 8, 9, 10, 11). Glucocorticoids, 1{alpha},25-dihydroxyvitamin D3 and chemokines, control aromatase activity and mRNA expression in bone (9, 12). In osteoblast-like cells and osteoclasts, the major promoter is found at exon 1.4 (5, 11). Other tissues use other promoters (13, 14).

Despite evidence to support a role for aromatase activity in bone cell metabolism, clinical examples of its importance are only now becoming available (15, 16). Inactivating mutations of the aromatase gene in both sexes are associated with increased bone turnover and decreased bone mineral density (BMD) (17, 18). Treatment of these patients with estrogen markedly improves bone mass (19, 21). Moreover, aromatase expression in bone has been quantified with respect to osteoporosis as detected radiologically (22).

Genes involved in estrogen metabolism (the aromatase gene) and in estrogenic response (the estrogen receptor {alpha} gene) are possible contributors to the abnormal pathophysiological processes associated with osteoporosis (23, 24). Genetic variants in the human aromatase gene, for example, could alter estrogen metabolism. A tetranucleotide simple tandem repeat polymorphism in intron 4 of the human aromatase cytochrome P-450 gene has been recently described (25). The present study was designed to evaluate the distribution of this aromatase gene polymorphism in a cohort of normal and osteoporotic postmenopausal Italian women.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Three hundred and fifty postmenopausal women (mean ± SEM age, 57 ± 8 yr; range, 47–76 yr) were selected from 1700 women who were evaluated for osteoporotic risk that can be defined by radiological [x-ray and dual energy x-ray absorptiometry (DXA)] and biochemical exams to prevent and treat the disease. To adequately assess the role of aromatase in the genetics of osteoporosis and to minimize the influence of several confounding factors, we selected an ethnically homogeneous group of Italian postmenopausal women who had never used bone-active drugs and with no history of diseases known to affect bone metabolism. One thousand three hundred and fifty women were excluded for the following reasons: 710 had used or were still using bone-active drugs (estrogen replacement therapy, vitamin D metabolites, bisphosphonates, calcitonin, fluorides), 258 had used or were still using drugs that could potentially affect bone metabolism (glucocorticoids, thyroid hormones, antacids); 210 were affected by diseases known to influence bone metabolism; 98 had different ethnic origin; and 74 refused or did not perform blood sampling. Using the WHO guidelines (26) women were described as osteoporotic (n = 185) and nonosteoporotic (n = 165). For all women, a detailed medical history was obtained including dietary calcium intake as assessed by a questionnaire about dietary habits. Table 1Go describes the general features of the population. All women gave informed consent. The study was approved by the institutional review board of both Florence and Siena Medical Centers.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical characteristics of study population

 
Bone densitometry and fracture assessment

Lumbar BMD (L2–L4) was measured by DXA (QDR 1000/W, Hologic, Inc., San Francisco, CA), with coefficients of variation of 0.5% in vitro and 0.9% in vivo. BMD at the upper femur (neck, Ward’s triangle, greater trochanter) was measured by DXA with coefficient of variation of 0.6% in vitro and 1.0% in vivo. A cross-calibration on the precision of measurements between the two centers in Florence and Siena was performed daily. The centers used personal spine phantom for calibration.

Vertebral fractures were evaluated by spine radiographs, according to the method of McCloskey (27). Fractures were present in both nonosteoporotic and osteoporotic women. Nonspine fractures were identified by self-report during the recruitment interview. Only nonviolent fractures were considered. The lateral lumbar spine x-ray was evaluated to detect osteophytes (28) and for facet joint osteoarthritis using a four-point scale (0 = none, 1 = mild, 2 = moderate, 3 = severe). Vascular calcifications were not evaluated because they have minimum impact on spinal density measurement (29).

Aromatase gene polymorphism

Genomic DNA was isolated from blood samples collected in ethylenediamine tetraacetate by a standard phenol-chloroform extraction procedure. PCR was performed using as primers GCAGGACTTAGCTAC (TTTA strand) and TTACAGTGAGCCAAGGTGGT (AAAT strand) (25). PCR amplification was carried out on 80 ng genomic DNA using 100 pmol of each oligonucleotide primer radiolabeled with [{alpha}-32P]deoxy-CTP using a random priming labeling kit (Roche, Mannheim, Germany).

Samples were processed as previously described (30), except that the denaturation cycle at 94 C was extended to 1.4 min. The PCR product was electrophoresed in a 6% polyacrylamide gel containing 7.6 mol/L urea for 3 h at 30 watts. Genotypes were identified by autoradiography.

Statistical analyisis

Aromatase TTTA repeat sequences were divided according to their mean values (<8, 8–11, or >11). The frequency distribution of aromatase allele TTTA repeats and of aromatase genotypes in normal and osteoporotic groups was compared using the standard {chi}2 test. Only women with the most frequent genotypes (osteoporotic, n = 185; normal, n = 165) were considered for statistical analysis. Differences in anthropometric characteristic, spinal, and femoral BMD among the different aromatase genotypes were calculated using ANOVA. Similar comparisons were performed after adjusting mean BMD values for potential confounding factors, such as age, height, weight, and years since menopause (YSM), using analysis of covariance (ANCOVA). Tukey’s test was used to compare the genotypes. Data were expressed as the mean ± SEM, with P < 0.05 accepted as the level of significance. Statistical analysis was performed using Statistica 5.1 program (Statsoft, Inc., Tulsa, OK).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Clinical characteristics of the patients are reported in Table 1Go. They were well matched for age, height, weight, and YSM. Six allelic variants were identified and denoted allele C [150 bp; (TTTA)n repeats, 7], allele D [154 bp; (TTTA)n repeats, 8], allele G [158 bp; (TTTA)n repeats, 9], allele L [162 bp; (TTTA)n repeats, 11], allele N [174 bp; (TTTA)n repeats, 12], and allele O [178 bp; (TTTA)n repeats, 14]. Allelic variant C is the most frequently represented in the total population (64.3%). Allelic variant D is the most frequent in osteoporotic women (90.7% vs. 9.3%), whereas allelic variant N is the most frequently represented in nonosteoporotic women (74.4% vs. 25.5%; Pearson’s {chi}2 test = 27.06; df = 5; P < 0.001; Fig. 1Go).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. Distribution of aromatase alleles in the population. Allele D (blue column) was the most frequent allele in the osteoporotic (OP) population, and allele N (pink column) was the most frequent allele in the nonosteoporotic (N-OP) population. Pearson’s {chi}2 = 27.06; df = 5; P < 0.001.

 
Based on these allelic variants 21 different genotypes were recognized. The frequency distribution of genotypes were in Hardy-Weinberg equilibrium. Only the six most frequent genotypes observed in the population were considered for statistical analysis, whereas rare genotypes (frequency, <5%) were excluded from the analysis. Genotypes were indicated as follows: DN, CD, CG, CN, CC, and NN (Fig. 2Go). Distribution of aromatase genotypes in the population was evaluated applying Pearson’s {chi}2 analysis. CC and CN genotypes were the most represented in our series (respectively, 28.9% and 20.2%; Table 2Go). NN genotype was significantly more frequent in normal women than in osteoporotic women (90.7% vs. 9.3%), whereas DN genotype was significantly more often represented in osteoporotic women (90.5% vs. 9.5%; Pearson’s {chi}2 test = 42.8; df = 10; P = <0.01). The distribution of aromatase genotypes in relation to the presence of peripheral and/or spine osteoporotic fractures did not show significant differences between genotypes in the 184 women analyzed (Pearson’s {chi}2 test = 7.36; df = 5; P = 0.19). However, a trend characterized be a lower incidence of spine fractures was observed in NN genotype (data not shown).



View larger version (72K):
[in this window]
[in a new window]
 
Figure 2. Blot banding pattern for tetranucleotide repeat polymorphism at the human P-450 gene (CYP19) in the population. The six most frequent genotypes observed in the population were considered for statistical analysis (frequency, <5%). Genotypes were indicated as follows: DN, CD, CG, CN, CC, and NN. The molecular weight is indicated on the right.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Distribution of aromatase genotypes and TTTA repeats in the population

 
Considering the number of the TTTA repeats patients were grouped into categories as alleles containing TTTA repeats fewer than 8, between 8 and 11, and more than 11. Alleles containing the longer TTTA repeats were seen more frequently in nonosteoporotic women compared with osteoporotic patients (Pearson’s {chi}2 test = 19.14; df = 2; P = 0.00007; data not shown). No statistically significant differences were observed in the incidence of osteoporotic fractures (peripheral and spine) among the three groups (Person’s {chi}2 test = 0.32; df = 2; P = 0.08), even though the incidence of fractures in women with alleles containing the longer TTTA repeats was lower. Moreover, considering only spine fractures, a significantly higher incidence was observed in the women with shorter TTTA repeats (spine fractures: + = 38; - = 3) in comparison with longer TTTA repeats (spine fractures: + = 11; - = 22) (Pearson’s {chi}2 test = 7.3; df = 2; P = 0.02), equivalent to a relative risk of 4.1 (95% confidence interval, 1.19–13.87; Fig. 3Go).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Distribution of aromatase TTTA repeats between women with (+) and those without (-) spine fractures. Alleles containing fewer than eight TTTA repeats had a statistically higher incidence of osteoporotic spine fractures equivalent to a relative risk of 4.1. Pearson’s {chi}2 = 7.3; df = 2; P = 0.02.

 
Applying ANCOVA, significant differences among the genotypes were observed in mean BMD at the lumbar spine (P = 0.001), but not at the femoral neck site (P = 0.74). Tukey’s test used to compare the six genotypes after ANCOVA analysis showed that women with the DN genotype had a significantly lower BMD in comparison with NN (P = 0.02) and CN (P = 0.008) genotypes (Fig. 4Go). No statistically significant differences were observed between the genotypes at the femoral neck BMD. The same test used to compare the groups with different numbers of TTTA repeats showed that women with a high number of TTTA repeats had a significantly higher lumbar BMD than women with alleles containing 8–11 TTTA repeats (P = 0.03; Fig. 5Go).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4. Tukey’s test: LS-BMD according to aromatase genotypes. The DN genotype showed a significantly lower LS-BMD in comparison with NN (P = 0.02) and CN (P = 0.008) genotypes.

 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. Tukey’s test: LS-BMD according to aromatase alleles containing TTTA repeats. Alleles with a higher number of TTTA repeats showed a significantly higher LS-BMD than those with 8–11 TTTA repeats (P = 0.03).

 
ANCOVA was also applied to evaluate whether the role of aromatase genotypes in lumbar BMD was influenced by YSM. On the basis of YSM, women were divided into 3 groups: less than 5, between 5 and 10, and more than 10 YSM. A statistically significant segregation of aromatase genotypes and lumbar BMD was observed only in patients in the first 5 YSM (P = 0.02), with women with DN genotype showing a significantly lower BMD than those with the NN genotype (P = 0.017; Fig. 6Go).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6. Tukey’s test: LS-BMD according to aromatase genotypes in women more than 5 YSM. The DN genotype showed a significantly lower LS-BMD than the NN genotype (P = 0.017).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bone remodeling is regulated by systemic hormones and locally produced factors acting in concert to maintain bone mass. Among hormones, estrogens exhibit recognized major effects on bone metabolism, not only in women but also in men (31). Postmenopausal women with undetectable serum estradiol concentrations have a high risk of developing hip and vertebral fractures (32, 33). Indeed, a male, a patient with a homozygous estrogen receptor {alpha}-inactivating mutation was reported to have a marked decrease in his BMD (34). Similarly, inactivating mutations of the aromatase gene were associated with low BMD in males as well as in females (17, 19). In fertile women the ovary represents the major source of circulating estrogens, whereas in postmenopausal women extraglandular aromatization of circulating androgens becomes the most important metabolic mechanism for estrogen production (35). Bone tissue and bone-derived cells express aromatase gene and enzyme activity (9, 11). It is, therefore, likely that estrogen production in bone tissue could result in local regulation of bone remodeling during life (9). With these conditions, the gene encoding aromatase becomes a potential candidate to be evaluated in the attempt to elucidate the genetic background of osteoporosis. In the present study the distribution of a tetranucleotide repeat polymorphism of the human aromatase gene was evaluated in a population of Italian postmenopausal women. The nonosteoporotic and osteoporotic populations were homogeneous for characteristics such as weight, height, age, YSM, and ethnicity. Of the six major allelic variants, the N allele was shown to be most prevalent in nonosteoporotic women, suggesting its independent protective function for susceptibility to osteoporosis. A mechanism through which the N allele acts as a protective factor could be the capability of higher local estrogen synthesis in bone tissue of subject bearing N allele (s). Indeed, the homozygous NN genotype was significantly more frequent in nonosteoporotic women than in osteoporotic women. In agreement with this finding, alleles containing longer (>11) TTTA repeats (mostly represented by the N allele) were more prevalent in nonosteoporotic women.

ANOVA to evaluate lumbar and femoral neck BMD differences among the six major genotypes of the aromatase gene showed a significant difference in genotype distribution at the lumbar spine. There was no correlation with femoral neck BMD. ANCOVA confirmed these results. Applying Tukey’s test to compare the six genotypes after ANCOVA analysis, we observed that women with the DN genotype showed significantly lower lumbar BMD than those with NN and CN genotypes. In agreement with these results is the fact that women with a high number of TTTA repeats had a higher lumbar BMD than women with allele containing TTTA repeats between 8 and 11. In particular, lumbar spine BMD was approximately 0.061 g/cm2 (7%) higher in women with a high number of TTTA repeats than in women with alleles containing between 8 and 11 TTTA repeats.

BMD at the lumbar spine was approximately 0.193 g/cm2 (21%) lower in DN individuals than in those with NN and 0.140 g/cm2 (16.1%) lower than in those with CN subjects. A difference of this magnitude could increase long-term fracture risk in DN women compared with NN and CN patients. In the present study we evaluated potential differences between genotypes and the incidence of osteoporotic fractures. A total of 184 women affected by fractures selected from both osteoporotic and nonosteoporotic groups were analyzed. We did not observe significant differences among genotypes for the incidence of any site osteoporotic fractures (Pearson’s {chi}2 test = 0.32; df = 2; P = 0.08). However, the allele with high number of TTTA repeats had a significantly lower incidence of spine fractures (spine fractures: + = 38; - = 3; Pearson’s {chi}2 test = 7.3; df = 2; P = 0.02).

Our inability to detect a difference is most likely due to the small size of the sample analyzed. The role of genotype NN in protecting women from postmenopausal bone loss and consequently from risk of developing vertebral fractures is still unknown.

No statistically significant differences in bone density were observed among the six genotypes at the femoral neck. Similarly, women with different numbers of TTTA repeats had femoral neck BMD not statistically different from each other. These results are in keeping with other observations (36). In view of the most rapid loss of lumbar spine bone density due to estrogen deficiency, the aromatase gene could be involved in early postmenopausal bone loss rather than that in the later postmenopausal years. This hypothesis was confirmed by statistical analysis showing a significant segregation of the aromatase genotypes and lumbar BMD only in the first 5 YSM, with the DN genotype showing a lumbar BMD lower by 0.169 g/cm2 (16.7%) compared with the NN genotype.

The mechanism through which aromatase gene activity associated with this polymorphic site controls bone metabolism is obscure. Theoretically women with DN genotype could be characterized by lower aromatase activity and/or synthesis with consequent reduction of estrogen synthesis. The aromatase gene could, therefore, be pivotal in the maintenance of a sufficient amount of local estrogens in bone tissue. Interestingly, the allelic variant containing longer TTTA repeats segregates with breast cancer risk (37, 38). It is likely that patients with allele containing longer TTTA repeats could express higher aromatase activity with increased estrogen production, which should be protective for bone loss while increasing the risk of breast cancer. This interpretation is consistent with the relationship between breast cancer risk and higher BMD (39). In contrast with this interpretation is the lack of correlation between estradiol concentrations and osteoporosis in postmenopausal women (9). Possibly, local bone tissue estrogens more than circulating concentrations may be important in the regulation of bone turnover in postmenopausal women, as estrogens produced locally could act as autocrine or paracrine modulators of bone cells. Functional studies in the future will have to encompass analysis of differential aromatase expression, activity, and regulatory pathways in the presence of different gene polymorphisms.

Finally, several studies are now showing that the age-related decline in male BMD is mostly related to declining estrogens levels (40, 41). It is likely that the effects of estrogens in the male might be due to a balance between local and peripheral estrogen production, and polymorphisms of the aromatase gene in women might have significance for men. There is clear evidence of genetic modulation of bone phenotype parameters, including bone density, quantitative ultrasound, bone size, and bone turnover at any particular age phase of life; genetic factors explain about 70% of the variance in bone phenotype. The importance of genetic heterogeneity, including ethnicity, as well as environmental and confounder factors need to be taken into account in gene search approaches (42).

It is well known that multifactorial diseases such as osteoporosis involve multiple genes and environmental factors and result principally from genetic variations that are relatively common in the general population. Linkage analysis and association studies are the two analytical methods available to detect the specific genetic regions, and candidate genes responsible for complex diseases present several crucial differences. In fact, association studies test whether a disease and an allele show correlated occurrence in a population, whereas linkage studies test whether they show correlated transmission within a pedigree (43). Association analysis for complex diseases may be an efficient approach to recognize genes with major impact even though association studies show some limitations (44), such as ethnical homogeneity and sample size. All of these arguments were considered, and these limitations were carefully evaluated in the analysis performed in the present study. In addition, as suggested by some researchers (43), to prevent spurious associations arising from admixture and given the difficulty of selecting a control group that is perfectly matched for ethnic ancestry, we use as an internal control for allele frequency evaluation the analysis of both affected individuals and their parents. Together, these considerations make it possible to ascribe the aromatase gene to the number of genes involved in the control of postmenopausal bone loss. Association studies are most meaningful when applied to functionally significant variations in genes having a clear biological relation to the trait (43). For this reason, functional studies to evaluate the activity and the expression of aromatase mRNA in fibroblasts of patients with different genotypes are underway in our laboratory. Undoubtedly, the genetic basis of osteoporosis will be found to be associated with a panoply of genes, all of which contribute to the genetic and phenotypic aspects of the postmenopausal women.


    Acknowledgments
 
We are grateful to Dr. J. P. Bilezikian for careful reading of the manuscript and for his important suggestions. We also thank Pasquale Imperiale for technical assistance.


    Footnotes
 
1 This work was supported by the Italian National Health System Projects: "Human Exposure to Xenobiotics with Potential Endocrine Activities: Evaluation of the Risk of Reproduction and Development (2000)" and "Environmental Factors as Risk of Diseases in Postmenopausal Women," Cofin. MURST MPI 1999, and Telethon grants. Back

Received June 28, 2000.

Revised October 13, 2000.

Revised January 8, 2001.

Accepted January 12, 2001.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Oursler MJ, Kassem M, Turner R, Riggs BL, Spelspberg TC. 1995 Regulation of bone cell function by gonadal steroid. In: Marcus R, Feldman D, Kelsey J, eds. Osteoporosis. New York: Academic Press; vol 7:237–260.
  2. Kommon BS, Terpening CM, Benz DJ, Graeme KA, O’Malley BW, Haussler MR. 1988 Estrogen binding receptor mRNA, and biologic response in osteoblast-like osteosarcoma cells. Science. 241:81–84.[Abstract/Free Full Text]
  3. Horowitz MC.1993. Cytokines and estrogen in bone: anti-osteoporotic effects. Science. 260:626–627.
  4. Nelson DR, Kamataki T, Waxman DJ, et al. 1993 The P450 superfamily: update of new sequences, gene mapping, accession numbers, early trivial name of enzymes and nomenclature DNA. Cell Biol. 12:1–51.
  5. Simpson ER, Didsdon MM, Agarwal VR, Hinshelwood MM, Bulun S, Zhao Y. 1997 Expression of the CYP19 (aromatase) gene: an unusual case of alternative promoter usage. FASEB J. 11:29–36.[Abstract]
  6. Heans GD, Mahendroo M, Corbin CJ, et al. 1989 Structural analysis of the gene encoding human aromatase cytochrome P450, the enzyme responsible for estrogens biosynthesis. J Biol Chem. 264:19385–19391.[Abstract/Free Full Text]
  7. Chen S, Besman MJ, Sparkes RS, et al. 1988 Human aromatase: cDNA cloning, Southern blot analysis, and assignment of the gene to chromosome 15. DNA. 7:27–38.[Medline]
  8. Tanaka S, Haji M, Nishi Y, Yanase T, Takayanagi R, Nawata H. 1993 Aromatase activity, in human osteoblast-like osteosarcoma cell. Calcif Tissue Int. 52:107–109.[CrossRef][Medline]
  9. Nawata H, Tanaka S, Tanaka S, et al. 1995 Aromatase in bone cell: association with osteoporosis in postmenopausal women. J Steroid Biochem Mol. 1–6:165–174.
  10. Purohit A, Flanagan AM, Reed MJ. 1992 Estrogen synthesis by osteoblast cell lines. Endocrinology. 131:2027–2029.[Abstract/Free Full Text]
  11. Shozu M, Simpson ER. 1998 Aromatase expression of human osteoblast-like cells. Mol Cell Endocrinol. 139:117–129.[CrossRef][Medline]
  12. Simpson ER, Ackerman GE, Smith ME, Mendelson CR. 1981 Estrogen formation in stromal cells of adipose tissue in women: induction by glucocorticoids. Proc Natl Acad Sci USA. 9:5690–5694.
  13. Harada N, Yamada K, Saito K, et al. 1990 Structural characterization of the human estrogen synthetase (aromatase) gene. Biochem Biophys Res Commun. 166:365–372.[CrossRef][Medline]
  14. Toda K, Terashima M, Kamamoto T. 1990 Structural and functional characterization of human aromatase P450 gene. Eur H Biochem. 193:559–565.
  15. Riggs BL, Melton LJ. 1986 Medical progress series: involutional osteoporosis. N Engl J Med. 314:1676–1686.[Medline]
  16. Riggs BL, Khosla S, Melton LJ. 1998 A unitary model for involutional osteoporosis: estrogen deficiency causes both type I and type II osteoporosis in postmenopausal women and contribute to bone loss in aging men. J Bone Miner Res. 13:763–773.[CrossRef][Medline]
  17. Morishima A, Grumbach MM, Simpson ER. 1995 Aromatase deficiency in male and female siblings caused by a novel mutation and the physiological role of estrogens. J Clin Endocrinol Metab. 80:3689–3698.[Abstract]
  18. Mullis PE, Yoshimura N, Kuhlmann B, et al. 1997 Aromatase deficiency in a female who is compound heterozygotes for the new point mutations in the P450 aromatase gene: impact of estrogens on hypergonadotropic, hypogonadism, multycistic ovaries, and bone densitometry in childhood. J Clin Endocrinol Metab. 82:17391.745.
  19. Carani C, Qin K, Simoni M, et al. 1997 Effect of testosterone and estradiol in a man with aromatase deficiency. N Engl J Med. 337:91–95.[Free Full Text]
  20. Morishima A, Grumbach MM, Bilezikian JP. 1997 Estrogen markedly increases bone mass in an estrogen deficient young man with aromatase deficiency. J Bone Miner Res. 12:S126.
  21. Bilezikian JP, Morishima A, Bell J, Grumbach MM. 1998 Increased bone mass as a result of estrogen therapy in a man with aromatase deficiency. N Engl J Med. 339:599–603.[Free Full Text]
  22. Sasano H, Uzuki M, Sawai T, et al. 1997 Aromatase in human bone tissue. J Bone Miner Res. 12:1416–1423.[CrossRef][Medline]
  23. Gennari L, Becherini L, Masi L:, et al. 1998 Vitamin D and estrogen receptor allelic variants in Italian postmenopausal women: evidence of multiple gene contribution to bone mineral density. J Clin Endocrinol Metab. 83:939–944.[Abstract/Free Full Text]
  24. Sano M, Inoue S, Hosoi T, et al. 1995 Association of estrogen receptor dinucleotide repeat polymorphism with osteoporosis. Biochem Biophys Res Commun. 217:378–383.[CrossRef][Medline]
  25. Polymeropoulos H, Xiao H, Rath DS, Merril CR. 1997 Tetranucleotide repeat polymorphism at the human P-450 gene (CYP19). Nucleic Acids Res. 19:195.
  26. Kanis JA, Melton LJ, Christiansen C, Johnston CC, Khaltaev N. 1994 The diagnosis of osteoporosis. J Bone Miner Res. 9:1137–1141.[Medline]
  27. McCloskey EV, Spector TD, Eyres KS, et al. 1993 The assessment of vertebral deformity: a method for use in population studies and clinical trials. Osteop Int. 3:138–147.[CrossRef][Medline]
  28. Orwoll ES, Oviatt SK, Mann T. 1990 The impact of ostoephytic and vascular calcifications on vertebral mineral density measurements in men. J Clin Endocrinol Metab. 70:1202–1207.[Abstract/Free Full Text]
  29. Pouilles JM, Tremollieres F, Louvet JP, Fournie B, Morlock G, Ribot C. 1988 Sensitivity of dual-photon absorptiometry in spinal osteoporosis. Calcif Tissue Int. 43:329–334.[Medline]
  30. Weber JL, May PE. 1990 Dinucleotide repeat polymorphism at the D18S35 locus. Nucleic Acids Res. 18:463.
  31. Turner RT, Riggs BL. 1994 Skeletal effects of estrogens. Endocr Rev. 15:275–300.[Abstract/Free Full Text]
  32. Cummings SR, Browner WS, Bauer D, Ensrud K, Jamal S, Ettinger B. 1998 Endogenous hormones and the risk of hip and vertebral fractures among older women. N Engl J Med. 339:733–738.[Abstract/Free Full Text]
  33. Ettinger B, Pressman A, Sklarin P, Bauer DC, Cauley JA, Cummings SR. 1998 Association between low levels of serum estradiol, bone density, and fractures among elderly women: the study of osteoporotic fractures. J Clin Endocrinol Metab. 83:2239–2243.[Abstract/Free Full Text]
  34. Smith EP, Boyd J, Frank GR, et al. 1994 Estrogen resistance caused by a mutation in the estrogen-receptor gene in a man. N Engl J Med. 331:1056–1061.[Abstract/Free Full Text]
  35. Riggs BL, Melton LJ. 1983 Evidence of two distinct syndromes of involutional osteoporosis: Implication for preventive therapy. Am J Med. 75:899–901.[CrossRef][Medline]
  36. Eisman JA, Kelly P, Morrison NA, et al. 1992 Genetic and environmental interactions on bone mass. In: Cohn DV, Gennari C, Tashjian AH, eds. Calcium regulating hormones and bone metabolism. 376–386.
  37. Kristensen VN, Andersen TI, Eriksten B, Magnus P, Borresen-Dale AL. 1998 A rare CYP19 (aromatase) variant may increase the risk of breast cancer. Pharmacogenetics. 8:43–48.[Medline]
  38. Sasano H, Harada N. 1998 Intratumoral aromatase in human breast, endometrial, and ovarian malignancies. Endocr Rew. 19:593–607.
  39. Cauley JA, Lucas FL, Kuller LH, et al. 1996 Bone mineral density and risk cancer in older women: the study of osteoporotic fractures. Study of osteoporotic fractures research group. JAMA. 276:1404–1408.[Abstract/Free Full Text]
  40. Khosla S, Melton LJ, III, Atkinson EJ, O’Fallon WM, Klee GG, Riggs BL. 1998 Relationship of serum sex steroid levels and bone turnover markers with bone mineral density in men and women: a key role for bioavailable estrogen. J Clin Endocrinol Metab. 83:2266–2274.[Abstract/Free Full Text]
  41. Bilezikian JP, Kurland ES, Rosen CJ. 1999 Male skeletal health and osteoporosis. Trends Endocrinol Metab. 8:244–250.
  42. Eisman JA. 2000 Genetic of osteoporosis. Endocr Rev. 20:788–804.[Abstract/Free Full Text]
  43. Lander ES, Schork NJ. 1994 Genetic dissection of complex traits. Science. 265:2037–2047.[Abstract/Free Full Text]
  44. Thomson G, Esposito MS. 1999 The genetic of complex diseases, millennium issue. M17–M20.
  45. Nbguyen TV, Blangero J, Eisman JA. 2000 Genetic epidemiological approaches to the search for osteoporotic genes. J Bone Miner Res. 15:392–401.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
I. Czajka-Oraniec, W. Zgliczynski, A. Kurylowicz, M. Mikula, and J. Ostrowski
Association between gynecomastia and aromatase (CYP19) polymorphisms
Eur. J. Endocrinol., May 1, 2008; 158(5): 721 - 727.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
J. B. J. van Meurs, T. A. Trikalinos, S. H. Ralston, S. Balcells, M. L. Brandi, K. Brixen, D. P. Kiel, B. L. Langdahl, P. Lips, O. Ljunggren, et al.
Large-Scale Analysis of Association Between LRP5 and LRP6 Variants and Osteoporosis
JAMA, March 19, 2008; 299(11): 1277 - 1290.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Lin, O. Ercan, J. Raza, C. P. Burren, S. M. Creighton, R. J. Auchus, M. T. Dattani, and J. C. Achermann
Variable Phenotypes Associated with Aromatase (CYP19) Insufficiency in Humans
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 982 - 990.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. A. Riancho, C. Valero, A. Naranjo, D. J. Morales, C. Sanudo, and M. T. Zarrabeitia
Identification of an Aromatase Haplotype That Is Associated with Gene Expression and Postmenopausal Osteoporosis
J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 660 - 665.
[Abstract] [Full Text] [PDF]


Home page
IBMS BoneKEyHome page
S. Ferrari
Single Gene Mutations and Variations Affecting Bone Turnover and Strength: a Selective 2006 Update
IBMS BoneKEy, December 1, 2006; 3(12): 11 - 29.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. A Riancho, M. T Zarrabeitia, C. Valero, C. Sanudo, V. Mijares, and J. Gonzalez-Macias
A gene-to-gene interaction between aromatase and estrogen receptors influences bone mineral density.
Eur. J. Endocrinol., July 1, 2006; 155(1): 53 - 59.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. X. Ma, A. A. Adjei, O. E. Salavaggione, J. Coronel, L. Pelleymounter, L. Wang, B. W. Eckloff, D. Schaid, E. D. Wieben, A. A. Adjei, et al.
Human Aromatase: Gene Resequencing and Functional Genomics
Cancer Res., December 1, 2005; 65(23): 11071 - 11082.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
I. M. Dick, A. Devine, and R. L. Prince
Association of an aromatase TTTA repeat polymorphism with circulating estrogen, bone structure, and biochemistry in older women
Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E989 - E995.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. Watanabe, S. Ohno, and S. Nakajin
Forskolin and dexamethasone synergistically induce aromatase (CYP19) expression in the human osteoblastic cell line SV-HFO
Eur. J. Endocrinol., April 1, 2005; 152(4): 619 - 624.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
L. Gennari, D. Merlotti, V. De Paola, A. Calabro, L. Becherini, G. Martini, and R. Nuti
Estrogen Receptor Gene Polymorphisms and the Genetics of Osteoporosis: A HuGE Review
Am. J. Epidemiol., February 15, 2005; 161(4): 307 - 320.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Gennari, R. Nuti, and J. P. Bilezikian
Aromatase Activity and Bone Homeostasis in Men
J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 5898 - 5907.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Gennari, L. Masi, D. Merlotti, L. Picariello, A. Falchetti, A. Tanini, C. Mavilia, F. Del Monte, S. Gonnelli, B. Lucani, et al.
A Polymorphic CYP19 TTTA Repeat Influences Aromatase Activity and Estrogen Levels in Elderly Men: Effects on Bone Metabolism
J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2803 - 2810.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Somner, S. McLellan, J. Cheung, Y. T. Mak, M. L. Frost, K. M. Knapp, A. S. Wierzbicki, M. Wheeler, I. Fogelman, S. H. Ralston, et al.
Polymorphisms in the P450 c17 (17-Hydroxylase/17,20-Lyase) and P450 c19 (Aromatase) Genes: Association with Serum Sex Steroid Concentrations and Bone Mineral Density in Postmenopausal Women
J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 344 - 351.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Van Pottelbergh, S. Goemaere, and J. M. Kaufman
Bioavailable Estradiol and an Aromatase Gene Polymorphism Are Determinants of Bone Mineral Density Changes in Men over 70 Years of Age
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3075 - 3081.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
B. L. Riggs, S. Khosla, and L. J. Melton III
Sex Steroids and the Construction and Conservation of the Adult Skeleton
Endocr. Rev., June 1, 2002; 23(3): 279 - 302.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Peacock, C. H. Turner, M. J. Econs, and T. Foroud
Genetics of Osteoporosis
Endocr. Rev., June 1, 2002; 23(3): 303 - 326.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masi, L.
Right arrow Articles by Brandi, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masi, L.
Right arrow Articles by Brandi, M. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals