| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Clinical Physiopathology, University of Florence, 50132 Florence, Italy
Address all correspondence and requests for reprints to: Maria Luisa Brandi, M.D., Ph.D., Department of Clinical Physiopathology, Viale Pieraccini 6, 50132 Florence, Italy. E-mail: m.brandi{at}dfc.unifi.it
| Abstract |
|---|
|
|
|---|
2 test = 42.8;
df = 10; P = <0.01). The allele containing
the longer TTTA repeats was statistically more represented in
nonosteoporotic women (Pearsons
2 test = 19.14;
df = 2; P = 0.00007). In addition, women with
a high number of TTTA repeats had a significantly higher lumbar bone
mineral density than women with alleles containing 811 TTTA repeats
(P = 0.03). Finally, considering the spine
fractures, a significantly higher incidence was observed in women with
shorter TTTA repeats than in those with longer TTTA repeats (Pearsons
2 test = 7.3; df = 2; P =
0.02), equivalent to a relative risk of 4.1 (95% confidence interval,
1.1913.87). In conclusion, the aromatase gene can be one of the
several genes potentially involved in the maintenance of bone mass and
in the regulation of bone mass loss. | Introduction |
|---|
|
|
|---|
4 -3-one A
ring of androgens to the corresponding phenolic A ring typical of
estrogens (4, 5, 6). Aromatase enzyme activity and its
corresponding messenger ribonucleic acid (mRNA) have been shown in
cultures of human osteoblast-like cells from adult and fetal bone,
suggesting that estrogens are produced locally in bone
(7, 8, 9, 10, 11). Glucocorticoids, 1
,25-dihydroxyvitamin
D3 and chemokines, control aromatase activity and
mRNA expression in bone (9, 12). In osteoblast-like cells
and osteoclasts, the major promoter is found at exon 1.4 (5, 11). Other tissues use other promoters (13, 14). Despite evidence to support a role for aromatase activity in bone cell metabolism, clinical examples of its importance are only now becoming available (15, 16). Inactivating mutations of the aromatase gene in both sexes are associated with increased bone turnover and decreased bone mineral density (BMD) (17, 18). Treatment of these patients with estrogen markedly improves bone mass (19, 21). Moreover, aromatase expression in bone has been quantified with respect to osteoporosis as detected radiologically (22).
Genes involved in estrogen metabolism (the aromatase gene) and in
estrogenic response (the estrogen receptor
gene) are possible
contributors to the abnormal pathophysiological processes associated
with osteoporosis (23, 24). Genetic variants in the human
aromatase gene, for example, could alter estrogen metabolism. A
tetranucleotide simple tandem repeat polymorphism in intron 4 of the
human aromatase cytochrome P-450 gene has been recently described
(25). The present study was designed to evaluate the
distribution of this aromatase gene polymorphism in a cohort of normal
and osteoporotic postmenopausal Italian women.
| Materials and Methods |
|---|
|
|
|---|
|
Lumbar BMD (L2L4) was measured by DXA (QDR 1000/W, Hologic, Inc., San Francisco, CA), with coefficients of variation of 0.5% in vitro and 0.9% in vivo. BMD at the upper femur (neck, Wards triangle, greater trochanter) was measured by DXA with coefficient of variation of 0.6% in vitro and 1.0% in vivo. A cross-calibration on the precision of measurements between the two centers in Florence and Siena was performed daily. The centers used personal spine phantom for calibration.
Vertebral fractures were evaluated by spine radiographs, according to the method of McCloskey (27). Fractures were present in both nonosteoporotic and osteoporotic women. Nonspine fractures were identified by self-report during the recruitment interview. Only nonviolent fractures were considered. The lateral lumbar spine x-ray was evaluated to detect osteophytes (28) and for facet joint osteoarthritis using a four-point scale (0 = none, 1 = mild, 2 = moderate, 3 = severe). Vascular calcifications were not evaluated because they have minimum impact on spinal density measurement (29).
Aromatase gene polymorphism
Genomic DNA was isolated from blood samples collected in
ethylenediamine tetraacetate by a standard phenol-chloroform extraction
procedure. PCR was performed using as primers GCAGGACTTAGCTAC (TTTA
strand) and TTACAGTGAGCCAAGGTGGT (AAAT strand) (25). PCR
amplification was carried out on 80 ng genomic DNA using 100 pmol of
each oligonucleotide primer radiolabeled with
[
-32P]deoxy-CTP using a random priming
labeling kit (Roche, Mannheim, Germany).
Samples were processed as previously described (30), except that the denaturation cycle at 94 C was extended to 1.4 min. The PCR product was electrophoresed in a 6% polyacrylamide gel containing 7.6 mol/L urea for 3 h at 30 watts. Genotypes were identified by autoradiography.
Statistical analyisis
Aromatase TTTA repeat sequences were divided according to their
mean values (<8, 811, or >11). The frequency distribution of
aromatase allele TTTA repeats and of aromatase genotypes in normal and
osteoporotic groups was compared using the standard
2 test. Only women with the most frequent
genotypes (osteoporotic, n = 185; normal, n = 165) were
considered for statistical analysis. Differences in anthropometric
characteristic, spinal, and femoral BMD among the different aromatase
genotypes were calculated using ANOVA. Similar comparisons were
performed after adjusting mean BMD values for potential confounding
factors, such as age, height, weight, and years since menopause (YSM),
using analysis of covariance (ANCOVA). Tukeys test was used to
compare the genotypes. Data were expressed as the mean ±
SEM, with P < 0.05 accepted as the level
of significance. Statistical analysis was performed using Statistica
5.1 program (Statsoft, Inc., Tulsa, OK).
| Results |
|---|
|
|
|---|
2 test = 27.06; df = 5;
P < 0.001; Fig. 1
|
2 analysis. CC and CN genotypes were the most
represented in our series (respectively, 28.9% and 20.2%; Table 2
2 test = 42.8; df = 10;
P = <0.01). The distribution of aromatase genotypes in
relation to the presence of peripheral and/or spine osteoporotic
fractures did not show significant differences between genotypes in the
184 women analyzed (Pearsons
2 test =
7.36; df = 5; P = 0.19). However, a trend
characterized be a lower incidence of spine fractures was observed in
NN genotype (data not shown).
|
|
2 test
= 19.14; df = 2; P = 0.00007; data not shown). No
statistically significant differences were observed in the incidence of
osteoporotic fractures (peripheral and spine) among the three groups
(Persons
2 test = 0.32; df = 2;
P = 0.08), even though the incidence of fractures in
women with alleles containing the longer TTTA repeats was lower.
Moreover, considering only spine fractures, a significantly higher
incidence was observed in the women with shorter TTTA repeats (spine
fractures: + = 38; - = 3) in comparison with longer TTTA repeats
(spine fractures: + = 11; - = 22) (Pearsons
2 test = 7.3; df = 2;
P = 0.02), equivalent to a relative risk of 4.1 (95%
confidence interval, 1.1913.87; Fig. 3
|
|
|
|
| Discussion |
|---|
|
|
|---|
-inactivating mutation was reported to have a marked
decrease in his BMD (34). Similarly, inactivating
mutations of the aromatase gene were associated with low BMD in males
as well as in females (17, 19). In fertile women the ovary
represents the major source of circulating estrogens, whereas in
postmenopausal women extraglandular aromatization of circulating
androgens becomes the most important metabolic mechanism for estrogen
production (35). Bone tissue and bone-derived cells
express aromatase gene and enzyme activity (9, 11). It is,
therefore, likely that estrogen production in bone tissue could result
in local regulation of bone remodeling during life (9).
With these conditions, the gene encoding aromatase becomes a potential
candidate to be evaluated in the attempt to elucidate the genetic
background of osteoporosis. In the present study the distribution of a
tetranucleotide repeat polymorphism of the human aromatase gene was
evaluated in a population of Italian postmenopausal women. The
nonosteoporotic and osteoporotic populations were homogeneous for
characteristics such as weight, height, age, YSM, and ethnicity. Of the
six major allelic variants, the N allele was shown to be most prevalent
in nonosteoporotic women, suggesting its independent protective
function for susceptibility to osteoporosis. A mechanism through which
the N allele acts as a protective factor could be the capability of
higher local estrogen synthesis in bone tissue of subject bearing N
allele (s). Indeed, the homozygous NN genotype was significantly more
frequent in nonosteoporotic women than in osteoporotic women. In
agreement with this finding, alleles containing longer (>11) TTTA
repeats (mostly represented by the N allele) were more prevalent in
nonosteoporotic women. ANOVA to evaluate lumbar and femoral neck BMD differences among the six major genotypes of the aromatase gene showed a significant difference in genotype distribution at the lumbar spine. There was no correlation with femoral neck BMD. ANCOVA confirmed these results. Applying Tukeys test to compare the six genotypes after ANCOVA analysis, we observed that women with the DN genotype showed significantly lower lumbar BMD than those with NN and CN genotypes. In agreement with these results is the fact that women with a high number of TTTA repeats had a higher lumbar BMD than women with allele containing TTTA repeats between 8 and 11. In particular, lumbar spine BMD was approximately 0.061 g/cm2 (7%) higher in women with a high number of TTTA repeats than in women with alleles containing between 8 and 11 TTTA repeats.
BMD at the lumbar spine was approximately 0.193
g/cm2 (21%) lower in DN individuals than in
those with NN and 0.140 g/cm2 (16.1%) lower than
in those with CN subjects. A difference of this magnitude could
increase long-term fracture risk in DN women compared with NN and CN
patients. In the present study we evaluated potential differences
between genotypes and the incidence of osteoporotic fractures. A total
of 184 women affected by fractures selected from both osteoporotic and
nonosteoporotic groups were analyzed. We did not observe significant
differences among genotypes for the incidence of any site osteoporotic
fractures (Pearsons
2 test = 0.32;
df = 2; P = 0.08). However, the allele with high
number of TTTA repeats had a significantly lower incidence of spine
fractures (spine fractures: + = 38; - = 3; Pearsons
2 test = 7.3; df = 2;
P = 0.02).
Our inability to detect a difference is most likely due to the small size of the sample analyzed. The role of genotype NN in protecting women from postmenopausal bone loss and consequently from risk of developing vertebral fractures is still unknown.
No statistically significant differences in bone density were observed among the six genotypes at the femoral neck. Similarly, women with different numbers of TTTA repeats had femoral neck BMD not statistically different from each other. These results are in keeping with other observations (36). In view of the most rapid loss of lumbar spine bone density due to estrogen deficiency, the aromatase gene could be involved in early postmenopausal bone loss rather than that in the later postmenopausal years. This hypothesis was confirmed by statistical analysis showing a significant segregation of the aromatase genotypes and lumbar BMD only in the first 5 YSM, with the DN genotype showing a lumbar BMD lower by 0.169 g/cm2 (16.7%) compared with the NN genotype.
The mechanism through which aromatase gene activity associated with this polymorphic site controls bone metabolism is obscure. Theoretically women with DN genotype could be characterized by lower aromatase activity and/or synthesis with consequent reduction of estrogen synthesis. The aromatase gene could, therefore, be pivotal in the maintenance of a sufficient amount of local estrogens in bone tissue. Interestingly, the allelic variant containing longer TTTA repeats segregates with breast cancer risk (37, 38). It is likely that patients with allele containing longer TTTA repeats could express higher aromatase activity with increased estrogen production, which should be protective for bone loss while increasing the risk of breast cancer. This interpretation is consistent with the relationship between breast cancer risk and higher BMD (39). In contrast with this interpretation is the lack of correlation between estradiol concentrations and osteoporosis in postmenopausal women (9). Possibly, local bone tissue estrogens more than circulating concentrations may be important in the regulation of bone turnover in postmenopausal women, as estrogens produced locally could act as autocrine or paracrine modulators of bone cells. Functional studies in the future will have to encompass analysis of differential aromatase expression, activity, and regulatory pathways in the presence of different gene polymorphisms.
Finally, several studies are now showing that the age-related decline in male BMD is mostly related to declining estrogens levels (40, 41). It is likely that the effects of estrogens in the male might be due to a balance between local and peripheral estrogen production, and polymorphisms of the aromatase gene in women might have significance for men. There is clear evidence of genetic modulation of bone phenotype parameters, including bone density, quantitative ultrasound, bone size, and bone turnover at any particular age phase of life; genetic factors explain about 70% of the variance in bone phenotype. The importance of genetic heterogeneity, including ethnicity, as well as environmental and confounder factors need to be taken into account in gene search approaches (42).
It is well known that multifactorial diseases such as osteoporosis involve multiple genes and environmental factors and result principally from genetic variations that are relatively common in the general population. Linkage analysis and association studies are the two analytical methods available to detect the specific genetic regions, and candidate genes responsible for complex diseases present several crucial differences. In fact, association studies test whether a disease and an allele show correlated occurrence in a population, whereas linkage studies test whether they show correlated transmission within a pedigree (43). Association analysis for complex diseases may be an efficient approach to recognize genes with major impact even though association studies show some limitations (44), such as ethnical homogeneity and sample size. All of these arguments were considered, and these limitations were carefully evaluated in the analysis performed in the present study. In addition, as suggested by some researchers (43), to prevent spurious associations arising from admixture and given the difficulty of selecting a control group that is perfectly matched for ethnic ancestry, we use as an internal control for allele frequency evaluation the analysis of both affected individuals and their parents. Together, these considerations make it possible to ascribe the aromatase gene to the number of genes involved in the control of postmenopausal bone loss. Association studies are most meaningful when applied to functionally significant variations in genes having a clear biological relation to the trait (43). For this reason, functional studies to evaluate the activity and the expression of aromatase mRNA in fibroblasts of patients with different genotypes are underway in our laboratory. Undoubtedly, the genetic basis of osteoporosis will be found to be associated with a panoply of genes, all of which contribute to the genetic and phenotypic aspects of the postmenopausal women.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received June 28, 2000.
Revised October 13, 2000.
Revised January 8, 2001.
Accepted January 12, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. Czajka-Oraniec, W. Zgliczynski, A. Kurylowicz, M. Mikula, and J. Ostrowski Association between gynecomastia and aromatase (CYP19) polymorphisms Eur. J. Endocrinol., May 1, 2008; 158(5): 721 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. J. van Meurs, T. A. Trikalinos, S. H. Ralston, S. Balcells, M. L. Brandi, K. Brixen, D. P. Kiel, B. L. Langdahl, P. Lips, O. Ljunggren, et al. Large-Scale Analysis of Association Between LRP5 and LRP6 Variants and Osteoporosis JAMA, March 19, 2008; 299(11): 1277 - 1290. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lin, O. Ercan, J. Raza, C. P. Burren, S. M. Creighton, R. J. Auchus, M. T. Dattani, and J. C. Achermann Variable Phenotypes Associated with Aromatase (CYP19) Insufficiency in Humans J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 982 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Riancho, C. Valero, A. Naranjo, D. J. Morales, C. Sanudo, and M. T. Zarrabeitia Identification of an Aromatase Haplotype That Is Associated with Gene Expression and Postmenopausal Osteoporosis J. Clin. Endocrinol. Metab., February 1, 2007; 92(2): 660 - 665. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ferrari Single Gene Mutations and Variations Affecting Bone Turnover and Strength: a Selective 2006 Update IBMS BoneKEy, December 1, 2006; 3(12): 11 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A Riancho, M. T Zarrabeitia, C. Valero, C. Sanudo, V. Mijares, and J. Gonzalez-Macias A gene-to-gene interaction between aromatase and estrogen receptors influences bone mineral density. Eur. J. Endocrinol., July 1, 2006; 155(1): 53 - 59. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. X. Ma, A. A. Adjei, O. E. Salavaggione, J. Coronel, L. Pelleymounter, L. Wang, B. W. Eckloff, D. Schaid, E. D. Wieben, A. A. Adjei, et al. Human Aromatase: Gene Resequencing and Functional Genomics Cancer Res., December 1, 2005; 65(23): 11071 - 11082. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Dick, A. Devine, and R. L. Prince Association of an aromatase TTTA repeat polymorphism with circulating estrogen, bone structure, and biochemistry in older women Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E989 - E995. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Watanabe, S. Ohno, and S. Nakajin Forskolin and dexamethasone synergistically induce aromatase (CYP19) expression in the human osteoblastic cell line SV-HFO Eur. J. Endocrinol., April 1, 2005; 152(4): 619 - 624. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gennari, D. Merlotti, V. De Paola, A. Calabro, L. Becherini, G. Martini, and R. Nuti Estrogen Receptor Gene Polymorphisms and the Genetics of Osteoporosis: A HuGE Review Am. J. Epidemiol., February 15, 2005; 161(4): 307 - 320. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gennari, R. Nuti, and J. P. Bilezikian Aromatase Activity and Bone Homeostasis in Men J. Clin. Endocrinol. Metab., December 1, 2004; 89(12): 5898 - 5907. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gennari, L. Masi, D. Merlotti, L. Picariello, A. Falchetti, A. Tanini, C. Mavilia, F. Del Monte, S. Gonnelli, B. Lucani, et al. A Polymorphic CYP19 TTTA Repeat Influences Aromatase Activity and Estrogen Levels in Elderly Men: Effects on Bone Metabolism J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2803 - 2810. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Somner, S. McLellan, J. Cheung, Y. T. Mak, M. L. Frost, K. M. Knapp, A. S. Wierzbicki, M. Wheeler, I. Fogelman, S. H. Ralston, et al. Polymorphisms in the P450 c17 (17-Hydroxylase/17,20-Lyase) and P450 c19 (Aromatase) Genes: Association with Serum Sex Steroid Concentrations and Bone Mineral Density in Postmenopausal Women J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 344 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Van Pottelbergh, S. Goemaere, and J. M. Kaufman Bioavailable Estradiol and an Aromatase Gene Polymorphism Are Determinants of Bone Mineral Density Changes in Men over 70 Years of Age J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3075 - 3081. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Riggs, S. Khosla, and L. J. Melton III Sex Steroids and the Construction and Conservation of the Adult Skeleton Endocr. Rev., June 1, 2002; 23(3): 279 - 302. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Peacock, C. H. Turner, M. J. Econs, and T. Foroud Genetics of Osteoporosis Endocr. Rev., June 1, 2002; 23(3): 303 - 326. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |