| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Original Studies |
Womens Health Research Institute, Endocrinology Division, Wyeth-Ayerst Research, Inc., Radnor, Pennsylvania 19087
Address all correspondence and requests for reprints to: Dr. Z. Zhang, Womens Health Research Institute, Wyeth-Ayerst Research, Inc., Room 4003, 145 King of Prussia Road, Radnor, Pennsylvania 19087. E-mail: zhangz{at}war.wyeth.com
| Abstract |
|---|
|
|
|---|
mRNA, suggesting a possible defect in steroid and growth
factor regulation. Thus, dysregulation of Cyr61 by estrogen and bFGF
may contribute to down-regulation of Cyr61 in leiomyomas, which, in
turn, may predispose uterine smooth muscle cells toward sustained
growth. | Introduction |
|---|
|
|
|---|
A central hypothesis in the development of leiomyomas is the dominant role of the ovarian steroids, 17ß-estradiol (E2) and progesterone (P4), in sustaining tumor growth. This hypothesis is supported by the observations that symptomatic premenopausal women with leiomyomas who are prescribed GnRH agonists and postmenopausal women who are not receiving hormone replacement therapy demonstrate a decrease in tumor size or enter remission (3, 4). Furthermore, biochemical studies have demonstrated elevated expression of estrogen receptor (ER) and P4 receptor (PR) in leiomyomas (5, 6). Hence, the net effect of menopause and therapeutics is a reduction in the levels of circulating E2 and P4 and, thus, tumor growth. In addition, overexpression of peptide growth factors, such as epidermal growth factor (EGF), heparin-binding EGF (HB-EGF), insulin-like growth factors I and II (IGF-I and IGF-II), and platelet-derived growth factor (PDGF), and somatic chromosomal rearrangements have been implicated as potential drivers of leiomyoma pathogenesis (for review, see Ref. 7). Furthermore, overproduction of extracellular matrix components, such as collagens I and III, is also a sentinel molecular feature of leiomyomas and results in significant fibrosis (8). However, the underlying mechanism of leiomyoma pathogenesis remains to be determined.
An emerging family of matrix-associated immediate early genes that play diverse roles in angiogenic and growth regulation are collectively known as CCN [Connective tissue growth factor (CTGF), Cyr61/Cef10, Nov] proteins. More specifically, Cyr61 is a 42-kDa cysteine-rich secreted heparin-binding protein that is rapidly induced in murine fibroblasts by serum, PDGF, HB-EGF, basic fibroblast growth factor (bFGF), cAMP, and the tumor promoter, 12-O-tetradecanoylphorbol-13-acetate (9, 10, 11). Several lines of evidence suggest that Cyr61 plays diverse roles in cellular proliferation, migration, differentiation, and angiogenesis, biological phenomena required for tumor growth and metastasis (12). Indeed, Cyr61 has been shown to be up-regulated in a number of primary tumor cell lines that have been derived from bladder papillomas, colon adenocarcinomas, melanomas, and meduloblastomas and is thought to be associated with tumorigenesis (13). Interestingly, down-regulation of Cyr61 has been documented in prostate tumors as well (14). Thus, Cyr61 is rapidly induced in an immediate early fashion by a spectrum of stimuli that includes growth factors, cytokines, and hormones and may have putative oncogenic bioactivity.
In this study an attempt to identify genes that may contribute to leiomyoma growth was undertaken using rapid analysis of differential expression (RADE) technology to screen ribonucleic acid (RNA) isolated from leiomyoma and matched myometrial tissues from women who had undergone hysterectomies. Of the several clones identified, Cyr61 was shown to be consistently and markedly down-regulated in leiomyomas compared with healthy autologous myometrium. In addition, given that the uterus is a primary target organ for ovarian steroids, we tested the hypothesis that in addition to growth factors, Cyr61 may be regulated by E2 and P4. The observation that Cyr61 is down-regulated in leiomyomas, which may be due to lack of induction by estrogen and bFGF, raises the possibility that this protein may contribute to tumorigenesis.
| Materials and Methods |
|---|
|
|
|---|
Anti-Cyr61 polyclonal antibodies were generated at the Louisiana State University Medical Center Core Facilities (Baton Rouge, LA) using a 10-amino acid peptide corresponding to amino acids 371381 (N-LYSLFNDIHK-C) of human Cyr61 as the antigen. Peptides were subsequently coupled to keyhole limpet hemocyanin and injected into female New Zealand White rabbits. After preliminary screening of crude antisera by Western analysis of uterine smooth muscle cell lysates, polyclonal antibodies were purified by affinity chromatography using the 371381 Cyr61 peptide as the absorbent. E2 was purchased from Sigma-Aldrich Corp. (St. Louis, MO); the PR agonist, R5020, was obtained from NEN Life Science Products (Boston, MA); bFGF was purchased from R & D Systems (Minneapolis, MN); and ICI 182,780 was provided by Zeneca Pharmaceuticals (Wilmington, DE).
Study subjects and tissue procurement
Uterine leiomyomas and matched myometrial specimens were obtained according to protocols approved by the institutional review boards after routine hysterectomy at the Department of Obstetrics and Gynecology, Pennsylvania Hospital. Tissue samples were provided from patients between the ages of 3853 yr (median age, 45 yr), who were not receiving hormone replacement therapy or prescribed GnRH agonists (n = 38). All but 1 patient had experienced normal menstrual cycles before surgery. At the time of hysterectomy 20 patients were in the proliferative phase, and 17 were in the secretory phase of their menstrual cycle. Tissue specimens were immediately frozen in liquid nitrogen after hysterectomies for total RNA isolation or fixed in 10% neutral-buffered formalin for in situ hybridization. Tissues for ex vivo culture were placed in phenol red-free DMEM/Hams F-12 medium (Life Technologies, Inc., Gaithersburg, MD) containing 100 U/mL penicillin, 100 µg/mL streptomycin, and 250 ng/mL amphotericin B as a fungizone and were transported on ice.
Identification of regulated genes using RADE
RADE was performed as previously reported (15). Briefly, total RNA isolated from matched leiomyoma and myometrial tissues (n = 4) was used for RADE analysis, and each RNA sample was analyzed in duplicate. Synthesis of complementary DNAs (cDNAs) was accomplished using p(deoxythymidine)18 oligonucleotides ending with A, G, or C. After cDNA synthesis, genes were amplified using a combination of random oligomers, appropriate p(deoxythymidine)18 downstream primers, and 35S-labeled deoxy (d)-ATP. The resulting products were amplified in duplicate, separated on SDS-polyacrylamide sequencing gels, and detected by autoradiography. After the procedure was repeated, candidate cDNA fragments were extracted from polyacrylamide gel slices and amplified by PCR using the appropriate pair of the primers. Amplified products were resolved by agarose gel electrophoresis, subcloned into pBR322, sequenced using ABI 377/373 sequencers (PE Applied Biosystems, Foster City, CA), and analyzed using BLASTN software (16).
Northern blotting for Cyr61 and ER
Total cellular RNA was isolated from myometrial and leiomyoma
tissue homogenates by guanidium isothiocyanate lysis followed by
phenol/chloroform extraction. Subsequently, total cellular RNA (20
µg) was subjected to electrophoresis in an 1% agarose gel containing
1 mol/L formaldehyde. Separated RNA transcripts were transferred onto
nylon membranes by capillary electrophoresis and subsequently
prehybridized at 60 C in RapidHyb hybridization solution
(Amersham Pharmacia Biotech, Arlington Heights, IL). A
0.41-kb human Cyr61 cDNA fragment was radiolabeled with
[
-32P]dCTP (3000 Ci/mmol) using the random
primer technique (Rediprime II, Amersham Pharmacia Biotech) and was used as the hybridization probe. The
radiolabeled probe (1 x 106 cpm/mL) was
hybridized to membranes for 4 h at 60 C. Membranes were washed
twice in 1 x SSPE (0.15 mol/L NaCl, 1 µmol/L ethylenediamine
tetraacetate, and 0.01 mol/L sodium phosphate, pH 7.4) and 0.1% SDS
for 15 min at 25 C, followed by a final wash in 0.1 x SSPE and
0.1% SDS for 5 min at 60 C. For ER
expression, membranes were
reprobed with a 1.96-kb human ER
cDNA that was radiolabeled with
[
-32P]dCTP (3000 Ci/mmol), hybridized, and
washed as described above. Relative levels of Cyr61 were normalized to
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) after reprobing
membranes with a 32P-radiolabeled oligonucleotide
according to the manufacturers protocol (end-labeling kit, Life Technologies, Inc.).
Protein extraction and immunoblotting for Cyr61
Tissue protein extracts were prepared from leiomyoma and matched myometrial tissue specimens by homogenization in 50 mmol/L Tris (pH 8.0), 250 mmol/L NaCl, 1.0% Nonidet P-40, 1.0% Triton-X 100, 2% SDS, 0.5% deoxycholate, 1 mmol/L ethylenediamine tetraacetate, and a protease inhibitor cocktail containing 10 µg/mL pepstatin, aprotinin, and leupeptin (Sigma, St. Louis, MO). Protein extracts (20 µg) were subjected to SDS-PAGE under reducing conditions in 10% bis-acrylamide and electrophoretically transferred to polyvinyl difluoride membrane (Immobilon-P, Bio-Rad Laboratories, Inc., Redding, CA). Membranes were blocked with 5% dry milk in Tris-buffered saline/0.1% Tween-20 and incubated with anti-Cyr61 pAb (10 µg/mL). Primary antibody binding was detected using a donkey antirabbit IgG antibody conjugated to horseradish peroxidase and an enhanced chemiluminescence detection system (Amersham Pharmacia Biotech). To normalize protein levels, Cyr61 Western blots were subsequently reprobed with a pan-actin monoclonal antibody (Sigma) and detected with a donkey antimouse secondary antibody conjugated to horseradish peroxidase.
In situ hybridization
For riboprobe synthesis, a 0.28-kb human Cyr61 cDNA fragment was positionally cloned into the EcoRI and HindIII sites of pGEM4Zf plasmid (Promega Corp., Madison, WI) to generate pGEM4Zf/Cyr61. Radiolabeled [35S]UTP sense and antisense complementary RNA transcripts were transcribed in vitro with T3 and T7 RNA polymerases, respectively, using the Gemini Riboprobe system (Promega Corp.). In situ hybridization was performed as described previously (17), using formalin-fixed leiomyoma and matched myometrial specimens. Briefly, processed slides were hybridized overnight with 100150 µL of an antisense or sense (control) riboprobe at 4.7 x 106 dpm/slide in 50% formamide hybridization mixture including 5% dextran sulfate and 200 mmol/L dithiothreitol at 55 C in a humidified chamber containing 50% formamide/600 mmol/L NaCl. Slides were washed three times at room temperature in 2 x SSC (0.3 mol/L NaCl and 0.03 mol/L sodium citrate, pH 7.0)/10 mmol/L dithiothreitol, followed by ribonuclease A (20 µg/mL) treatment for 30 min at 37 C, then washed for 15 min in 0.1 x SSC at room temperature. Slides were further washed at 65 C with 0.1 x SSC to remove nonspecific label and dehydrated with a graded series of alcohol-ammonium acetate (70%, 95%, and 100%). Air-dried slides were exposed to x-ray film (Amersham Pharmacia Biotech) for 3 days for preliminary examination and then dipped in NTB2 nuclear emulsion (Eastman Kodak Co., Rochester, NY) diluted 1:1 with 600 mmol/L ammonium acetate. Slides were exposed for 31 days in light-tight, black, desiccated boxes; photographically processed; stained in cresyl violet; and coverslipped.
Adenovirus/ER
infection of uterine smooth muscle cells
Primary cultures of human uterine smooth muscle cells (UTSMC)
were infected with adenovirus containing the full-length human ER
cDNA at early passages (3, 4, 5, 6) as previously described
(18). Briefly, UTSMCs were cultured in the presence of
DMEM/F-12/10% heat- inactivated serum up to 90% confluence and
infected with an Ad5a/ER
viral stock at a dilution of 1:50 for
3.0 h under 95% air/5% CO2. Immediately
afterward, the medium was replaced with phenol-red free DMEM/F-12/0.1%
heat-inactivated charcoal-stripped serum, and cells were cultured for
an additional 24.0 h. Cells were treated with 10 nmol/L
E2 for 0.5, 1.0, 2.0, 4.0, 8.0, and 24.0 h
for time-course experiments or were cotreated with 100 nmol/L ICI
182,780 for 1.0 h. Total RNA was isolated and analyzed by Northern
blotting as described above. All UTSMC cell infection experiments were
repeated at least three times.
Tissue treatment with sex steroids and growth factors
Tissue specimens obtained as described above were immediately minced into 1- to 2-mm pieces using sterilized scalpels and forceps and placed in phenol-red free DMEM/Hams F-12 containing antifungal and antibiotic agents only. Samples were treated ex vivo with 10 nmol/L E2, 10 nmol/L R5020, a combination of 10 nmol/L E2 and 10 nmol/L R5020, 100 nmol/L ICI 182,780 (ICI), a combination of 10 nmol/L E2 and 100 nmol/L ICI, 10 ng/mL bFGF, 10% charcoal-stripped serum, or ethanol vehicle for 1 h at 37 C under 95% air/5% CO2. Treated tissue specimens were harvested and snap-frozen in liquid nitrogen before RNA isolation and Northern blotting.
Real-time RT-PCR
Total RNA samples from human leiomyoma and myometrium tissues
and Ad5/ER
-infected UTSMCs that were treated with steroid hormones
and/or growth factors were analyzed further by real-time RT-PCR to make
quantitative assessments of increases in Cyr61 RNA levels using the
Taqman Gold procedure (PE Applied Biosytems). Using this
technique, real-time detection of accumulated PCR products was
monitored by an increase in fluorescence, which occurs when flurophores
conjugated to a gene-specific probe are released during each PCR cycle.
The probe consists of an oligonucleotide with a 5'-reporter dye
(6-carboxyfluorescein) and a 3'-quencher
(6-carboxy-N,N,N',N'-tetramethylrhodamine).
The increase in fluorescence signal is detected only if the target
sequence is complimentary to the probe and is amplified during PCR. As
a result, any nonspecific amplification is not detected. Reactions are
performed in an ABI Prism Sequence Detection System, and samples are
analyzed using sequence detection software. Mean fluorescence values
are converted into nanograms of PCR product using a standard curve
consisting of 0.0, 0.48, 2.5, 12.0, 60.0, and 300.0 ng template RNA
during sample analysis. For Cyr61, a total of 50 ng total RNA/sample
were analyzed in triplicate using Cyr61-specific primer pairs
(5'-primer, AGTGCTGCGGAGGAGTGGGT; 3'-primer, ACCTCGGAGGCATCGAATC) and a
customized Cyr61 probe (ACCAGGACGCCTCCTTGGCA). RT was performed at 48 C
for 30 min, followed by 40 cycles of PCR. All values are normalized to
18S ribosomal RNA (rRNA) contained within each sample reaction tube
using specific primer pairs and probes supplied by the
manufacturer.
Statistical analysis
Values derived from densitometric measurements of RNA bands detected on Northern blots were analyzed using SAS statistical software (SAS Institute, Inc., Cary, NC) for significance using the paired t test method for two groups. The fold change in the levels of Cyr61 messenger RNA (mRNA) and protein bands were considered significant if P < 0.05. Numerical values derived by real-time RT-PCR experiments were analyzed for statistical significance by one-way ANOVA for a multifactorial experimental design using Dunnetts t test. The multicomparison significance level for ANOVA was 0.05. If significance was achieved by one-way analysis, post-ANOVA comparison of means was performed using Scheffés F tests (19).
| Results |
|---|
|
|
|---|
RADE analysis of total RNA demonstrated decreased expression of a
410-nucleotide cDNA fragment in 4 of 4 leiomyoma specimens compared
with matched myometrial controls (Fig. 1A
). Sequence analysis using BLASTN
software demonstrated that the cDNA fragment was 96% homologous to the
C-terminal portion of human Cyr61. To confirm down-regulation of Cyr61
in leiomyomas as identified by RADE, Northern analysis using total RNA
isolated from 10 additional patients that had undergone hysterectomies
during the proliferative or secretory phase of the menstrual cycles was
performed. Cyr61 transcripts were markedly diminished in leiomyoma
specimens compared with autologous myometrium in 10 of 10 patients
(Fig. 1B
) studied. The decrease in Cyr61 mRNA, normalized to GAPDH mRNA
levels, was greater than 9-fold compared with the high basal levels
present in autologous myometrium (Fig. 1D
). Northern analysis of total
RNA samples from myometrial tissues isolated from cycling patients did
not reveal differences in Cyr61 mRNA levels between the proliferative
and secretory phases (Fig. 1C
). To confirm that Cyr61 protein levels in
leiomyoma tissue paralleled a decrease in transcript, Western analysis
was performed using affinity-purified polyclonal antibodies that
specifically recognized Cyr61 at 42 kDa with minimal cross-reactivity
(data not shown). Immunoblot analysis of tissue lysates generated from
leiomyoma and matched myometrial controls demonstrated a greater than
9-fold decrease in Cyr61 protein levels in 10 of 10 additional patients
studied as well (Fig. 2
, A and C).
|
|
To determine the precise cell types in which Cyr61 is expressed in
the uterus, in situ hybridization experiments were performed
using tissue sections and 35S-radiolabeled Cyr61
riboprobes. In six of six patients, high levels of Cyr61 mRNA were
detected in myometrial cells that were adjacent to leiomyoma tumors
(Fig. 3
, A and C). However, Cyr61
transcripts were dramatically decreased or absent in leiomyoma smooth
muscle cells (Fig. 3
, A and C) from the same six patients. Leiomyoma
tissues were identified based on gross dissection and classical
morphological characteristics, such as increased matrix deposition.
Negative control slides hybridized with the sense Cyr61 probe gave no
apparent signal (Fig. 3
, B and D). Interestingly, high basal levels of
Cyr61 transcripts were also observed in stromal, but not vascular,
endothelial or glandular epithelial cells in the endometrium (data not
shown). Therefore, the high basal expression of Cyr61 is primarily
confined to uterine smooth muscle cells in healthy myometrium,
whereas in leiomyomas it is decreased.
|
The high constitutive levels of Cyr61 mRNA in the myometrium
prompted us to examine other human tissues to determine whether
elevated basal expression of Cyr61 was an integral feature of other
organs and cell types. Interestingly, a relatively high level of Cyr61
expression was also observed in spleen compared with uterus (Fig. 4A
). Furthermore, in addition to the
uterine myometrium, analysis of other human muscle tissues revealed
high basal expression in skeletal muscle, heart, and bladder, whereas
relatively lower levels were detected in colon, small intestine,
stomach, and prostate (Fig. 4B
). Therefore, high constitutive
expression of Cyr61 appears to be a characteristic feature of organs
such as the heart, bladder, and uterus that are comprised primarily of
smooth and skeletal muscle cells.
|
Cursory analysis of the murine Cyr61 promoter had identified an
estrogen response element from -1195 to -1219 and a
P4 response element from -1592 to -1617. Moreover,
we and others observed a greater than 10-fold increase in Cyr61
expression by E2 in mature ovariectomized rats in
a time-dependent fashion (data not shown) (20). As the
human, murine, and rodent genes are more than 93% conserved
(21), we hypothesized that Cyr61 may be regulated by
estrogen and/or P4 in human myometrium, given that the
uterus is an ovarian sex steroid target organ. However, initial
attempts in our laboratory to maintain steroid receptor-positive
primary culture human UTSMC under a variety of conditions were
unsuccessful. Therefore, ER and PR were reintroduced into UTSMC at
early passages by adenoviral infection, which has been shown to
increase E2 and P4
responsiveness in vitro (18). Treatment of
Ad5/ER
-infected UTSMC with 10 nmol/L E2
resulted in a 2.5-fold increase in Cyr61 mRNA above basal levels within
1.0 h (Fig. 5
, A and C) during a
24-h period. In addition, up-regulation of Cyr61 by
E2 was dependent upon ER
based on the
observations that 1) the antiestrogen, ICI 182,780, completely
inhibited E2 stimulation (Fig. 5
, B and D); and
2) up-regulation was not observed in uninfected UTSMCs treated with 10
nmol/L E2 (data not shown). Cyr61 was not
regulated, however, by the PR agonist, R5020, in Ad5/PR-infected UTSMC
during a 0.0- to 24.0-h treatment period (data not shown). Therefore,
in addition to growth factors, Cyr61 is up-regulated by
E2 in an immediate-early fashion in primary
cultures of human UTSMCs that express ER
.
|
To further address ovarian sex steroid regulation of Cyr61 in the
context of fibroid pathogenesis, freshly obtained leiomyoma and matched
myometrial explants (n = 8) were treated ex vivo
with 10 nmol/L E2, 10 nmol/L R5020, or a
combination of 10 nmol/L E2 and 10 nmol/L R5020.
As a positive control, explants were stimulated with 10 ng/mL bFGF,
which induces Cyr61 in cell types such as murine and human fibroblasts
(10). Quantitative changes in Cyr61 levels after steroid
and growth factor treatments were assessed and corroborated by
real-time RT-PCR in four of the eight explants. Similar to primary
cultured UTSMCs, E2 treatment resulted in a
greater than 2-fold increase in Cyr61 transcript levels within 1 h
in myometrial tissue, whereas the synthetic PR agonist, R5020, had no
effect on Cyr61 expression, nor did it synergize with
E2 (Figs. 6A
and 7
). The E2-mediated
induction of Cyr61 was ER dependent as it was inhibited by the ER
antagonist, ICI 182,780 (Figs. 6A
and 7
). However, no difference in
E2 regulation of Cyr61 was detected in myometrial
tissues isolated from the proliferative or secretory phase of cycling
patients (data not shown). Cyr61 expression was also significantly
enhanced more than 3-fold when myometrial explants were treated with
either bFGF (Figs. 6A
and 7
) or serum (data not shown) for 1 h.
Paradoxically, neither E2 nor bFGF was able to
up-regulate Cyr61 in leiomyoma tissues as observed in myometrial
controls (Figs. 6D
and 7
). The latter observation was not due to the
lack of ER
expression, which was consistently 2-fold higher in
leiomyoma explants compared with autologous myometrium (Figs. 6
, B and
E). Therefore, in addition to bFGF and serum, Cyr61 is rapidly induced
by E2 in human myometrial tissue, but not in
leiomyoma tumors that are ER
positive. The lack of Cyr61 induction
by either sex steroid or growth factor may account in part for
the diminished expression observed in leiomyomas.
|
|
| Discussion |
|---|
|
|
|---|
The dramatic down-regulation of Cyr61 in leiomyomas may imply a novel role for this protein as a potential regulator of smooth muscle cell differentiation. In addition, it is plausible that the lack of Cyr61 expression may augment growth factor activity and enhance smooth muscle cell proliferation in leiomyomas. The relative homology between the N-terminal domain of CCN proteins and members of the IGF-binding protein (IGFBP) superfamily suggests that it may function to modulate IGF activity. Indeed, Cyr61 has been redesignated IGFBP11 and belongs to a subset of emerging IGFBP-related proteins (22). Given that levels of both IGF-I and IGF-II mRNA and protein are elevated in leiomyomas (23), it is possible that suppression of Cyr61 may increase the bioavailability and activity of IGFs. Cyr61 is also a heparin-binding protein that associates with heparin-binding growth factors such as bFGF and PDGF, both of which regulate Cyr61 expression in cell types such as murine fibroblasts and human endothelial cells (24, 25). The ability of bFGF and PDGF to regulate Cyr61 expression may suggest a potential negative feedback mechanism to sequester heparin-binding growth factors and quench their activity. Conceivably, a decrease in Cyr61 expression may render these heparin-binding growth factors, which have been shown to be up-regulated in leiomyomas (7, 26), more accessible to adjacent cells and thus more effective in stimulating cell proliferation.
Alternatively, elevated expression of Cyr61 appears to be a feature of organs that contain muscular tissue, such as heart and uterus. This feature underscores a potential role for Cyr61 in maintaining a differentiated muscle cell phenotype. Although there is no direct evidence that Cyr61 is involved in muscle development, recent investigations have focused on the role of Cyr61 in mammalian chondrogenesis and hippocampal neuronal cell differentiation. For example, in situ hybridization analysis during mouse embryogenesis displayed increased Cyr61 expression in mesenchymal condensations of both mesodermal and neuroectodermal origins as they differentiate into chrondrocytes (27). Furthermore, recombinant murine Cyr61 added exogenously is capable of both accelerating the differentiation of mesenchymal cells into chondrocytes and enhancing the extent of differentiation (28). In addition, Cyr61 is induced by bFGF in a rapid and transient fashion during differentiation of the immortalized neuronal hippocampal cell line H197 (29). Taken together, it appears that Cyr61 plays a novel role in promoting mammalian developmental processes such as chondrogenesis and skeletal and neuronal cell differentiation. Thus, down- regulation of Cyr61 in leiomyomas may result in dedifferentiation of smooth muscle cells and increased sensitization to growth factor-induced cell proliferation.
The role of Cyr61 in mammalian cell development also suggests that aberrant expression may predispose cells toward dysregulated growth, such as in tumorigenesis. Indeed, overexpression of Cyr61 has been observed in several human cell lines derived from human bladder papilloma, colon adenocarcinoma, melanoma, and meduloblastoma (12). In some instances Cyr61 is thought to promote tumorigenesis. For example, transfection of a Cyr61 expression vector into the gastric adenocarcinoma cell line RF-1, which does not express Cyr61, increases these cells tumorigenicity (12). Conversely, Cyr61 is shown to be down-regulated in the epithelium of prostate cancer biopsies and in the embryonal-rhabdomyosarcoma cell line, RD, suggesting that it may function as a tumor suppressor as well (14, 30). Interestingly, rCop1, a recently identified member of the CCN family that shares a high degree of homology to Cyr61, has been shown to be a negative regulator of cell transformation when overexpressed and thus behaves similarly to tumor suppressors (31). Therefore, depending on the cell and tumor types, variable expression of Cyr61 may result in either positive or negative selection for dysregulated cell growth.
As ovarian steroids are primary hormones controlling uterine functions, it is conceivable that estrogens and/or progestins regulate the expression of Cyr61. Indeed, preliminary nucleotide analysis of the murine Cyr61 promoter had identified an estrogen response element from -1195 to -1219 and a P4 response element from -1592 to -1617. Moreover, in mature ovariectomized rats Cyr61 is up-regulated greater than 10-fold by E2 in a time-dependent fashion (20). Our initial attempts to test this hypothesis using primary smooth muscle cells derived from leiomyoma and myometrial tissue specimens were unsuccessful because ER and PR were rapidly lost in culture. Other investigators who have attempted to establish a leiomyoma cell line in vitro that retains ER and PR activity (32) have consistently observed the latter. Therefore, both ER and PR were reintroduced into UTSMC by adenoviral vector delivery and subsequently treated with E2 and the progestin R5020, respectively. Interestingly, in adenovirus-infected UTSMCs Cyr61 is rapidly up-regulated in an immediate-early fashion by E2, but not by R5020. Furthermore, myometrial explants treated ex vivo with E2 for 1.0 h also resulted in a 2-fold increase in Cyr61 expression. Quantitative changes in Cyr61 mRNA levels were corroborated by real-time RT-PCR to distinguish fold changes above 2-fold. However, differences in Cyr61 mRNA levels between proliferative and secretory phases were not observed, which may be due to the fact that Cyr61 is an immediate-early gene that is rapidly induced and down-regulated within 0.52.0 h. As a result it may be difficult to observe any further increases in Cyr61 levels when estrogen is elevated during the proliferative phase of the menstrual cycle, given this small window of time for up-regulation. In addition, exposure of myometrial explants to bFGF or serum results in up-regulation of Cyr61 mRNA levels ex vivo. Therefore, estrogen, growth factors, and other locally acting factors may up-regulate and maintain the high basal expression of Cyr61 in the human uterine myometrium.
Paradoxically, in leiomyoma explants isolated from patients Cyr61 is
not induced by estrogen, bFGF, or serum despite the elevated expression
of ER
, suggesting a possible defect in steroid and/or growth factor
regulation. In addition, we did not observe increased Cyr61 expression
in leiomyoma explants that were extracted during the proliferative or
secretory phase of the menstrual cycle. Given that both bFGF and ER are
elevated in leiomyomas (7, 24), the failure to respond to
estrogen or bFGF may in part explain the diminished levels of Cyr61
expression observed in leiomyomas. Alternatively, the lack of Cyr61
expression in leiomyomas may be due to allelic loss or alterations of
chromosome 1p22-p31 in which the gene is located (20),
abrogation of the estrogen or bFGF-signaling pathway, and/or mutations
of the estrogen and bFGF response elements contained within the
promoter region.
In summary, Cyr61 is dramatically down-regulated at the mRNA and protein levels in human uterine leiomyomas compared with autologous myometrial tissues. Abundant basal levels are present in uterine smooth muscle cells as well as other muscular tissue, such as heart and bladder. In addition to serum growth factors, Cyr61 is an estrogen target gene in the human myometrium. In leiomyomas, however, Cyr61 expression is unresponsive to E2, bFGF, or serum, implying that the lack of Cyr61 synthesis may be due in part due to dysregulation by estrogen and growth factors. The marked down-regulation of Cyr61 in leiomyomas may promote growth by either inhibiting smooth muscle cell differentiation or augmenting the activity of growth factors such as IGFs, HB-EGF, and bFGF. The function of Cyr61 in uterine smooth muscle cell proliferation and differentiation is currently under investigation.
| Acknowledgments |
|---|
Received April 8, 2000.
Revised July 11, 2000.
Revised December 14, 2000.
Accepted December 23, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. S. Dobroff, H. Wang, V. O. Melnikova, G. J. Villares, M. Zigler, L. Huang, and M. Bar-Eli Silencing cAMP-response Element-binding Protein (CREB) Identifies CYR61 as a Tumor Suppressor Gene in Melanoma J. Biol. Chem., September 18, 2009; 284(38): 26194 - 26206. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. N. Nierth-Simpson, M. M. Martin, T.-C. Chiang, L. I. Melnik, L. V. Rhodes, S. E. Muir, M. E. Burow, and J. A. McLachlan Human Uterine Smooth Muscle and Leiomyoma Cells Differ in Their Rapid 17{beta}-Estradiol Signaling: Implications for Proliferation Endocrinology, May 1, 2009; 150(5): 2436 - 2445. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-W. Tan, W.-H. Yang, Y.-T. Lin, S.-F. Hsu, T.-M. Li, S.-T. Kao, W.-C. Chen, Y.-C. Fong, and C.-H. Tang Cyr61 increases migration and MMP-13 expression via {alpha}v{beta}3 integrin, FAK, ERK and AP-1-dependent pathway in human chondrosarcoma cells Carcinogenesis, February 1, 2009; 30(2): 258 - 268. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R Harlow, A. C Bradshaw, M. T Rae, K. D Shearer, and S. G Hillier Oestrogen formation and connective tissue growth factor expression in rat granulosa cells J. Endocrinol., January 1, 2007; 192(1): 41 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Luo, L. Ding, and N. Chegini CCNs, fibulin-1C and S100A4 expression in leiomyoma and myometrium: inverse association with TGF-{beta} and regulation by TGF-{beta} in leiomyoma and myometrial smooth muscle cells Mol. Hum. Reprod., April 1, 2006; 12(4): 245 - 256. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zaitseva, B. J. Vollenhoven, and P. A.W. Rogers In vitro culture significantly alters gene expression profiles and reduces differences between myometrial and fibroid smooth muscle cells Mol. Hum. Reprod., March 1, 2006; 12(3): 187 - 207. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gery, D. Xie, D. Yin, H. Gabra, C. Miller, H. Wang, D. Scott, W. S. Yi, M. L. Popoviciu, J. W. Said, et al. Ovarian Carcinomas: CCN Genes Are Aberrantly Expressed and CCN1 Promotes Proliferation of these Cells Clin. Cancer Res., October 15, 2005; 11(20): 7243 - 7254. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-T. Lin, C.-Y. Zuon, C.-C. Chang, S.-T. Chen, C.-P. Chen, B.-R. Lin, M.-Y. Wang, Y.-M. Jeng, K.-J. Chang, P.-H. Lee, et al. Cyr61 Induces Gastric Cancer Cell Motility/Invasion via Activation of the Integrin/Nuclear Factor-{kappa}B/Cyclooxygenase-2 Signaling Pathway Clin. Cancer Res., August 15, 2005; 11(16): 5809 - 5820. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Arslan, L. I. Gold, K. Mittal, T.-C. Suen, I. Belitskaya-Levy, M.-S. Tang, and P. Toniolo Gene expression studies provide clues to the pathogenesis of uterine leiomyoma: new evidence and a systematic review Hum. Reprod., April 1, 2005; 20(4): 852 - 863. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Chien, T. Kumagai, C. W. Miller, J. C. Desmond, J. M. Frank, J. W. Said, and H. P. Koeffler Cyr61 Suppresses Growth of Human Endometrial Cancer Cells J. Biol. Chem., December 17, 2004; 279(51): 53087 - 53096. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sakamoto, M. Yokoyama, X. Zhang, K. Prakash, K. Nagao, T. Hatanaka, R. H. Getzenberg, and Y. Kakehi Increased Expression of CYR61, an Extracellular Matrix Signaling Protein, in Human Benign Prostatic Hyperplasia and Its Regulation by Lysophosphatidic Acid Endocrinology, June 1, 2004; 145(6): 2929 - 2940. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Absenger, H. Hess-Stumpp, B. Kreft, J. Kratzschmar, B. Haendler, N. Schutze, P.-A. Regidor, and E. Winterhager Cyr61, a deregulated gene in endometriosis Mol. Hum. Reprod., June 1, 2004; 10(6): 399 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Mason, A. C. Lake, J. E. Wubben, R. A. Nowak, and J. J. Castellot Jr The growth arrest-specific gene CCN5 is deficient in human leiomyomas and inhibits the proliferation and motility of cultured human uterine smooth muscle cells Mol. Hum. Reprod., March 1, 2004; 10(3): 181 - 187. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Mason, D. Grove-Strawser, B. S. Rubin, R. A. Nowak, and J. J. Castellot Jr. Estrogen Induces CCN5 Expression in the Rat Uterus in Vivo Endocrinology, February 1, 2004; 145(2): 976 - 982. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Weston, A. C. Trajstman, C. E. Gargett, U. Manuelpillai, B. J. Vollenhoven, and P. A.W. Rogers Fibroids display an anti-angiogenic gene expression profile when compared with adjacent myometrium Mol. Hum. Reprod., September 1, 2003; 9(9): 541 - 549. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Soon, T.-A. Yie, A. Shvarts, A. J. Levine, F. Su, and K.-M. Tchou-Wong Overexpression of WISP-1 Down-regulated Motility and Invasion of Lung Cancer Cells through Inhibition of Rac Activation J. Biol. Chem., March 21, 2003; 278(13): 11465 - 11470. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tong, D. Xie, J. O'Kelly, C. W. Miller, C. Muller-Tidow, and H. P. Koeffler Cyr61, a Member of CCN Family, Is a Tumor Suppressor in Non-Small Cell Lung Cancer J. Biol. Chem., December 7, 2001; 276(50): 47709 - 47714. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sampath, R. C. Winneker, and Z. Zhang Cyr61, a Member of the CCN Family, Is Required for MCF-7 Cell Proliferation: Regulation by 17{beta}-Estradiol and Overexpression in Human Breast Cancer Endocrinology, June 1, 2001; 142(6): 2540 - 2548. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |