help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sampath, D.
Right arrow Articles by Zhang, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sampath, D.
Right arrow Articles by Zhang, Z.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
Medline Plus Health Information
*Uterine Cancer
*Uterine Fibroids
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 4 1707-1715
Copyright © 2001 by The Endocrine Society


Original Studies

Aberrant Expression of Cyr61, a Member of the CCN (CTGF/Cyr61/Cef10/NOVH) Family, and Dysregulation by 17ß-Estradiol and Basic Fibroblast Growth Factor in Human Uterine Leiomyomas

Deepak Sampath, Yuan Zhu, Richard C. Winneker and Zhiming Zhang

Women’s Health Research Institute, Endocrinology Division, Wyeth-Ayerst Research, Inc., Radnor, Pennsylvania 19087

Address all correspondence and requests for reprints to: Dr. Z. Zhang, Women’s Health Research Institute, Wyeth-Ayerst Research, Inc., Room 4003, 145 King of Prussia Road, Radnor, Pennsylvania 19087. E-mail: zhangz{at}war.wyeth.com


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Uterine leiomyomas are the most common tumors of the reproductive tract, afflicting women between the ages of 30–55 yr. Although considered to be the leading cause of hysterectomies in the United States, little is known of the etiology and mechanisms of pathogenesis in leiomyomas. Accordingly, rapid analysis of differential expression (RADE) was employed to identify genes that are abnormally expressed in leiomyomas. Of the several genes identified, Cyr61, a member of the CCN family of growth and angiogenic regulators, was shown to be markedly down-regulated at the messenger ribonucleic acid (mRNA) and protein levels in leiomyoma tumors compared with the matched uterine myometrial controls (n = 38). In addition, in situ hybridization experiments corroborated the lack of Cyr61 expression in leiomyoma cells, whereas abundant transcript levels were identified in adjacent myometrial smooth muscle cells. To elucidate the mechanisms of Cyr61 gene regulation in leiomyomas, we determined the effects of ovarian steroids, basic fibroblast growth factor (bFGF), and serum, on Cyr61 expression using an ex vivo culture system. Treatment of human myometrial explants with 17ß-estradiol and bFGF up-regulated Cyr61 transcripts, whereas the progesterone receptor agonist, R5020 (alone or in combination with 17ß-estradiol), had no effect. Paradoxically, neither 17ß-estradiol nor bFGF was capable of up-regulating Cyr61 mRNA in leiomyoma explants despite elevated levels of ER{alpha} mRNA, suggesting a possible defect in steroid and growth factor regulation. Thus, dysregulation of Cyr61 by estrogen and bFGF may contribute to down-regulation of Cyr61 in leiomyomas, which, in turn, may predispose uterine smooth muscle cells toward sustained growth.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
UTERINE LEIOMYOMAS, or fibroids, are typically defined as benign tumors of the myometrial smooth muscle tissue. As such, leiomyoma cells are hypothesized to originate from dedifferentiated smooth muscle cells in the myometrium that exhibit elevated mitotic activity as a result of clonal expansion (1). Approximately 25% of women between the reproductive ages of 30–55 yr are afflicted with leiomyomas. Although considered to be a benign disease, uterine leiomyomas account for more than 30% of all hysterectomies performed in the United States and pose a major health concern among women (2).

A central hypothesis in the development of leiomyomas is the dominant role of the ovarian steroids, 17ß-estradiol (E2) and progesterone (P4), in sustaining tumor growth. This hypothesis is supported by the observations that symptomatic premenopausal women with leiomyomas who are prescribed GnRH agonists and postmenopausal women who are not receiving hormone replacement therapy demonstrate a decrease in tumor size or enter remission (3, 4). Furthermore, biochemical studies have demonstrated elevated expression of estrogen receptor (ER) and P4 receptor (PR) in leiomyomas (5, 6). Hence, the net effect of menopause and therapeutics is a reduction in the levels of circulating E2 and P4 and, thus, tumor growth. In addition, overexpression of peptide growth factors, such as epidermal growth factor (EGF), heparin-binding EGF (HB-EGF), insulin-like growth factors I and II (IGF-I and IGF-II), and platelet-derived growth factor (PDGF), and somatic chromosomal rearrangements have been implicated as potential drivers of leiomyoma pathogenesis (for review, see Ref. 7). Furthermore, overproduction of extracellular matrix components, such as collagens I and III, is also a sentinel molecular feature of leiomyomas and results in significant fibrosis (8). However, the underlying mechanism of leiomyoma pathogenesis remains to be determined.

An emerging family of matrix-associated immediate early genes that play diverse roles in angiogenic and growth regulation are collectively known as CCN [Connective tissue growth factor (CTGF), Cyr61/Cef10, Nov] proteins. More specifically, Cyr61 is a 42-kDa cysteine-rich secreted heparin-binding protein that is rapidly induced in murine fibroblasts by serum, PDGF, HB-EGF, basic fibroblast growth factor (bFGF), cAMP, and the tumor promoter, 12-O-tetradecanoylphorbol-13-acetate (9, 10, 11). Several lines of evidence suggest that Cyr61 plays diverse roles in cellular proliferation, migration, differentiation, and angiogenesis, biological phenomena required for tumor growth and metastasis (12). Indeed, Cyr61 has been shown to be up-regulated in a number of primary tumor cell lines that have been derived from bladder papillomas, colon adenocarcinomas, melanomas, and meduloblastomas and is thought to be associated with tumorigenesis (13). Interestingly, down-regulation of Cyr61 has been documented in prostate tumors as well (14). Thus, Cyr61 is rapidly induced in an immediate early fashion by a spectrum of stimuli that includes growth factors, cytokines, and hormones and may have putative oncogenic bioactivity.

In this study an attempt to identify genes that may contribute to leiomyoma growth was undertaken using rapid analysis of differential expression (RADE) technology to screen ribonucleic acid (RNA) isolated from leiomyoma and matched myometrial tissues from women who had undergone hysterectomies. Of the several clones identified, Cyr61 was shown to be consistently and markedly down-regulated in leiomyomas compared with healthy autologous myometrium. In addition, given that the uterus is a primary target organ for ovarian steroids, we tested the hypothesis that in addition to growth factors, Cyr61 may be regulated by E2 and P4. The observation that Cyr61 is down-regulated in leiomyomas, which may be due to lack of induction by estrogen and bFGF, raises the possibility that this protein may contribute to tumorigenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Anti-Cyr61 polyclonal antibodies were generated at the Louisiana State University Medical Center Core Facilities (Baton Rouge, LA) using a 10-amino acid peptide corresponding to amino acids 371–381 (N-LYSLFNDIHK-C) of human Cyr61 as the antigen. Peptides were subsequently coupled to keyhole limpet hemocyanin and injected into female New Zealand White rabbits. After preliminary screening of crude antisera by Western analysis of uterine smooth muscle cell lysates, polyclonal antibodies were purified by affinity chromatography using the 371–381 Cyr61 peptide as the absorbent. E2 was purchased from Sigma-Aldrich Corp. (St. Louis, MO); the PR agonist, R5020, was obtained from NEN Life Science Products (Boston, MA); bFGF was purchased from R & D Systems (Minneapolis, MN); and ICI 182,780 was provided by Zeneca Pharmaceuticals (Wilmington, DE).

Study subjects and tissue procurement

Uterine leiomyomas and matched myometrial specimens were obtained according to protocols approved by the institutional review boards after routine hysterectomy at the Department of Obstetrics and Gynecology, Pennsylvania Hospital. Tissue samples were provided from patients between the ages of 38–53 yr (median age, 45 yr), who were not receiving hormone replacement therapy or prescribed GnRH agonists (n = 38). All but 1 patient had experienced normal menstrual cycles before surgery. At the time of hysterectomy 20 patients were in the proliferative phase, and 17 were in the secretory phase of their menstrual cycle. Tissue specimens were immediately frozen in liquid nitrogen after hysterectomies for total RNA isolation or fixed in 10% neutral-buffered formalin for in situ hybridization. Tissues for ex vivo culture were placed in phenol red-free DMEM/Ham’s F-12 medium (Life Technologies, Inc., Gaithersburg, MD) containing 100 U/mL penicillin, 100 µg/mL streptomycin, and 250 ng/mL amphotericin B as a fungizone and were transported on ice.

Identification of regulated genes using RADE

RADE was performed as previously reported (15). Briefly, total RNA isolated from matched leiomyoma and myometrial tissues (n = 4) was used for RADE analysis, and each RNA sample was analyzed in duplicate. Synthesis of complementary DNAs (cDNAs) was accomplished using p(deoxythymidine)18 oligonucleotides ending with A, G, or C. After cDNA synthesis, genes were amplified using a combination of random oligomers, appropriate p(deoxythymidine)18 downstream primers, and 35S-labeled deoxy (d)-ATP. The resulting products were amplified in duplicate, separated on SDS-polyacrylamide sequencing gels, and detected by autoradiography. After the procedure was repeated, candidate cDNA fragments were extracted from polyacrylamide gel slices and amplified by PCR using the appropriate pair of the primers. Amplified products were resolved by agarose gel electrophoresis, subcloned into pBR322, sequenced using ABI 377/373 sequencers (PE Applied Biosystems, Foster City, CA), and analyzed using BLASTN software (16).

Northern blotting for Cyr61 and ER{alpha}

Total cellular RNA was isolated from myometrial and leiomyoma tissue homogenates by guanidium isothiocyanate lysis followed by phenol/chloroform extraction. Subsequently, total cellular RNA (20 µg) was subjected to electrophoresis in an 1% agarose gel containing 1 mol/L formaldehyde. Separated RNA transcripts were transferred onto nylon membranes by capillary electrophoresis and subsequently prehybridized at 60 C in RapidHyb hybridization solution (Amersham Pharmacia Biotech, Arlington Heights, IL). A 0.41-kb human Cyr61 cDNA fragment was radiolabeled with [{alpha}-32P]dCTP (3000 Ci/mmol) using the random primer technique (Rediprime II, Amersham Pharmacia Biotech) and was used as the hybridization probe. The radiolabeled probe (1 x 106 cpm/mL) was hybridized to membranes for 4 h at 60 C. Membranes were washed twice in 1 x SSPE (0.15 mol/L NaCl, 1 µmol/L ethylenediamine tetraacetate, and 0.01 mol/L sodium phosphate, pH 7.4) and 0.1% SDS for 15 min at 25 C, followed by a final wash in 0.1 x SSPE and 0.1% SDS for 5 min at 60 C. For ER{alpha} expression, membranes were reprobed with a 1.96-kb human ER{alpha} cDNA that was radiolabeled with [{alpha}-32P]dCTP (3000 Ci/mmol), hybridized, and washed as described above. Relative levels of Cyr61 were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) after reprobing membranes with a 32P-radiolabeled oligonucleotide according to the manufacturer’s protocol (end-labeling kit, Life Technologies, Inc.).

Protein extraction and immunoblotting for Cyr61

Tissue protein extracts were prepared from leiomyoma and matched myometrial tissue specimens by homogenization in 50 mmol/L Tris (pH 8.0), 250 mmol/L NaCl, 1.0% Nonidet P-40, 1.0% Triton-X 100, 2% SDS, 0.5% deoxycholate, 1 mmol/L ethylenediamine tetraacetate, and a protease inhibitor cocktail containing 10 µg/mL pepstatin, aprotinin, and leupeptin (Sigma, St. Louis, MO). Protein extracts (20 µg) were subjected to SDS-PAGE under reducing conditions in 10% bis-acrylamide and electrophoretically transferred to polyvinyl difluoride membrane (Immobilon-P, Bio-Rad Laboratories, Inc., Redding, CA). Membranes were blocked with 5% dry milk in Tris-buffered saline/0.1% Tween-20 and incubated with anti-Cyr61 pAb (10 µg/mL). Primary antibody binding was detected using a donkey antirabbit IgG antibody conjugated to horseradish peroxidase and an enhanced chemiluminescence detection system (Amersham Pharmacia Biotech). To normalize protein levels, Cyr61 Western blots were subsequently reprobed with a pan-actin monoclonal antibody (Sigma) and detected with a donkey antimouse secondary antibody conjugated to horseradish peroxidase.

In situ hybridization

For riboprobe synthesis, a 0.28-kb human Cyr61 cDNA fragment was positionally cloned into the EcoRI and HindIII sites of pGEM4Zf plasmid (Promega Corp., Madison, WI) to generate pGEM4Zf/Cyr61. Radiolabeled [35S]UTP sense and antisense complementary RNA transcripts were transcribed in vitro with T3 and T7 RNA polymerases, respectively, using the Gemini Riboprobe system (Promega Corp.). In situ hybridization was performed as described previously (17), using formalin-fixed leiomyoma and matched myometrial specimens. Briefly, processed slides were hybridized overnight with 100–150 µL of an antisense or sense (control) riboprobe at 4.7 x 106 dpm/slide in 50% formamide hybridization mixture including 5% dextran sulfate and 200 mmol/L dithiothreitol at 55 C in a humidified chamber containing 50% formamide/600 mmol/L NaCl. Slides were washed three times at room temperature in 2 x SSC (0.3 mol/L NaCl and 0.03 mol/L sodium citrate, pH 7.0)/10 mmol/L dithiothreitol, followed by ribonuclease A (20 µg/mL) treatment for 30 min at 37 C, then washed for 15 min in 0.1 x SSC at room temperature. Slides were further washed at 65 C with 0.1 x SSC to remove nonspecific label and dehydrated with a graded series of alcohol-ammonium acetate (70%, 95%, and 100%). Air-dried slides were exposed to x-ray film (Amersham Pharmacia Biotech) for 3 days for preliminary examination and then dipped in NTB2 nuclear emulsion (Eastman Kodak Co., Rochester, NY) diluted 1:1 with 600 mmol/L ammonium acetate. Slides were exposed for 31 days in light-tight, black, desiccated boxes; photographically processed; stained in cresyl violet; and coverslipped.

Adenovirus/ER{alpha} infection of uterine smooth muscle cells

Primary cultures of human uterine smooth muscle cells (UTSMC) were infected with adenovirus containing the full-length human ER{alpha} cDNA at early passages (3, 4, 5, 6) as previously described (18). Briefly, UTSMCs were cultured in the presence of DMEM/F-12/10% heat- inactivated serum up to 90% confluence and infected with an Ad5a/ER{alpha} viral stock at a dilution of 1:50 for 3.0 h under 95% air/5% CO2. Immediately afterward, the medium was replaced with phenol-red free DMEM/F-12/0.1% heat-inactivated charcoal-stripped serum, and cells were cultured for an additional 24.0 h. Cells were treated with 10 nmol/L E2 for 0.5, 1.0, 2.0, 4.0, 8.0, and 24.0 h for time-course experiments or were cotreated with 100 nmol/L ICI 182,780 for 1.0 h. Total RNA was isolated and analyzed by Northern blotting as described above. All UTSMC cell infection experiments were repeated at least three times.

Tissue treatment with sex steroids and growth factors

Tissue specimens obtained as described above were immediately minced into 1- to 2-mm pieces using sterilized scalpels and forceps and placed in phenol-red free DMEM/Ham’s F-12 containing antifungal and antibiotic agents only. Samples were treated ex vivo with 10 nmol/L E2, 10 nmol/L R5020, a combination of 10 nmol/L E2 and 10 nmol/L R5020, 100 nmol/L ICI 182,780 (ICI), a combination of 10 nmol/L E2 and 100 nmol/L ICI, 10 ng/mL bFGF, 10% charcoal-stripped serum, or ethanol vehicle for 1 h at 37 C under 95% air/5% CO2. Treated tissue specimens were harvested and snap-frozen in liquid nitrogen before RNA isolation and Northern blotting.

Real-time RT-PCR

Total RNA samples from human leiomyoma and myometrium tissues and Ad5/ER{alpha}-infected UTSMCs that were treated with steroid hormones and/or growth factors were analyzed further by real-time RT-PCR to make quantitative assessments of increases in Cyr61 RNA levels using the Taqman Gold procedure (PE Applied Biosytems). Using this technique, real-time detection of accumulated PCR products was monitored by an increase in fluorescence, which occurs when flurophores conjugated to a gene-specific probe are released during each PCR cycle. The probe consists of an oligonucleotide with a 5'-reporter dye (6-carboxyfluorescein) and a 3'-quencher (6-carboxy-N,N,N',N'-tetramethylrhodamine). The increase in fluorescence signal is detected only if the target sequence is complimentary to the probe and is amplified during PCR. As a result, any nonspecific amplification is not detected. Reactions are performed in an ABI Prism Sequence Detection System, and samples are analyzed using sequence detection software. Mean fluorescence values are converted into nanograms of PCR product using a standard curve consisting of 0.0, 0.48, 2.5, 12.0, 60.0, and 300.0 ng template RNA during sample analysis. For Cyr61, a total of 50 ng total RNA/sample were analyzed in triplicate using Cyr61-specific primer pairs (5'-primer, AGTGCTGCGGAGGAGTGGGT; 3'-primer, ACCTCGGAGGCATCGAATC) and a customized Cyr61 probe (ACCAGGACGCCTCCTTGGCA). RT was performed at 48 C for 30 min, followed by 40 cycles of PCR. All values are normalized to 18S ribosomal RNA (rRNA) contained within each sample reaction tube using specific primer pairs and probes supplied by the manufacturer.

Statistical analysis

Values derived from densitometric measurements of RNA bands detected on Northern blots were analyzed using SAS statistical software (SAS Institute, Inc., Cary, NC) for significance using the paired t test method for two groups. The fold change in the levels of Cyr61 messenger RNA (mRNA) and protein bands were considered significant if P < 0.05. Numerical values derived by real-time RT-PCR experiments were analyzed for statistical significance by one-way ANOVA for a multifactorial experimental design using Dunnett’s t test. The multicomparison significance level for ANOVA was 0.05. If significance was achieved by one-way analysis, post-ANOVA comparison of means was performed using Scheffé’s F tests (19).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Down-regulation of Cyr61 in leiomyoma tumors

RADE analysis of total RNA demonstrated decreased expression of a 410-nucleotide cDNA fragment in 4 of 4 leiomyoma specimens compared with matched myometrial controls (Fig. 1AGo). Sequence analysis using BLASTN software demonstrated that the cDNA fragment was 96% homologous to the C-terminal portion of human Cyr61. To confirm down-regulation of Cyr61 in leiomyomas as identified by RADE, Northern analysis using total RNA isolated from 10 additional patients that had undergone hysterectomies during the proliferative or secretory phase of the menstrual cycles was performed. Cyr61 transcripts were markedly diminished in leiomyoma specimens compared with autologous myometrium in 10 of 10 patients (Fig. 1BGo) studied. The decrease in Cyr61 mRNA, normalized to GAPDH mRNA levels, was greater than 9-fold compared with the high basal levels present in autologous myometrium (Fig. 1DGo). Northern analysis of total RNA samples from myometrial tissues isolated from cycling patients did not reveal differences in Cyr61 mRNA levels between the proliferative and secretory phases (Fig. 1CGo). To confirm that Cyr61 protein levels in leiomyoma tissue paralleled a decrease in transcript, Western analysis was performed using affinity-purified polyclonal antibodies that specifically recognized Cyr61 at 42 kDa with minimal cross-reactivity (data not shown). Immunoblot analysis of tissue lysates generated from leiomyoma and matched myometrial controls demonstrated a greater than 9-fold decrease in Cyr61 protein levels in 10 of 10 additional patients studied as well (Fig. 2Go, A and C).



View larger version (31K):
[in this window]
[in a new window]
 
Figure 1. Identification of Cyr61 by RADE methodology and confirmation by Northern analysis. A, Representative autoradiograph of 35S-radiolabeled cDNAs generated from total RNA extracted from leiomyoma (L) and matched myometrial (M) tissues (n = 4) analyzed in duplicate. B, Representative Northern blot of total RNA isolated from leiomyomas (L) and matched myometrial (M) tissues hybridized with a 0.41-kb partial cDNA fragment of Cyr61 and analyzed as described in Materials and Methods. Specimens were obtained from patients that were in the proliferative (P) or secretory (S) phase of their menstrual cycles during the time of hysterectomies. Arrows indicate the positions of the 2.4-kb major and the 3.5-kb minor Cyr61 transcripts. C, Membranes were subsequently reprobed with a 2.0-kb radiolabeled mouse GAPDH to verify equivalent sample loading. D, Densimetric analysis of Cyr61 mRNA levels using a Molecular Dynamics, Inc., PhosphorImager (Sunnyvale, CA) and image quantitation software. Numerical values are based on the relative volume of the band size, and the total amount of Cyr61 was normalized to the level of GAPDH. The fold expression of Cyr61 was calculated by dividing the ratio of Cyr61/GAPDH in myometrial tissues by leiomyoma tissues. Values represent the mean ± SD for 10 patients. *, Significant decrease in levels compared with myometrial control values.

 


View larger version (40K):
[in this window]
[in a new window]
 
Figure 2. Analysis of Cyr61 protein expression in leiomyomas. A, Representative Western blot of tissue protein extracts generated from leiomyoma and matched myometrial tissues. Twenty micrograms of tissue lysates were separated on a 10% bis-acrylamide gel and transferred onto polyvinylidene difluoride membranes. Membranes were subsequently probed with an anti-Cyr61 polyclonal antibody (10 µg/mL), followed by a donkey antirabbit secondary antibody conjugated to horseradish peroxidase. Detection of Cyr61 proteins was accomplished using an enhanced chemiluminescent as described in Materials and Methods. B, Protein blots were subsequently reprobed with an antiactin monospecific antibody to confirm equivalent protein loading. C, Cyr61 protein levels were quantitated by densitometric analysis using a Bio-Rad Laboratories, Inc., molecular imager. Numerical values are based on the relative optical density (OD) of the band size, and the total amount of Cyr61 was normalized to the level of actin. The fold expression of Cyr61 was calculated by dividing the ratio of Cyr61/actin in myometrial tissues by leiomyoma tissues. Values represent the mean ± SD for 10 patients. *, Significant decrease in levels compared with myometrial control values.

 
Suppression of Cyr61 expression in uterine leiomyoma smooth muscle cells

To determine the precise cell types in which Cyr61 is expressed in the uterus, in situ hybridization experiments were performed using tissue sections and 35S-radiolabeled Cyr61 riboprobes. In six of six patients, high levels of Cyr61 mRNA were detected in myometrial cells that were adjacent to leiomyoma tumors (Fig. 3Go, A and C). However, Cyr61 transcripts were dramatically decreased or absent in leiomyoma smooth muscle cells (Fig. 3Go, A and C) from the same six patients. Leiomyoma tissues were identified based on gross dissection and classical morphological characteristics, such as increased matrix deposition. Negative control slides hybridized with the sense Cyr61 probe gave no apparent signal (Fig. 3Go, B and D). Interestingly, high basal levels of Cyr61 transcripts were also observed in stromal, but not vascular, endothelial or glandular epithelial cells in the endometrium (data not shown). Therefore, the high basal expression of Cyr61 is primarily confined to uterine smooth muscle cells in healthy myometrium, whereas in leiomyomas it is decreased.



View larger version (157K):
[in this window]
[in a new window]
 
Figure 3. Suppression of Cyr61 expression in uterine leiomyoma smooth muscle cells as determined by in situ hybridization. Representative low magnification darkfield (A and B) and high magnification brightfield (C and D) photomicrographs of leiomyoma and adjacent myometrial tissue sections. Arrows denote representative uterine smooth muscle cells (M) that express elevated Cyr61 transcripts and are adjacent to leiomyoma tumor cells (L). In situ hybridization was accomplished with a 35S-radiolabed 280-bp Cyr61 cRNA antisense probe (A and C). Sense radiolabeled cRNA probes gave no signal above background (B and D) in serial tissue sections. Magnification, x100 (A and B) and x400 (C and D). Bars, 15 µm (A and B) and 5 µm (C and D).

 
Differential expression of Cyr61 in human tissue

The high constitutive levels of Cyr61 mRNA in the myometrium prompted us to examine other human tissues to determine whether elevated basal expression of Cyr61 was an integral feature of other organs and cell types. Interestingly, a relatively high level of Cyr61 expression was also observed in spleen compared with uterus (Fig. 4AGo). Furthermore, in addition to the uterine myometrium, analysis of other human muscle tissues revealed high basal expression in skeletal muscle, heart, and bladder, whereas relatively lower levels were detected in colon, small intestine, stomach, and prostate (Fig. 4BGo). Therefore, high constitutive expression of Cyr61 appears to be a characteristic feature of organs such as the heart, bladder, and uterus that are comprised primarily of smooth and skeletal muscle cells.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Differential expression of Cyr61 in multiple human tissues. Multiple human tissue (A) and human muscle tissue (B) total RNA nylon membranes were obtained from CLONTECH Laboratories, Inc., and hybridized with a 32P-labeled Cyr61 cDNA probe as described above. Arrows indicate the positions of the 2.4-kb major and the 3.5-kb minor Cyr61 transcripts.

 
Cyr61 is up-regulated by E2 in human uterine smooth muscle cells

Cursory analysis of the murine Cyr61 promoter had identified an estrogen response element from -1195 to -1219 and a P4 response element from -1592 to -1617. Moreover, we and others observed a greater than 10-fold increase in Cyr61 expression by E2 in mature ovariectomized rats in a time-dependent fashion (data not shown) (20). As the human, murine, and rodent genes are more than 93% conserved (21), we hypothesized that Cyr61 may be regulated by estrogen and/or P4 in human myometrium, given that the uterus is an ovarian sex steroid target organ. However, initial attempts in our laboratory to maintain steroid receptor-positive primary culture human UTSMC under a variety of conditions were unsuccessful. Therefore, ER and PR were reintroduced into UTSMC at early passages by adenoviral infection, which has been shown to increase E2 and P4 responsiveness in vitro (18). Treatment of Ad5/ER{alpha}-infected UTSMC with 10 nmol/L E2 resulted in a 2.5-fold increase in Cyr61 mRNA above basal levels within 1.0 h (Fig. 5Go, A and C) during a 24-h period. In addition, up-regulation of Cyr61 by E2 was dependent upon ER{alpha} based on the observations that 1) the antiestrogen, ICI 182,780, completely inhibited E2 stimulation (Fig. 5Go, B and D); and 2) up-regulation was not observed in uninfected UTSMCs treated with 10 nmol/L E2 (data not shown). Cyr61 was not regulated, however, by the PR agonist, R5020, in Ad5/PR-infected UTSMC during a 0.0- to 24.0-h treatment period (data not shown). Therefore, in addition to growth factors, Cyr61 is up-regulated by E2 in an immediate-early fashion in primary cultures of human UTSMCs that express ER{alpha}.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 5. Up-regulation of Cyr61 by E2 in primary cultures of human uterine smooth muscle cells. Representative Northern blot (A and C) of total RNA extracted from primary cultures of human uterine smooth muscle cells (UTSMC) infected with an adenoviral vector containing the full-length human ER{alpha} cDNA and treated with either 10 nmol/L E2 for 0–24 h (A) or cotreated with 100 nmol/L ICI 182,780 (B) as described in Materials and Methods. Increases in Cyr61 mRNA levels were quantified by real-time RT-PCR (C and D) using the Taqman Gold procedure (PE Applied Biosytems) as described in Materials and Methods. For Cyr61, a total of 50 ng total RNA/sample were analyzed in triplicate, and levels were normalized to 18S rRNA. Numerical values are represented as a ratio of Cyr61 to 18S rRNA (mean nanograms ± SEM). All RT-PCR experiments were repeated at least twice. *, P < 0.0001.

 
Dysregulation of Cyr61 by E2 and bFGF in leiomyomas

To further address ovarian sex steroid regulation of Cyr61 in the context of fibroid pathogenesis, freshly obtained leiomyoma and matched myometrial explants (n = 8) were treated ex vivo with 10 nmol/L E2, 10 nmol/L R5020, or a combination of 10 nmol/L E2 and 10 nmol/L R5020. As a positive control, explants were stimulated with 10 ng/mL bFGF, which induces Cyr61 in cell types such as murine and human fibroblasts (10). Quantitative changes in Cyr61 levels after steroid and growth factor treatments were assessed and corroborated by real-time RT-PCR in four of the eight explants. Similar to primary cultured UTSMCs, E2 treatment resulted in a greater than 2-fold increase in Cyr61 transcript levels within 1 h in myometrial tissue, whereas the synthetic PR agonist, R5020, had no effect on Cyr61 expression, nor did it synergize with E2 (Figs. 6AGo and 7Go). The E2-mediated induction of Cyr61 was ER dependent as it was inhibited by the ER antagonist, ICI 182,780 (Figs. 6AGo and 7Go). However, no difference in E2 regulation of Cyr61 was detected in myometrial tissues isolated from the proliferative or secretory phase of cycling patients (data not shown). Cyr61 expression was also significantly enhanced more than 3-fold when myometrial explants were treated with either bFGF (Figs. 6AGo and 7Go) or serum (data not shown) for 1 h. Paradoxically, neither E2 nor bFGF was able to up-regulate Cyr61 in leiomyoma tissues as observed in myometrial controls (Figs. 6DGo and 7Go). The latter observation was not due to the lack of ER{alpha} expression, which was consistently 2-fold higher in leiomyoma explants compared with autologous myometrium (Figs. 6Go, B and E). Therefore, in addition to bFGF and serum, Cyr61 is rapidly induced by E2 in human myometrial tissue, but not in leiomyoma tumors that are ER{alpha} positive. The lack of Cyr61 induction by either sex steroid or growth factor may account in part for the diminished expression observed in leiomyomas.



View larger version (71K):
[in this window]
[in a new window]
 
Figure 6. Dysregulation of Cyr61 by E2 and bFGF ex vivo in leiomyomas. Fresh myometrial (A–C) and leiomyoma (D–F) tissue specimens isolated from eight patients were cultured ex vivo in the presence of ethanol vehicle, 10 nmol/L E2, 10 nmol/L R5020, 10 ng/mL bFGF, a combination of 10 nmol/L E2 and 10 nmol/L R5020, 100 nmol/L ICI 182,780, or a combination of 10 nmol/L E2 and 100 nmol/L ICI 182,780 for 1.0 h at 37 C. After treatment, total RNA was extracted and analyzed by Northern blotting as described in Materials and Methods with a 32P-labeled Cyr61 cDNA (A and D). In addition, membranes were reprobed with a 32P-labeled 1.96-kb ER{alpha} cDNA as described in Materials and Methods (B and E). Membranes were subsequently reprobed with a GAPDH cDNA to account for equivalency in sample loading (C and F). Arrows indicate the 2.4-kb major Cyr61 and the 6.2-kb ER{alpha} transcript.

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 7. Quantitative assessment of Cyr61 expression in tissue specimens treated ex vivo. Human leiomyoma and myometrial tissue samples that were treated ex vivo with steroid hormones and/or growth factors (n = 4) were analyzed further by real-time RT-PCR to make quantitative assessments of increases in Cyr61 RNA levels using the Taqman Gold procedure (PE Applied Biosytems) as described above and in Materials and Methods. Reactions were performed in an ABI Prism Sequence Detection System, and samples were analyzed using Sequence Detection software (PE Applied Biosytems). For Cyr61, a total of 50 ng total RNA/sample were analyzed in triplicate using Cyr61-specific primer pairs (5'-primer, AGTGCTGCGGAGGAGTGGGT; 3'-primer, ACCTCGGAGGCATCGAATC) and a customized Cyr61 probe (ACCAGGACGCCTCCTTGGCA). Total Cyr61 levels were normalized to 18S rRNA, and values are represented as a ratio of Cyr61 to 18S rRNA (mean nanograms ± SEM). All RT-PCR experiments were performed at least twice for a total of four patients. *, P < 0.0001.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leiomyomas are often characterized as a disease of dysregulated differentiation and cell growth of uterine smooth muscle cells. In an attempt to identify gene products that may contribute to leiomyoma development and tumor growth, RADE was employed using leiomyoma and matched myometrial tissues from patients who had undergone hysterectomies. Cyr61 was shown to be down-regulated at both the mRNA and protein levels in leiomyoma specimens compared with normal myometrium. This was further corroborated by in situ hybridization experiments in which decreased expression was localized to smooth muscle cells contained within the leiomyoma tissue, whereas high basal levels of Cyr61 mRNA were observed in the juxtaposed myometrial smooth muscle layers.

The dramatic down-regulation of Cyr61 in leiomyomas may imply a novel role for this protein as a potential regulator of smooth muscle cell differentiation. In addition, it is plausible that the lack of Cyr61 expression may augment growth factor activity and enhance smooth muscle cell proliferation in leiomyomas. The relative homology between the N-terminal domain of CCN proteins and members of the IGF-binding protein (IGFBP) superfamily suggests that it may function to modulate IGF activity. Indeed, Cyr61 has been redesignated IGFBP11 and belongs to a subset of emerging IGFBP-related proteins (22). Given that levels of both IGF-I and IGF-II mRNA and protein are elevated in leiomyomas (23), it is possible that suppression of Cyr61 may increase the bioavailability and activity of IGFs. Cyr61 is also a heparin-binding protein that associates with heparin-binding growth factors such as bFGF and PDGF, both of which regulate Cyr61 expression in cell types such as murine fibroblasts and human endothelial cells (24, 25). The ability of bFGF and PDGF to regulate Cyr61 expression may suggest a potential negative feedback mechanism to sequester heparin-binding growth factors and quench their activity. Conceivably, a decrease in Cyr61 expression may render these heparin-binding growth factors, which have been shown to be up-regulated in leiomyomas (7, 26), more accessible to adjacent cells and thus more effective in stimulating cell proliferation.

Alternatively, elevated expression of Cyr61 appears to be a feature of organs that contain muscular tissue, such as heart and uterus. This feature underscores a potential role for Cyr61 in maintaining a differentiated muscle cell phenotype. Although there is no direct evidence that Cyr61 is involved in muscle development, recent investigations have focused on the role of Cyr61 in mammalian chondrogenesis and hippocampal neuronal cell differentiation. For example, in situ hybridization analysis during mouse embryogenesis displayed increased Cyr61 expression in mesenchymal condensations of both mesodermal and neuroectodermal origins as they differentiate into chrondrocytes (27). Furthermore, recombinant murine Cyr61 added exogenously is capable of both accelerating the differentiation of mesenchymal cells into chondrocytes and enhancing the extent of differentiation (28). In addition, Cyr61 is induced by bFGF in a rapid and transient fashion during differentiation of the immortalized neuronal hippocampal cell line H19–7 (29). Taken together, it appears that Cyr61 plays a novel role in promoting mammalian developmental processes such as chondrogenesis and skeletal and neuronal cell differentiation. Thus, down- regulation of Cyr61 in leiomyomas may result in dedifferentiation of smooth muscle cells and increased sensitization to growth factor-induced cell proliferation.

The role of Cyr61 in mammalian cell development also suggests that aberrant expression may predispose cells toward dysregulated growth, such as in tumorigenesis. Indeed, overexpression of Cyr61 has been observed in several human cell lines derived from human bladder papilloma, colon adenocarcinoma, melanoma, and meduloblastoma (12). In some instances Cyr61 is thought to promote tumorigenesis. For example, transfection of a Cyr61 expression vector into the gastric adenocarcinoma cell line RF-1, which does not express Cyr61, increases these cells’ tumorigenicity (12). Conversely, Cyr61 is shown to be down-regulated in the epithelium of prostate cancer biopsies and in the embryonal-rhabdomyosarcoma cell line, RD, suggesting that it may function as a tumor suppressor as well (14, 30). Interestingly, rCop1, a recently identified member of the CCN family that shares a high degree of homology to Cyr61, has been shown to be a negative regulator of cell transformation when overexpressed and thus behaves similarly to tumor suppressors (31). Therefore, depending on the cell and tumor types, variable expression of Cyr61 may result in either positive or negative selection for dysregulated cell growth.

As ovarian steroids are primary hormones controlling uterine functions, it is conceivable that estrogens and/or progestins regulate the expression of Cyr61. Indeed, preliminary nucleotide analysis of the murine Cyr61 promoter had identified an estrogen response element from -1195 to -1219 and a P4 response element from -1592 to -1617. Moreover, in mature ovariectomized rats Cyr61 is up-regulated greater than 10-fold by E2 in a time-dependent fashion (20). Our initial attempts to test this hypothesis using primary smooth muscle cells derived from leiomyoma and myometrial tissue specimens were unsuccessful because ER and PR were rapidly lost in culture. Other investigators who have attempted to establish a leiomyoma cell line in vitro that retains ER and PR activity (32) have consistently observed the latter. Therefore, both ER and PR were reintroduced into UTSMC by adenoviral vector delivery and subsequently treated with E2 and the progestin R5020, respectively. Interestingly, in adenovirus-infected UTSMCs Cyr61 is rapidly up-regulated in an immediate-early fashion by E2, but not by R5020. Furthermore, myometrial explants treated ex vivo with E2 for 1.0 h also resulted in a 2-fold increase in Cyr61 expression. Quantitative changes in Cyr61 mRNA levels were corroborated by real-time RT-PCR to distinguish fold changes above 2-fold. However, differences in Cyr61 mRNA levels between proliferative and secretory phases were not observed, which may be due to the fact that Cyr61 is an immediate-early gene that is rapidly induced and down-regulated within 0.5–2.0 h. As a result it may be difficult to observe any further increases in Cyr61 levels when estrogen is elevated during the proliferative phase of the menstrual cycle, given this small window of time for up-regulation. In addition, exposure of myometrial explants to bFGF or serum results in up-regulation of Cyr61 mRNA levels ex vivo. Therefore, estrogen, growth factors, and other locally acting factors may up-regulate and maintain the high basal expression of Cyr61 in the human uterine myometrium.

Paradoxically, in leiomyoma explants isolated from patients Cyr61 is not induced by estrogen, bFGF, or serum despite the elevated expression of ER{alpha}, suggesting a possible defect in steroid and/or growth factor regulation. In addition, we did not observe increased Cyr61 expression in leiomyoma explants that were extracted during the proliferative or secretory phase of the menstrual cycle. Given that both bFGF and ER are elevated in leiomyomas (7, 24), the failure to respond to estrogen or bFGF may in part explain the diminished levels of Cyr61 expression observed in leiomyomas. Alternatively, the lack of Cyr61 expression in leiomyomas may be due to allelic loss or alterations of chromosome 1p22-p31 in which the gene is located (20), abrogation of the estrogen or bFGF-signaling pathway, and/or mutations of the estrogen and bFGF response elements contained within the promoter region.

In summary, Cyr61 is dramatically down-regulated at the mRNA and protein levels in human uterine leiomyomas compared with autologous myometrial tissues. Abundant basal levels are present in uterine smooth muscle cells as well as other muscular tissue, such as heart and bladder. In addition to serum growth factors, Cyr61 is an estrogen target gene in the human myometrium. In leiomyomas, however, Cyr61 expression is unresponsive to E2, bFGF, or serum, implying that the lack of Cyr61 synthesis may be due in part due to dysregulation by estrogen and growth factors. The marked down-regulation of Cyr61 in leiomyomas may promote growth by either inhibiting smooth muscle cell differentiation or augmenting the activity of growth factors such as IGFs, HB-EGF, and bFGF. The function of Cyr61 in uterine smooth muscle cell proliferation and differentiation is currently under investigation.


    Acknowledgments
 
We are grateful to the generous contributions of Dr. Ashok Bapat, Sean McClarney, and Daniel Gonder for RADE experiments. Invaluable technical expertise was also kindly provided by Dr. Christopher C. Chadwick, Dr. Paul J. Shugrue, and Malcolm V. Lane.

Received April 8, 2000.

Revised July 11, 2000.

Revised December 14, 2000.

Accepted December 23, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rein MS, Nowak RA. 1992 Biology of uterine myomas and myometrium in vitro. Semin Reprod Endocrinol. 10:310–319.
  2. Cramer DW. 1992 Epidemology of myomas. Semin Reprod Endocrinol. 10:320–324.
  3. Friedman AJ, Lobel SM, Rein MS, Barbieri RI. 1990 Efficacy and safety considerations in women with uterine leiomyomas treated with gonadotropin-releasing hormone agonists: the estrogen threshold hypothesis. Am J Obstet Gynecol. 163:1114–1119.[Medline]
  4. Maheux R. 1989 Treatment of uterine leiomyomata: past, present and future. Horm Res. 32(Suppl 1):125–133.
  5. Brandon DD, Erickson TE, Keenan EJ, et al. 1995 Estrogen receptor gene expression in human uterine leiomyomata. J Clin Endocrinol Metab. 80:1876–1881.[Abstract]
  6. Brandon DD, Bethea CL, Strawn EY, et al. 1993 Progesterone receptor messenger ribonucleic acid and protein are overexpressed in human uterine leiomyomas. Am J Obstet Gynecol. 169:78–85.[Medline]
  7. Andersen J. 1996 Growth factors and cytokines in uterine leiomyomas. Semin Reprod Endocrinol. 14:269–282.[Medline]
  8. Stewart A, Friedman AJ, Peck K, Nowak R. 1994 Relative overexpression of collagen type I and III mRNAs by uterine leiomyomas during the proliferative phase of the menstrual cycle. J Clin Endocrinol Metab. 79:900–906.[Abstract]
  9. Lau LF, Nathans D. 1985 Identification of a set of genes expressed during G0/G1 transition of cultured mouse cells. EMBO J. 4:3145–3151.[Medline]
  10. Lau LF, Nathans D. 1987 Expression of a set of growth-related immediate early genes in BALBc 3T3 cells coordinate regulation with c-fos or c-myc. Proc Natl Acad Sci USA. 84:1182–1186.[Abstract/Free Full Text]
  11. Nathans D, Lau LF, Christy B, Hartzell Y, Ryder K. 1988 The genomic response to growth factors. Cold Spring Harbor Symp Quant Biol. 53:893–900.
  12. Lau LF, Lam SC-T. 1999 The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248:44–57.[CrossRef][Medline]
  13. Babic AM, Kireeva ML, Kolesnikova TV, Lau LF. 1998 Cyr61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad Sci USA. 95:6355–6360.[Abstract/Free Full Text]
  14. Pilarsky CP, Schmidt U, EiBrich C, et al. 1998 Expression of extracellular matrix signaling molecule Cyr61 is downregulated in prostrate cancer. Prostate. 36:85–91.[CrossRef][Medline]
  15. Liang P, Pardee AB. 1997 Methods in molecular biology. Totawa: Humana Press.
  16. Altschul SF, Madden TL, Schaffer AA, et al. 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389–3402.[Abstract/Free Full Text]
  17. Shugrue PJ, Lane MV, Merchenthaler I. 1996 In situ hybridization analysis of the distribution of neurokinin-3 mRNA in the rat central nervous system. J Comp Neurol. 37:395–414.
  18. Bodine PVN, Green J, Harris HA, Bhat RA, Stein GS, Lian JB, Komm BS. 1997 Functional properties of a conditionally phenotypic, estrogen-responsive, human osteoblastic cell line. J Cell Biochem. 65:368–387.[CrossRef][Medline]
  19. Norman GR, Streiner DL. 1994 Biostatistics: the bare essentials. St. Louis: Mosby.
  20. Rivera-Gonzalez R, Petersen DN, Tkalcevic G, Thompson DD, Brown TA. 1998 Estrogen-induced genes in the uterus of ovariectomized rats and their regulation by droloxifiene and tamoxifene. J Steroid Biochem Mol Biol. 64:13–24.[CrossRef][Medline]
  21. Jay P, Berge-Lefranc L, Marsollier C, Mejean S, Taviaux S, Berta P. 1997 The human growth factor-inducible immediate early gene, Cyr61, maps to chromosome 1p. Oncogene. 14:1753–1757.[CrossRef][Medline]
  22. Kim HS, Nagella SR, Oh Y, Wilson E, Roberts CTJ, Rosenfeld RG. 1997 Identification of a family of low-affinity insulin-like growth factor binding proteins (IGFBPs): characterization of connective tissue growth factor as a member of the IGFBP superfamily. Proc Natl Acad Sci USA. 94:12981–12986.[Abstract/Free Full Text]
  23. Vollenhoven BJ, Herington AC, Healy DL. 1993 Messenger ribonucleic acid expression of the insulin-like growth factors and their binding proteins in uterine fibroids and myometrium. J Clin Endocrinol Metab. 76:1106–1110.[Abstract]
  24. Charles CH, Abler AS, Lau LF. 1991 cDNA sequence of a growth factor-inducible immediate early gene and characterization of its encoded protein. Oncogene. 8:23–28.
  25. Kolesnikova TV, Lau LF. 1998 Human Cyr61-mediated enhancement of bFGF-induced DNA synthesis in human umbilical vein endothelial cells. Oncogene. 16:747–754.[CrossRef][Medline]
  26. Mangrulkar RS, Ono M, Ishikawa M, Takashima S, Klagsburn M, Nowak RA. 1995 Isolation and characterization of heparin-binding growth factors in human leiomyomas and normal myometrium. Biol Reprod. 53:636–646.[Abstract]
  27. O’Brien TP, Lau LF. 1992 Expression of the growth factor-inducible immediate early gene Cyr61 correlates with chondrogenesis during mouse embryonic development. Cell Growth Differ. 3:645–654.[Abstract]
  28. Wong M, Kireeva ML, Kolesnikova TV, Lau LF. 1997 Cyr61, product of a growth factor-inducible immediate-early gene, regulates chondrogenesis in mouse limb bud mesenchymal cells. Dev Biol. 192:492–508.[CrossRef][Medline]
  29. Chung C, Kwang and Ahn Young Soo. 1998 Expression of immediate early gene Cyr61 during the differentiation of immortalized embryonic hippocampal neuronal cells. Neuro Lett. 255:155–158.
  30. Genini M, Schwalbe P, Scholl FA, Schafer BW. 1996 Isolation of genes differentially expressed in human primary myoblasts and embryonal rhabdomyosarcoma. Int J Cancer. 66:571–577.[CrossRef][Medline]
  31. Zhang R, Averboukh L, Zhu W, Zhang H, Jo H. 1998 Identification of rCOP-1, a new member of the CCN protein family, as a negative regulator for cellular transformation. Mol Cell Biol. 18:6131–6141.[Abstract/Free Full Text]
  32. Severino MF, Murray MJ, Brandon DD, Clinton GM, Burry KA, Novy MJ. 1996 Rapid loss of oestrogen and progesterone receptors in human leiomyoma and myometrial explant cultures. Mol Hum Reprod. 2:823–898.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. S. Dobroff, H. Wang, V. O. Melnikova, G. J. Villares, M. Zigler, L. Huang, and M. Bar-Eli
Silencing cAMP-response Element-binding Protein (CREB) Identifies CYR61 as a Tumor Suppressor Gene in Melanoma
J. Biol. Chem., September 18, 2009; 284(38): 26194 - 26206.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. N. Nierth-Simpson, M. M. Martin, T.-C. Chiang, L. I. Melnik, L. V. Rhodes, S. E. Muir, M. E. Burow, and J. A. McLachlan
Human Uterine Smooth Muscle and Leiomyoma Cells Differ in Their Rapid 17{beta}-Estradiol Signaling: Implications for Proliferation
Endocrinology, May 1, 2009; 150(5): 2436 - 2445.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
T.-W. Tan, W.-H. Yang, Y.-T. Lin, S.-F. Hsu, T.-M. Li, S.-T. Kao, W.-C. Chen, Y.-C. Fong, and C.-H. Tang
Cyr61 increases migration and MMP-13 expression via {alpha}v{beta}3 integrin, FAK, ERK and AP-1-dependent pathway in human chondrosarcoma cells
Carcinogenesis, February 1, 2009; 30(2): 258 - 268.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
C. R Harlow, A. C Bradshaw, M. T Rae, K. D Shearer, and S. G Hillier
Oestrogen formation and connective tissue growth factor expression in rat granulosa cells
J. Endocrinol., January 1, 2007; 192(1): 41 - 52.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
X. Luo, L. Ding, and N. Chegini
CCNs, fibulin-1C and S100A4 expression in leiomyoma and myometrium: inverse association with TGF-{beta} and regulation by TGF-{beta} in leiomyoma and myometrial smooth muscle cells
Mol. Hum. Reprod., April 1, 2006; 12(4): 245 - 256.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Zaitseva, B. J. Vollenhoven, and P. A.W. Rogers
In vitro culture significantly alters gene expression profiles and reduces differences between myometrial and fibroid smooth muscle cells
Mol. Hum. Reprod., March 1, 2006; 12(3): 187 - 207.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Gery, D. Xie, D. Yin, H. Gabra, C. Miller, H. Wang, D. Scott, W. S. Yi, M. L. Popoviciu, J. W. Said, et al.
Ovarian Carcinomas: CCN Genes Are Aberrantly Expressed and CCN1 Promotes Proliferation of these Cells
Clin. Cancer Res., October 15, 2005; 11(20): 7243 - 7254.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M.-T. Lin, C.-Y. Zuon, C.-C. Chang, S.-T. Chen, C.-P. Chen, B.-R. Lin, M.-Y. Wang, Y.-M. Jeng, K.-J. Chang, P.-H. Lee, et al.
Cyr61 Induces Gastric Cancer Cell Motility/Invasion via Activation of the Integrin/Nuclear Factor-{kappa}B/Cyclooxygenase-2 Signaling Pathway
Clin. Cancer Res., August 15, 2005; 11(16): 5809 - 5820.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
A. A. Arslan, L. I. Gold, K. Mittal, T.-C. Suen, I. Belitskaya-Levy, M.-S. Tang, and P. Toniolo
Gene expression studies provide clues to the pathogenesis of uterine leiomyoma: new evidence and a systematic review
Hum. Reprod., April 1, 2005; 20(4): 852 - 863.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Chien, T. Kumagai, C. W. Miller, J. C. Desmond, J. M. Frank, J. W. Said, and H. P. Koeffler
Cyr61 Suppresses Growth of Human Endometrial Cancer Cells
J. Biol. Chem., December 17, 2004; 279(51): 53087 - 53096.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. Sakamoto, M. Yokoyama, X. Zhang, K. Prakash, K. Nagao, T. Hatanaka, R. H. Getzenberg, and Y. Kakehi
Increased Expression of CYR61, an Extracellular Matrix Signaling Protein, in Human Benign Prostatic Hyperplasia and Its Regulation by Lysophosphatidic Acid
Endocrinology, June 1, 2004; 145(6): 2929 - 2940.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
Y. Absenger, H. Hess-Stumpp, B. Kreft, J. Kratzschmar, B. Haendler, N. Schutze, P.-A. Regidor, and E. Winterhager
Cyr61, a deregulated gene in endometriosis
Mol. Hum. Reprod., June 1, 2004; 10(6): 399 - 407.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
H. R. Mason, A. C. Lake, J. E. Wubben, R. A. Nowak, and J. J. Castellot Jr
The growth arrest-specific gene CCN5 is deficient in human leiomyomas and inhibits the proliferation and motility of cultured human uterine smooth muscle cells
Mol. Hum. Reprod., March 1, 2004; 10(3): 181 - 187.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. R. Mason, D. Grove-Strawser, B. S. Rubin, R. A. Nowak, and J. J. Castellot Jr.
Estrogen Induces CCN5 Expression in the Rat Uterus in Vivo
Endocrinology, February 1, 2004; 145(2): 976 - 982.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
G. Weston, A. C. Trajstman, C. E. Gargett, U. Manuelpillai, B. J. Vollenhoven, and P. A.W. Rogers
Fibroids display an anti-angiogenic gene expression profile when compared with adjacent myometrium
Mol. Hum. Reprod., September 1, 2003; 9(9): 541 - 549.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. L. Soon, T.-A. Yie, A. Shvarts, A. J. Levine, F. Su, and K.-M. Tchou-Wong
Overexpression of WISP-1 Down-regulated Motility and Invasion of Lung Cancer Cells through Inhibition of Rac Activation
J. Biol. Chem., March 21, 2003; 278(13): 11465 - 11470.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Tong, D. Xie, J. O'Kelly, C. W. Miller, C. Muller-Tidow, and H. P. Koeffler
Cyr61, a Member of CCN Family, Is a Tumor Suppressor in Non-Small Cell Lung Cancer
J. Biol. Chem., December 7, 2001; 276(50): 47709 - 47714.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. Sampath, R. C. Winneker, and Z. Zhang
Cyr61, a Member of the CCN Family, Is Required for MCF-7 Cell Proliferation: Regulation by 17{beta}-Estradiol and Overexpression in Human Breast Cancer
Endocrinology, June 1, 2001; 142(6): 2540 - 2548.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sampath, D.
Right arrow Articles by Zhang, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sampath, D.
Right arrow Articles by Zhang, Z.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
Medline Plus Health Information
*Uterine Cancer
*Uterine Fibroids


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals