| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Division of Endocrinology and Metabolism, Departments of Medicine, Psychiatry (D.A.G.), and Biomathematics (D.A.G.), Mount Sinai School of Medicine, New York, New York 10029
Address all correspondence and requests for reprints to: Yaron Tomer, M.D., Division of Endocrinology and Metabolism, Box 1055, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, New York 10029. E-mail: yaron.tomer{at}mssm.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
= 0.41). As the linked
region contained the CTLA-4 and CD28 genes, we then tested whether they
were the susceptibility genes for TAbs on chromosome 2q33. The CD28
gene was sequenced in 15 individuals, and a new C/T single nucleotide
polymorphism (SNP) was identified in intron 3. Analysis of this SNP
revealed no association with TAbs in the probands of the linked
families (families that were linked with D2S155) compared with
controls. The CTLA-4 gene was analyzed using the known
A/G49 SNP, and the results showed a significantly increased
frequency of the G allele in the probands of the linked families
compared with the probands of the unlinked families or with controls
(P = 0.02). We concluded that 1) a major gene for
thyroid autoantibody production was located on chromosome 2q33; 2) the
TAb gene on chromosome 2q33 was most likely the CTLA-4 gene and not the
CD28 gene; and 3) CTLA-4 contributed to the genetic susceptibility to
TAb production, but there was no evidence that it contributed
specifically to Graves’ or Hashimoto’s diseases. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The AITDs most likely develop as a consequence of a complex interaction
between genetic susceptibility and environmental effects.
Epidemiological evidence for a genetic predisposition to the AITDs is
abundant: 1) the AITDs cluster in families (5), and the
sibling risk ratio (
s) has been estimated to
be more than 10 (6); 2) a higher concordance rate has been
reported for monozygotic twins compared with dizygotic twins
(7, 8, 9); and 3) AITDs are 5–10 times more common in
females than in males (5). Moreover, an increased
prevalence of TAbs has been reported in first degree relatives of
patients with AITDs (10, 11, 12), suggesting a genetic
predisposition. Indeed, segregation analyses in families with thyroid
antibodies have shown vertical transmission of TAbs, which was
consistent with either a Mendelian dominant pattern of inheritance
(13, 14) or complex inheritance (15).
Although there is strong evidence for genetic predisposition for TAb production, the susceptibility genes for TAbs are not known. The aim of the present study was to map the susceptibility genes for TAb production by a whole genome linkage study. We now report the identification of a major susceptibility locus for thyroid autoantibodies on chromosome 2q33, giving a maximum logarithm of odds (LOD) score of 4.2. Detailed analysis of this locus showed evidence that the TAb gene in this region was most likely the CTLA-4 gene and not CD28.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Fifty-six families (323 individuals) were analyzed in the current study (28 from the U.S., 9 from Italy, 10 from Israel, and 9 from the United Kingdom). All families enrolled in the study were multiplex for AITD and TAb (>1 affected) and multigenerational. On the average, our families had 6.2 members.
Clinical assessment
For this study all patients with GD, HT, or thyroid autoantibodies alone were considered affected. GD was diagnosed by 1) documented clinical and biochemical hyperthyroidism requiring treatment, 2) a diffuse goiter, 3) the presence of TSH receptor antibodies, and/or 4) diffusely increased 131I uptake in the thyroid gland. HT was diagnosed by documented clinical and biochemical hypothyroidism requiring thyroid hormone replacement and the presence of autoantibodies to TPO, with or without antibodies to thyroglobulin (Tg). Antithyroglobulin and anti-TPO antibodies were measured by specific RIA (Kronus, Boise, ID). Family members were defined as unaffected if they had no evidence of clinical AITD, and they were negative for TAbs. Individuals for whom thyroid antibody levels were not available (n = 40) were considered unknown in the linkage analysis. For all subjects, phenotype was determined with the clinician blinded to the individual’s genotype. Each participant was interviewed and examined and gave written informed consent before participating in the study. All pertinent clinical and laboratory data were recorded and stored in our database. At the time of the interview, blood was collected for DNA purification and thyroid function and thyroid antibody testing.
PCR amplification of microsatellite markers
DNA was extracted from whole blood as previously described (16). For the whole genome screening we used the Perkin-Elmer microsatellite panels (Foster City, CA; version 1.0, panels 1–4, 20, and 25–28; version 2.0, panels 5–19 and 21–24; a total of 387 markers). In addition, oligonucleotides for amplification of the microsatellites used for fine mapping were designed according to published sequences in the Genome Database (http://gdbwww.gdb.org/). Microsatellite markers were selected from the Genethon linkage maps (17) and were analyzed according to the method of Weber (18). Fluorescence-labeled primers were purchased from PE Applied Biosystems (Foster City, CA). PCR were performed in 15-µL reaction volumes containing 50 ng genomic DNA; 5 pmol of each primer (one of which was fluorescence labeled); PCR buffer containing 50 mmol/L KCl; 10 mmol/L Tris-HCl (pH 8.3); 1.5 mmol/L MgCl2; 200 µmol/L of each deoxy (d)-ATP, dGTP, dTTP, and dCTP; and 1 U of AmpliTaq DNA polymerase (PE Applied Biosystems, Foster City, CA). Reaction mixtures were heated to 94 C for 7 min, then cycled 30 times as follows: 30 s at 94 C, 30 s at 55 C, and 30 s at 72 C. The PCR products were diluted 1:20 in ddH2O and pooled. Two microliters of the pooled products were mixed with 0.5 µL of the internal size standard and 10 µL deionized formamide, denatured, and separated using an ABI 310 genetic analyzer (PE Applied Biosystems). Allele calling was performed using Genotyper 2.0 software (PE Applied Biosystems). The marker data were then automatically exported to our database (Ingres database), where they were integrated with the already existing phenotype information and prepared for linkage analysis.
Evaluation of the CTLA-4 gene
We analyzed the CTLA-4 gene using the A/G single nucleotide polymorphism (SNP) at position 49 in exon 1 (A/G49). This was performed using an automated fluorescence-based restriction fragment length polymorphism (RFLP) analysis as previously described (19). DNA was amplified using the following primers: forward primer, GCTCTACTTCCTGAAGACCT; and reverse primer, AGTCTCACTCACCTTTGCAG. The forward primer was fluorescence labeled. PCRs were performed in a 20-µL reaction mixture containing 50 ng total DNA, as described above for microsatellite analysis. Fluorescence-labeled PCR products were incubated at 37 C with the restriction enzyme BbvI for 2 h. The digested PCR product was diluted 1:25 in ddH20, denatured, and separated on an ABI-310 genetic analyzer (PE Applied Biosystems). The two alleles were easily separated using this method: the A allele, which resulted in an undigested PCR product of 162 bp, and the G allele, which resulted in a digested PCR product with two fragments of 90 and 72 bp; as the 90-bp fragment contained the fluorescence-labeled forward primer, it was visualized on the ABI-310, whereas the 72-bp fragment was not. Allele typing was performed using Genotyper 2.0 software.
Sequencing the CD28 gene
The CD28 gene has four exons (20). The primers used
for amplifying the CD28 exons are shown in Table 1
. All primers were intronic at an
average distance of 30–50 bases from the 3'- or 5'-end of the exons.
Genomic DNA was amplified using these primers as described above for
the CTLA-4 RFLP analysis. The PCR product was purified using the
QIAquick gel extraction kit (QIAGEN, Valencia, CA). It was
then sequenced using the Perkin-Elmer DNA sequencing kit
(PE Applied Biosystems), and separated on an ABI-310
automated sequencer (PE Applied Biosystems).
|
The sequence analysis of the CD28 gene revealed a new SNP in
intron 3 (see Results). The SNP identified in intron 3 of
the CD28 gene was analyzed by the same modified RFLP method used for
analyzing the CTLA-4 A/G49 SNP. For the SNP
analysis exon 3 was amplified using the primers shown in Table 1
. The
forward primer was fluorescence labeled, and the labeled amplified PCR
product was digested using the restriction enzyme AciI. The
two alleles were easily separated using this method: the T allele
resulted in a fluorescence-labeled undigested PCR product of 280 bp,
and the C allele resulted in a digested PCR product with two fragments:
a fluorescence-labeled 208-bp fragment and a nonlabeled 72-bp
fragment.
Two-point linkage analyses
Two-point LOD scores for the different markers studied were computed using LIPED software (21), assuming both dominant and recessive models (22). For each model three levels of penetrance were tested (30%, 50%, and 80%). According to recently published guidelines (23) we used a LOD score of 1.9 or greater in our whole genome screen as evidence of linkage and a LOD score greater than 3.3 as significant evidence of linkage.
Multipoint linkage analysis
Multipoint LOD scores were computed by the Genehunter program (24) using all markers on each chromosome. Multipoint linkage analysis yields the maximum information for each family for the area of interest. Using Genehunter, we set the inheritance parameters identical to those that gave the maximum LOD scores in the two-point analyses. Marker placement and distances for the multipoint analysis were obtained from the Genethon maps (17).
Heterogeneity testing
As heterogeneity was possible among our families, we allowed for the possibility that TAbs were linked in only a subset of the families. Heterogeneity testing was performed using the Genehunter algorithm for heterogeneity (heterogeneity LOD score).
Association analyses
These were performed using the 
2 and
Fisher exact tests. P < 0.05 was considered
significant.
Power calculations
Simulation studies were performed to assess the power of our 56
families to detect linkage and to assess the maximum attainable LOD
scores using our dataset. The simulations demonstrated that using a
dataset of 56 families gave statistical power to reject linkage out to
10 centimorgans (cM; 
= 0.1), even at a penetrance as low as
0.3 (25). Our families were, therefore, sufficient to
reject linkage for the tested markers. Simulations also showed that we
had the power to detect linkage using the 56 families. The theoretical
maximum attainable LOD score in our dataset was 6.7, assuming the
recessive model and a = 0.01 (25).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Table 2 shows the clinical
characteristics of the 56 families studied. Fourteen families (25%)
had only GD-affected members, 22 families (39%) had only HT-affected
members, and 20 families (36%) were mixed with both GD- and
HT-affected first degree relatives. There were 185 family members who
did not have GD or HT at the time of the study. Thyroid antibodies were
measured in 145 (78%) of these unaffected family members, and 50 of
them (34%) had thyroid antibodies, similar to the incidence reported
in previous studies (26, 27). The female to male ratio was
7.1:1 for the AITD patients and 1:1 for the thyroid antibody-positive
family members who did not have clinical disease, indicating that many
males with TAbs did not develop disease.
|
A total of 387 microsatellite markers spanning the whole human
genome were analyzed. For mapping the thyroid antibody susceptibility
genes TAb-positive individuals with or without GD/HT were considered
affected. Whole genome screening revealed only one locus with a LOD
score above 3.0 on chromosome 2q33 (Fig. 1A). The maximum 2-point LOD score was
3.61 [strong evidence for linkage (23)] at marker D2S325
(210.9 cM), obtained for the dominant model, at a penetrance of 80%
and a recombination fraction () of 0.2. Moreover, the LOD scores of
other markers in the local region of D2S325 were positive in a
geographically logical sequence (Fig. 1B). The fact that the maximum
LOD score occurred assuming dominant inheritance was consistent with
earlier segregation analysis data (14). However, this
locus showed no evidence for linkage to GD or HT [2-point LOD
scores = 0.42 for GD and -0.60 for HT] (data not shown)
(25), demonstrating that the gene in this region conferred
susceptibility to TAbs, but clinical disease development required
additional genes and/or environmental factors. Separate linkage
analysis of TPO and Tg yielded lower positive LOD scores (MLS,
0.83 for TPO and 0.3 for Tg). Thus, there was no indication that one of
these antibodies had a stronger influence on the genetic susceptibility
to TAb production.
|
= 0.2), which could indicate that genetic heterogeneity
existed in our dataset (28). Genetic heterogeneity exists
when only a subset of the families is linked with the tested locus, and
this appeared to be the case in our dataset. Multipoint heterogeneity
testing showed heterogeneity in our dataset giving an of 0.39
(i.e. 
30–40% of the families in our dataset were linked
with the region on chromosome 2q33). Fine mapping of the TAb susceptibility locus
To fine map the TAb susceptibility locus we performed a multipoint
analysis using densely spaced markers at 2q33. We generated a genetic
map for the 2q33 region using 11 markers, with sex-averaged distances
between markers (in centimorgans) as follows:
D2S316–0.2-D2S348–1.2-D2S374–1.4-D2S309–0.8-D2S307–0.2-CTLA-4(A/G)-0.4-D2S346–3.6-D2S369–0.4-D2S155–0.3-D2S154–1.0-D2S325.
This order and distances in centimorgans were obtained
from the Genethon maps (17) and were confirmed in our
dataset. Multipoint linkage analysis localized the TAb susceptibility
locus on chromosome 2q33 to within an approximate interval of 4 cM
between markers D2S346 and D2S325. The heterogeneity multipoint LOD
scores throughout this interval were greater than 3.0, with a maximum
heterogeneity multipoint LOD score of 4.2 obtained near marker D2S155
( = 0.42; Table 3). This
represented significant evidence for linkage (23, 29).
|
The chromosome 2q33 region contains at least three important immune regulatory genes, CTLA-4, CD28, and inducible costimulator (ICOS). We, therefore, tested the CTLA-4 and CD28 genes, but we were unable to examine ICOS because the intron/exon sequences of the ICOS gene were not available in the public databases at the time of writing.
Analysis of the CD28 gene
Sequencing of the CD28 gene in 15 normal individuals
revealed a new C/T SNP in intron 3 at position 17 after the 3'-end of
the exon (C/T-I3 + 17 SNP). To test whether the TAb susceptibility gene
on chromosome 2q33 could be the CD28 gene, we performed family-based
association studies with the CD28 C/T-I3 + 17 SNP. For this analysis we
divided our families into 2 groups based on the method suggested by Ott
(30): 1) families linked with TAb-1 (families with
multipoint LOD score at marker D2S155 >0.1), and 2) families not
linked with TAb-1 (families with multipoint LOD score at D2S155 
0).
We then compared the frequency of the C allele in the probands of the
linked families, the probands of the unlinked families, and the
controls. The analysis showed that the C allele was present in 21.4%
of the controls and the T allele was present in 78.6% of the controls.
An almost identical frequency of the C and T alleles was found in the
probands of the unlinked families (25% and 75%, respectively) and the
probands of the linked families (26.6% and 73.4%, respectively;
P = 0.66). Thus, there was no association between the
CD28 gene SNP and TAbs in our families.
Analysis of the CTLA-4 gene
We used the same analysis to test whether the TAb susceptibility
gene on chromosome 2q33 could be the CTLA-4 gene. The results showed
that 34% of the controls had the G allele and 66% had the A allele
(Table 4), similar to the frequencies
reported in previous studies in Caucasians (31, 32).
An almost identical frequency of G and A alleles was found in the
probands of the unlinked families (36.5% and 63.5%, respectively;
Table 4). However, in the probands of the linked families we found a
frequency of 53% for the G allele and 47% for the A allele
(P = 0.02; Table 4). When analyzing the genotypes of
the probands and the controls, the frequencies of the GG, AG, and AA
genotypes were, respectively, 13%, 43%, and 44% for the controls,
and 13%, 46%, and 41%, respectively, for the probands in the
unlinked families (Table 4). In contrast, the frequencies of the GG,
AG, and AA genotypes in the probands of the linked families were 21%,
63%, and 16%, respectively (P = 0.06; Table 4).
Moreover, in almost all the linked families the probands had the G
allele, and only in 3 of 19 (16%) linked families did the probands
have the AA genotype, compared with 53 of 119 (44%) of the
controls.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Genetic susceptibility to the production of thyroid antibodies was first suggested by Hall et al. (36). Their studies of first degree relatives of probands with AITDs indicated proportions of affected relatives similar to the theoretical expectation for dominant inheritance. More recent family studies have shown that up to 50% of the siblings of AITD patients were TAb positive (5, 11, 26), in contrast to a TAb population prevalence of 7–15% (37). These findings were true in different ethnic groups such as the Japanese (27) and British populations (36). The genetic susceptibility to the production of thyroid antibodies was further supported by several segregation analyses in families with thyroid antibodies that suggested a Mendelian dominant pattern of inheritance (13, 14, 15). Recently, Jaume et al. (38) found evidence for the genetic transmission of TPO antibody fingerprints, suggesting that autoantibody recognition of the TPO antigen was genetically transmitted.
The penetrance of the TAb locus in our dataset was high (80%). This
was in contrast to the low penetrance (30%) of the Graves’ disease
loci that we reported previously (25). The high penetrance
of the TAb locus was expected in view of the much higher prevalence of
thyroid antibodies within families compared with the prevalence of
clinical disease (5). Moreover, thyroid antibodies have
been shown to precede clinical disease by many years (37).
Thus, the age of onset of TAbs is expected to be much lower than the
age of onset of clinical disease.
The chromosomal region giving the high LOD scores contained three important immune regulatory genes: the CTLA-4, CD28, and ICOS genes. Our data excluded CD28 and showed that CTLA-4 may be the susceptibility gene for thyroid antibody production in the subgroup of approximately 34% of the families in our dataset linked to this region. ICOS was not analyzed because its genomic sequence was not available in the public databases. Therefore, we could not exclude ICOS as the susceptibility gene for TAbs in this region.
CTLA-4 is an important costimulatory molecule necessary for T cell
activation. Recently, there have been several reports demonstrating an
association of the CTLA-4 gene with AITDs (31, 39, 40) and other autoimmune diseases (41, 42). Two
CTLA-4 polymorphisms, a microsatellite marker located at the
3'-noncoding region of the CTLA-4 gene and a SNP at the leader peptide
of the CTLA-4 gene, were found to be associated with Graves’ disease,
giving a low relative risk of about 2.0 (31, 39, 40), and
a similar low association has been reported for HT (40, 42, 43, 44). Pearce et al. (45) reported
linkage to the CTLA-4 gene region in families with AITD. Recently, the
same group claimed that the association of the CTLA-4 gene to Graves’
ophthalmopathy was much stronger than that to GD alone
(46). We have not been able to confirm these data. Also in
our dataset we did not find a stronger association of the CTLA-4 SNP G
allele to Graves’ ophthalmopathy compared with GD without
ophthalmopathy (19). Moreover, in our dataset GD itself
showed little evidence of linkage to the CTLA-4 gene region. That we
did find strong linkage of the CTLA-4 gene region to thyroid antibodies
suggested that a gene in this region conferred susceptibility to TAb
production. Therefore, the production of clinical disease (GD or HT)
must require the participation of other disease-specific genes
(25) and environmental triggers (47). When we
tested whether CD28 or CTLA-4 could be the actual genes in this region
responsible for thyroid antibodies, the CD28 gene did not show an
association with TAbs or AITD, but the CTLA-4 gene showed a clear
association with TAbs. The families that showed positive evidence of
linkage had significantly more probands with the G allele compared with
the unlinked families and controls, suggesting that the linkage was due
to transmission of the G allele of the A/G49 SNP.
Indeed, the analysis showed that almost all of the linked families had
probands with the G allele, while in the probands from the unlinked
families and controls there was a significantly lower frequency of G
(P = 0.02; Table 4). These results suggested that the G
allele of the CTLA-4 A/G49 SNP predisposed
individuals to develop thyroid antibodies. Our results were in accord
with previous studies showing an association of AITD with the CTLA-4
gene (31, 39, 40), as the AITD patients examined, by
definition, must have been positive for TAbs. Therefore, our results
extended these observations to show that the CTLA-4 gene may confer
susceptibility to the production of TAbs. As some of the TAb-positive
individuals would eventually develop AITD, the disease also showed an
association with the CTLA-4 gene, as previously observed. Functional
studies on the influence of the CTLA-4 A/G49 SNP
on T cell function are needed to analyze how this polymorphism may have
conferred susceptibility to the development of TAbs (48).
Alternatively, the CTLA-4 gene A/G49 SNP may be
in strong linkage disequilibrium with a nearby gene that confers
susceptibility to TAb production. In this regard it is important to
note that the ICOS gene has not yet been tested and, therefore, is not
excluded as the TAb susceptibility gene on chromosome 2q33.
In conclusion, we found strong evidence for a susceptibility gene for thyroid antibodies on chromosome 2q33. This gene was mapped to within 4 cM of the CTLA-4 gene, and our family-based association studies provided strong evidence that the CTLA-4 gene was the TAb susceptibility gene in this region. We concluded that the G allele of the CTLA-4 A/G49 SNP predisposed individuals to the production of thyroid autoantibodies in at least 34% of families with AITDs.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received August 30, 2000.
Revised December 8, 2000.
Accepted December 22, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  A. Huber, F. Menconi, S. Corathers, E. M. Jacobson, and Y. Tomer Joint Genetic Susceptibility to Type 1 Diabetes and Autoimmune Thyroiditis: from Epidemiology to Mechanisms Endocr. Rev., October 1, 2008; 29(6): 697 - 725. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ban, D. A. Greenberg, T. F. Davies, E. Jacobson, E. Concepcion, and Y. Tomer 'Linkage Analysis of Thyroid Antibody Production: Evidence for Shared Susceptibility to Clinical Autoimmune Thyroid Disease J. Clin. Endocrinol. Metab., September 1, 2008; 93(9): 3589 - 3596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-Y. Hsiao, M.-C. Hsieh, K.-J. Tien, S.-C. Hsu, S.-J. Shin, and S.-R. Lin Association between a C/T Polymorphism in Exon 33 of the Thyroglobulin Gene Is Associated with Relapse of Graves' Hyperthyroidism after Antithyroid Withdrawal in Taiwanese J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3197 - 3201. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S Hansen, T. H Brix, I. Iachine, K. O Kyvik, and L. Hegedus The relative importance of genetic and environmental effects for the early stages of thyroid autoimmunity: a study of healthy Danish twins Eur. J. Endocrinol., January 1, 2006; 154(1): 29 - 38. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Golden, L. Levin, Y. Ban, E. Concepcion, D. A. Greenberg, and Y. Tomer Genetic Analysis of Families with Autoimmune Diabetes and Thyroiditis: Evidence for Common and Unique Genes J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4904 - 4911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Ban, E. S. Concepcion, R. Villanueva, D. A. Greenberg, T. F. Davies, and Y. Tomer Analysis of Immune Regulatory Genes in Familial and Sporadic Graves' Disease J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4562 - 4568. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P.-W. Wang, R.-T. Liu, S.-H. H. Juo, S.-T. Wang, Y.-H. Hu, C.-J. Hsieh, M.-H. Chen, I-Y. Chen, and C.-L. Wu Cytotoxic T Lymphocyte-Associated Molecule-4 Polymorphism and Relapse of Graves' Hyperthyroidism after Antithyroid Withdrawal J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 169 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Ban, D. A. Greenberg, E. Concepcion, L. Skrabanek, R. Villanueva, and Y. Tomer Amino acid substitutions in the thyroglobulin gene are associated with susceptibility to human and murine autoimmune thyroid disease PNAS, December 9, 2003; 100(25): 15119 - 15124. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Tomer and T. F. Davies Searching for the Autoimmune Thyroid Disease Susceptibility Genes: From Gene Mapping to Gene Function Endocr. Rev., October 1, 2003; 24(5): 694 - 717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Collins, J. M. Heward, J. Carr-Smith, J. Daykin, J. A. Franklyn, and S. C. L. Gough Association of a Rare Thyroglobulin Gene Microsatellite Variant with Autoimmune Thyroid Disease J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 5039 - 5042. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Dittmar and G. J. Kahaly Polyglandular Autoimmune Syndromes: Immunogenetics and Long-Term Follow-Up J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2983 - 2992. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. H. Kacem, A. Rebai, N. Kaffel, S. Masmoudi, M. Abid, and H. Ayadi PDS Is a New Susceptibility Gene to Autoimmune Thyroid Diseases: Association and Linkage Study J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 2274 - 2280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Vaidya, P. Kendall-Taylor, and S. H. S. Pearce The Genetics of Autoimmune Thyroid Disease J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5385 - 5397. [Full Text] [PDF]
|
|
|
|
 |
|
 S. Anjos, A. Nguyen, H. Ounissi-Benkalha, M.-C. Tessier, and C. Polychronakos A Common Autoimmunity Predisposing Signal Peptide Variant of the Cytotoxic T-lymphocyte Antigen 4 Results in Inefficient Glycosylation of the Susceptibility Allele J. Biol. Chem., November 22, 2002; 277(48): 46478 - 46486. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
