help button home button Endocrine Society JCEM JCEM Call for Nominations for EIC
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomer, Y.
Right arrow Articles by Davies, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomer, Y.
Right arrow Articles by Davies, T. F.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 4 1687-1693
Copyright © 2001 by The Endocrine Society


Original Studies

CTLA-4 and Not CD28 Is a Susceptibility Gene for Thyroid Autoantibody Production1

Yaron Tomer, David A. Greenberg, Giuseppe Barbesino, Erlinda Concepcion and Terry F. Davies

Division of Endocrinology and Metabolism, Departments of Medicine, Psychiatry (D.A.G.), and Biomathematics (D.A.G.), Mount Sinai School of Medicine, New York, New York 10029

Address all correspondence and requests for reprints to: Yaron Tomer, M.D., Division of Endocrinology and Metabolism, Box 1055, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, New York 10029. E-mail: yaron.tomer{at}mssm.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
One of the hallmarks of the human autoimmune thyroid diseases (AITDs) is the production of high titers of autoantibodies against thyroglobulin and thyroid peroxidase that often precedes the development of clinical disease. A high percentage of family members of patients with AITDs have significant titers of thyroid antibodies (TAbs), suggesting a genetic predisposition for their development, and segregation analyses have favored a dominant mode of inheritance. The aim of the present study was to identify the susceptibility genes for TAb production. We completed a genome-wide scan in 56 multiplex families (323 individuals) in which all family members with AITDs and/or detectable TAbs were considered affected. The highest 2-point logarithm of odds (LOD) score of 3.6 was obtained for marker D2S325 on chromosome 2q33 at 210.9 centimorgans. This locus showed no evidence for linkage to Graves’ disease or Hashimoto’s thyroiditis (2-point LOD scores, 0.42 for Graves’ disease and -0.60 for Hashimoto’s thyroiditis), demonstrating that the gene in this region conferred susceptibility to TAbs, but that clinical disease development required additional genetic and/or environmental factors. We then fine-mapped the region linked with TAbs using 11 densely spaced microsatellite markers. Multipoint linkage analysis using these markers showed a maximum LOD score of 4.2 obtained for marker D2S155 at 209.8 centimorgans (with heterogeneity, {alpha} = 0.41). As the linked region contained the CTLA-4 and CD28 genes, we then tested whether they were the susceptibility genes for TAbs on chromosome 2q33. The CD28 gene was sequenced in 15 individuals, and a new C/T single nucleotide polymorphism (SNP) was identified in intron 3. Analysis of this SNP revealed no association with TAbs in the probands of the linked families (families that were linked with D2S155) compared with controls. The CTLA-4 gene was analyzed using the known A/G49 SNP, and the results showed a significantly increased frequency of the G allele in the probands of the linked families compared with the probands of the unlinked families or with controls (P = 0.02). We concluded that 1) a major gene for thyroid autoantibody production was located on chromosome 2q33; 2) the TAb gene on chromosome 2q33 was most likely the CTLA-4 gene and not the CD28 gene; and 3) CTLA-4 contributed to the genetic susceptibility to TAb production, but there was no evidence that it contributed specifically to Graves’ or Hashimoto’s diseases.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE AUTOIMMUNE THYROID diseases (AITDs), including Graves’ disease (GD) and Hashimoto’s thyroiditis (HT), are among the most common human autoimmune diseases, with a population prevalence of 1–2% (1). In GD the autoimmune process results in the production of thyroid-stimulating antibodies and leads to hyperthyroidism, whereas in HT the end result is thyroid cell death and hypothyroidism (reviewed in Refs. 2 and 3). One of the hallmarks of the autoimmune thyroid diseases is the easily detectable production of autoantibodies to thyroglobulin (Tg) and thyroid peroxidase (TPO; the microsomal antigen). The production of thyroid antibodies (TAbs) often precedes the development of clinical AITD, and TAbs have been widely used to show the population most at risk for the development of AITD. For example, in females who were positive for TAbs and who had an abnormal TSH, the annual risk of developing hypothyroidism was 2–4% (4).

The AITDs most likely develop as a consequence of a complex interaction between genetic susceptibility and environmental effects. Epidemiological evidence for a genetic predisposition to the AITDs is abundant: 1) the AITDs cluster in families (5), and the sibling risk ratio ({lambda}s) has been estimated to be more than 10 (6); 2) a higher concordance rate has been reported for monozygotic twins compared with dizygotic twins (7, 8, 9); and 3) AITDs are 5–10 times more common in females than in males (5). Moreover, an increased prevalence of TAbs has been reported in first degree relatives of patients with AITDs (10, 11, 12), suggesting a genetic predisposition. Indeed, segregation analyses in families with thyroid antibodies have shown vertical transmission of TAbs, which was consistent with either a Mendelian dominant pattern of inheritance (13, 14) or complex inheritance (15).

Although there is strong evidence for genetic predisposition for TAb production, the susceptibility genes for TAbs are not known. The aim of the present study was to map the susceptibility genes for TAb production by a whole genome linkage study. We now report the identification of a major susceptibility locus for thyroid autoantibodies on chromosome 2q33, giving a maximum logarithm of odds (LOD) score of 4.2. Detailed analysis of this locus showed evidence that the TAb gene in this region was most likely the CTLA-4 gene and not CD28.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ascertainment of the study families

Fifty-six families (323 individuals) were analyzed in the current study (28 from the U.S., 9 from Italy, 10 from Israel, and 9 from the United Kingdom). All families enrolled in the study were multiplex for AITD and TAb (>1 affected) and multigenerational. On the average, our families had 6.2 members.

Clinical assessment

For this study all patients with GD, HT, or thyroid autoantibodies alone were considered affected. GD was diagnosed by 1) documented clinical and biochemical hyperthyroidism requiring treatment, 2) a diffuse goiter, 3) the presence of TSH receptor antibodies, and/or 4) diffusely increased 131I uptake in the thyroid gland. HT was diagnosed by documented clinical and biochemical hypothyroidism requiring thyroid hormone replacement and the presence of autoantibodies to TPO, with or without antibodies to thyroglobulin (Tg). Antithyroglobulin and anti-TPO antibodies were measured by specific RIA (Kronus, Boise, ID). Family members were defined as unaffected if they had no evidence of clinical AITD, and they were negative for TAbs. Individuals for whom thyroid antibody levels were not available (n = 40) were considered unknown in the linkage analysis. For all subjects, phenotype was determined with the clinician blinded to the individual’s genotype. Each participant was interviewed and examined and gave written informed consent before participating in the study. All pertinent clinical and laboratory data were recorded and stored in our database. At the time of the interview, blood was collected for DNA purification and thyroid function and thyroid antibody testing.

PCR amplification of microsatellite markers

DNA was extracted from whole blood as previously described (16). For the whole genome screening we used the Perkin-Elmer microsatellite panels (Foster City, CA; version 1.0, panels 1–4, 20, and 25–28; version 2.0, panels 5–19 and 21–24; a total of 387 markers). In addition, oligonucleotides for amplification of the microsatellites used for fine mapping were designed according to published sequences in the Genome Database (http://gdbwww.gdb.org/). Microsatellite markers were selected from the Genethon linkage maps (17) and were analyzed according to the method of Weber (18). Fluorescence-labeled primers were purchased from PE Applied Biosystems (Foster City, CA). PCR were performed in 15-µL reaction volumes containing 50 ng genomic DNA; 5 pmol of each primer (one of which was fluorescence labeled); PCR buffer containing 50 mmol/L KCl; 10 mmol/L Tris-HCl (pH 8.3); 1.5 mmol/L MgCl2; 200 µmol/L of each deoxy (d)-ATP, dGTP, dTTP, and dCTP; and 1 U of AmpliTaq DNA polymerase (PE Applied Biosystems, Foster City, CA). Reaction mixtures were heated to 94 C for 7 min, then cycled 30 times as follows: 30 s at 94 C, 30 s at 55 C, and 30 s at 72 C. The PCR products were diluted 1:20 in ddH2O and pooled. Two microliters of the pooled products were mixed with 0.5 µL of the internal size standard and 10 µL deionized formamide, denatured, and separated using an ABI 310 genetic analyzer (PE Applied Biosystems). Allele calling was performed using Genotyper 2.0 software (PE Applied Biosystems). The marker data were then automatically exported to our database (Ingres database), where they were integrated with the already existing phenotype information and prepared for linkage analysis.

Evaluation of the CTLA-4 gene

We analyzed the CTLA-4 gene using the A/G single nucleotide polymorphism (SNP) at position 49 in exon 1 (A/G49). This was performed using an automated fluorescence-based restriction fragment length polymorphism (RFLP) analysis as previously described (19). DNA was amplified using the following primers: forward primer, GCTCTACTTCCTGAAGACCT; and reverse primer, AGTCTCACTCACCTTTGCAG. The forward primer was fluorescence labeled. PCRs were performed in a 20-µL reaction mixture containing 50 ng total DNA, as described above for microsatellite analysis. Fluorescence-labeled PCR products were incubated at 37 C with the restriction enzyme BbvI for 2 h. The digested PCR product was diluted 1:25 in ddH20, denatured, and separated on an ABI-310 genetic analyzer (PE Applied Biosystems). The two alleles were easily separated using this method: the A allele, which resulted in an undigested PCR product of 162 bp, and the G allele, which resulted in a digested PCR product with two fragments of 90 and 72 bp; as the 90-bp fragment contained the fluorescence-labeled forward primer, it was visualized on the ABI-310, whereas the 72-bp fragment was not. Allele typing was performed using Genotyper 2.0 software.

Sequencing the CD28 gene

The CD28 gene has four exons (20). The primers used for amplifying the CD28 exons are shown in Table 1Go. All primers were intronic at an average distance of 30–50 bases from the 3'- or 5'-end of the exons. Genomic DNA was amplified using these primers as described above for the CTLA-4 RFLP analysis. The PCR product was purified using the QIAquick gel extraction kit (QIAGEN, Valencia, CA). It was then sequenced using the Perkin-Elmer DNA sequencing kit (PE Applied Biosystems), and separated on an ABI-310 automated sequencer (PE Applied Biosystems).


View this table:
[in this window]
[in a new window]
 
Table 1. Primers used for amplification the CD28 exons and the PCR product length in bp

 
SNP analysis of the CD28 gene

The sequence analysis of the CD28 gene revealed a new SNP in intron 3 (see Results). The SNP identified in intron 3 of the CD28 gene was analyzed by the same modified RFLP method used for analyzing the CTLA-4 A/G49 SNP. For the SNP analysis exon 3 was amplified using the primers shown in Table 1Go. The forward primer was fluorescence labeled, and the labeled amplified PCR product was digested using the restriction enzyme AciI. The two alleles were easily separated using this method: the T allele resulted in a fluorescence-labeled undigested PCR product of 280 bp, and the C allele resulted in a digested PCR product with two fragments: a fluorescence-labeled 208-bp fragment and a nonlabeled 72-bp fragment.

Two-point linkage analyses

Two-point LOD scores for the different markers studied were computed using LIPED software (21), assuming both dominant and recessive models (22). For each model three levels of penetrance were tested (30%, 50%, and 80%). According to recently published guidelines (23) we used a LOD score of 1.9 or greater in our whole genome screen as evidence of linkage and a LOD score greater than 3.3 as significant evidence of linkage.

Multipoint linkage analysis

Multipoint LOD scores were computed by the Genehunter program (24) using all markers on each chromosome. Multipoint linkage analysis yields the maximum information for each family for the area of interest. Using Genehunter, we set the inheritance parameters identical to those that gave the maximum LOD scores in the two-point analyses. Marker placement and distances for the multipoint analysis were obtained from the Genethon maps (17).

Heterogeneity testing

As heterogeneity was possible among our families, we allowed for the possibility that TAbs were linked in only a subset of the families. Heterogeneity testing was performed using the Genehunter algorithm for heterogeneity (heterogeneity LOD score).

Association analyses

These were performed using the {chi}2 and Fisher exact tests. P < 0.05 was considered significant.

Power calculations

Simulation studies were performed to assess the power of our 56 families to detect linkage and to assess the maximum attainable LOD scores using our dataset. The simulations demonstrated that using a dataset of 56 families gave statistical power to reject linkage out to 10 centimorgans (cM; {theta} = 0.1), even at a penetrance as low as 0.3 (25). Our families were, therefore, sufficient to reject linkage for the tested markers. Simulations also showed that we had the power to detect linkage using the 56 families. The theoretical maximum attainable LOD score in our dataset was 6.7, assuming the recessive model and a {theta} = 0.01 (25).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characteristics of the study sample

Table 2Go shows the clinical characteristics of the 56 families studied. Fourteen families (25%) had only GD-affected members, 22 families (39%) had only HT-affected members, and 20 families (36%) were mixed with both GD- and HT-affected first degree relatives. There were 185 family members who did not have GD or HT at the time of the study. Thyroid antibodies were measured in 145 (78%) of these unaffected family members, and 50 of them (34%) had thyroid antibodies, similar to the incidence reported in previous studies (26, 27). The female to male ratio was 7.1:1 for the AITD patients and 1:1 for the thyroid antibody-positive family members who did not have clinical disease, indicating that many males with TAbs did not develop disease.


View this table:
[in this window]
[in a new window]
 
Table 2. Characteristics of the study sample

 
Whole genome screening

A total of 387 microsatellite markers spanning the whole human genome were analyzed. For mapping the thyroid antibody susceptibility genes TAb-positive individuals with or without GD/HT were considered affected. Whole genome screening revealed only one locus with a LOD score above 3.0 on chromosome 2q33 (Fig. 1AGo). The maximum 2-point LOD score was 3.61 [strong evidence for linkage (23)] at marker D2S325 (210.9 cM), obtained for the dominant model, at a penetrance of 80% and a recombination fraction ({theta}) of 0.2. Moreover, the LOD scores of other markers in the local region of D2S325 were positive in a geographically logical sequence (Fig. 1BGo). The fact that the maximum LOD score occurred assuming dominant inheritance was consistent with earlier segregation analysis data (14). However, this locus showed no evidence for linkage to GD or HT [2-point LOD scores = 0.42 for GD and -0.60 for HT] (data not shown) (25), demonstrating that the gene in this region conferred susceptibility to TAbs, but clinical disease development required additional genes and/or environmental factors. Separate linkage analysis of TPO and Tg yielded lower positive LOD scores (MLS, 0.83 for TPO and 0.3 for Tg). Thus, there was no indication that one of these antibodies had a stronger influence on the genetic susceptibility to TAb production.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 1. A, Whole genome analysis for loci linked with thyroid antibodies. The x-axis shows the relative marker positions on each chromosome, and the y-axis shows the LOD score obtained for each marker. Only one locus on chromosome 2 gave a LOD score above 3. This was designated TAb-1. B, Maximum two-point LOD score results for markers on chromosome 2. Twenty-nine markers were used to scan chromosome 2, which has an estimated length of 265 cM. The highest LOD score was obtained for marker D2S325 (maximum LOD score, 3.6), and the LOD scores of other markers in the region were positive in a geographically logical sequence.

 
The maximum LOD score was obtained at a high recombination fraction ({theta} = 0.2), which could indicate that genetic heterogeneity existed in our dataset (28). Genetic heterogeneity exists when only a subset of the families is linked with the tested locus, and this appeared to be the case in our dataset. Multipoint heterogeneity testing showed heterogeneity in our dataset giving an {alpha} of 0.39 (i.e. ~30–40% of the families in our dataset were linked with the region on chromosome 2q33).

Fine mapping of the TAb susceptibility locus

To fine map the TAb susceptibility locus we performed a multipoint analysis using densely spaced markers at 2q33. We generated a genetic map for the 2q33 region using 11 markers, with sex-averaged distances between markers (in centimorgans) as follows: D2S316–0.2-D2S348–1.2-D2S374–1.4-D2S309–0.8-D2S307–0.2-CTLA-4(A/G)-0.4-D2S346–3.6-D2S369–0.4-D2S155–0.3-D2S154–1.0-D2S325. This order and distances in centimorgans were obtained from the Genethon maps (17) and were confirmed in our dataset. Multipoint linkage analysis localized the TAb susceptibility locus on chromosome 2q33 to within an approximate interval of 4 cM between markers D2S346 and D2S325. The heterogeneity multipoint LOD scores throughout this interval were greater than 3.0, with a maximum heterogeneity multipoint LOD score of 4.2 obtained near marker D2S155 ({alpha} = 0.42; Table 3Go). This represented significant evidence for linkage (23, 29).


View this table:
[in this window]
[in a new window]
 
Table 3. Heterogeneity testing for loci on chromosome 2q33 that were linked with TAbs

 
Identifying the TAb gene on chromosome 2q33

The chromosome 2q33 region contains at least three important immune regulatory genes, CTLA-4, CD28, and inducible costimulator (ICOS). We, therefore, tested the CTLA-4 and CD28 genes, but we were unable to examine ICOS because the intron/exon sequences of the ICOS gene were not available in the public databases at the time of writing.

Analysis of the CD28 gene

Sequencing of the CD28 gene in 15 normal individuals revealed a new C/T SNP in intron 3 at position 17 after the 3'-end of the exon (C/T-I3 + 17 SNP). To test whether the TAb susceptibility gene on chromosome 2q33 could be the CD28 gene, we performed family-based association studies with the CD28 C/T-I3 + 17 SNP. For this analysis we divided our families into 2 groups based on the method suggested by Ott (30): 1) families linked with TAb-1 (families with multipoint LOD score at marker D2S155 >0.1), and 2) families not linked with TAb-1 (families with multipoint LOD score at D2S155 <=0). We then compared the frequency of the C allele in the probands of the linked families, the probands of the unlinked families, and the controls. The analysis showed that the C allele was present in 21.4% of the controls and the T allele was present in 78.6% of the controls. An almost identical frequency of the C and T alleles was found in the probands of the unlinked families (25% and 75%, respectively) and the probands of the linked families (26.6% and 73.4%, respectively; P = 0.66). Thus, there was no association between the CD28 gene SNP and TAbs in our families.

Analysis of the CTLA-4 gene

We used the same analysis to test whether the TAb susceptibility gene on chromosome 2q33 could be the CTLA-4 gene. The results showed that 34% of the controls had the G allele and 66% had the A allele (Table 4Go), similar to the frequencies reported in previous studies in Caucasians (31, 32). An almost identical frequency of G and A alleles was found in the probands of the unlinked families (36.5% and 63.5%, respectively; Table 4Go). However, in the probands of the linked families we found a frequency of 53% for the G allele and 47% for the A allele (P = 0.02; Table 4Go). When analyzing the genotypes of the probands and the controls, the frequencies of the GG, AG, and AA genotypes were, respectively, 13%, 43%, and 44% for the controls, and 13%, 46%, and 41%, respectively, for the probands in the unlinked families (Table 4Go). In contrast, the frequencies of the GG, AG, and AA genotypes in the probands of the linked families were 21%, 63%, and 16%, respectively (P = 0.06; Table 4Go). Moreover, in almost all the linked families the probands had the G allele, and only in 3 of 19 (16%) linked families did the probands have the AA genotype, compared with 53 of 119 (44%) of the controls.


View this table:
[in this window]
[in a new window]
 
Table 4. Comparison of the frequency of the CTLA-4 A/G49 SNP genotypes in probands from families that were linked and families that were not linked with the TAb-1 locus

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Autoantibodies to Tg and TPO are consistently found in patients with AITDs. A variety of explanations for the production of these TAbs have been proposed, including 1) anti-Tg and anti-TPO are early markers of AITD which precede and facilitate the development of clinical disease; 2) anti-Tg and anti-TPO production is an epiphenomenon secondary to the release of thyroid antigens by thyrocytes undergoing either stimulation or apoptosis induced by the autoimmune response to the thyroid (33, 34); and 3) it is the quality of the TAbs produced that is the deciding pathological factor (e.g. their affinity, specificity, and complement fixing potential) (35). Whatever their role, TAbs are found in almost all patients with AITDs and in many family members of such patients. This report suggests that CTLA-4 is a major TAb susceptibility gene. The finding of CTLA-4 as a gene specific for thyroid autoantibody secretion supports the suggestion that the production of thyroid antibodies is an early event in the development of clinical disease.

Genetic susceptibility to the production of thyroid antibodies was first suggested by Hall et al. (36). Their studies of first degree relatives of probands with AITDs indicated proportions of affected relatives similar to the theoretical expectation for dominant inheritance. More recent family studies have shown that up to 50% of the siblings of AITD patients were TAb positive (5, 11, 26), in contrast to a TAb population prevalence of 7–15% (37). These findings were true in different ethnic groups such as the Japanese (27) and British populations (36). The genetic susceptibility to the production of thyroid antibodies was further supported by several segregation analyses in families with thyroid antibodies that suggested a Mendelian dominant pattern of inheritance (13, 14, 15). Recently, Jaume et al. (38) found evidence for the genetic transmission of TPO antibody fingerprints, suggesting that autoantibody recognition of the TPO antigen was genetically transmitted.

The penetrance of the TAb locus in our dataset was high (80%). This was in contrast to the low penetrance (~30%) of the Graves’ disease loci that we reported previously (25). The high penetrance of the TAb locus was expected in view of the much higher prevalence of thyroid antibodies within families compared with the prevalence of clinical disease (5). Moreover, thyroid antibodies have been shown to precede clinical disease by many years (37). Thus, the age of onset of TAbs is expected to be much lower than the age of onset of clinical disease.

The chromosomal region giving the high LOD scores contained three important immune regulatory genes: the CTLA-4, CD28, and ICOS genes. Our data excluded CD28 and showed that CTLA-4 may be the susceptibility gene for thyroid antibody production in the subgroup of approximately 34% of the families in our dataset linked to this region. ICOS was not analyzed because its genomic sequence was not available in the public databases. Therefore, we could not exclude ICOS as the susceptibility gene for TAbs in this region.

CTLA-4 is an important costimulatory molecule necessary for T cell activation. Recently, there have been several reports demonstrating an association of the CTLA-4 gene with AITDs (31, 39, 40) and other autoimmune diseases (41, 42). Two CTLA-4 polymorphisms, a microsatellite marker located at the 3'-noncoding region of the CTLA-4 gene and a SNP at the leader peptide of the CTLA-4 gene, were found to be associated with Graves’ disease, giving a low relative risk of about 2.0 (31, 39, 40), and a similar low association has been reported for HT (40, 42, 43, 44). Pearce et al. (45) reported linkage to the CTLA-4 gene region in families with AITD. Recently, the same group claimed that the association of the CTLA-4 gene to Graves’ ophthalmopathy was much stronger than that to GD alone (46). We have not been able to confirm these data. Also in our dataset we did not find a stronger association of the CTLA-4 SNP G allele to Graves’ ophthalmopathy compared with GD without ophthalmopathy (19). Moreover, in our dataset GD itself showed little evidence of linkage to the CTLA-4 gene region. That we did find strong linkage of the CTLA-4 gene region to thyroid antibodies suggested that a gene in this region conferred susceptibility to TAb production. Therefore, the production of clinical disease (GD or HT) must require the participation of other disease-specific genes (25) and environmental triggers (47). When we tested whether CD28 or CTLA-4 could be the actual genes in this region responsible for thyroid antibodies, the CD28 gene did not show an association with TAbs or AITD, but the CTLA-4 gene showed a clear association with TAbs. The families that showed positive evidence of linkage had significantly more probands with the G allele compared with the unlinked families and controls, suggesting that the linkage was due to transmission of the G allele of the A/G49 SNP. Indeed, the analysis showed that almost all of the linked families had probands with the G allele, while in the probands from the unlinked families and controls there was a significantly lower frequency of G (P = 0.02; Table 4Go). These results suggested that the G allele of the CTLA-4 A/G49 SNP predisposed individuals to develop thyroid antibodies. Our results were in accord with previous studies showing an association of AITD with the CTLA-4 gene (31, 39, 40), as the AITD patients examined, by definition, must have been positive for TAbs. Therefore, our results extended these observations to show that the CTLA-4 gene may confer susceptibility to the production of TAbs. As some of the TAb-positive individuals would eventually develop AITD, the disease also showed an association with the CTLA-4 gene, as previously observed. Functional studies on the influence of the CTLA-4 A/G49 SNP on T cell function are needed to analyze how this polymorphism may have conferred susceptibility to the development of TAbs (48). Alternatively, the CTLA-4 gene A/G49 SNP may be in strong linkage disequilibrium with a nearby gene that confers susceptibility to TAb production. In this regard it is important to note that the ICOS gene has not yet been tested and, therefore, is not excluded as the TAb susceptibility gene on chromosome 2q33.

In conclusion, we found strong evidence for a susceptibility gene for thyroid antibodies on chromosome 2q33. This gene was mapped to within 4 cM of the CTLA-4 gene, and our family-based association studies provided strong evidence that the CTLA-4 gene was the TAb susceptibility gene in this region. We concluded that the G allele of the CTLA-4 A/G49 SNP predisposed individuals to the production of thyroid autoantibodies in at least 34% of families with AITDs.


    Acknowledgments
 
We thank all of the AITD families who graciously agreed to participate in the study. Additional members of the International Consortium for the Genetics of Autoimmune Thyroid Disease include: Drs. Meir Berezin (Tel-Hashomer, Israel), Rhoda Cobin (New York, NY), Luca Chiovato and Aldo Pinchera (Pisa, Italy), Sandra McLachlan (Los Angeles, CA; who repeatedly asked us to perform these analyses, and we thank her), Bernard Rees Smith (Cardiff, UK), and Fred Clark and Eric Young (Newcastle upon Tyne, UK).


    Footnotes
 
1 This work was supported in part by NIDDK Grants DK-35764, DK-45011, and DK-52464 (to T.F.D.); DK-02498 (to Y.T.); DK-31775, NS-27941, and MH-48858 (to D.A.G.); the David Owen Segal Endowment; and the Consorzio Pisa Ricerche, University of Pisa (to G.B.). Back

Received August 30, 2000.

Revised December 8, 2000.

Accepted December 22, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jacobson DL, Gange SJ, Rose NR, Graham NM. 1997 Epidemiology and estimated population burden of selected autoimmune diseases in the United States. Clin Immunol Immunopathol. 84:223–243.[CrossRef][Medline]
  2. Davies TF. 2000 Graves’ diseases: pathogenesis. In: Braverman LE, Utiger RD, eds. Werner and Ingbar’s the thyroid: A fundamental and clinical text. Philadelphia: Lippincott, Williams & Wilkens; 518–530.
  3. Weetman AP. 1996 Chronic autoimmune thyroiditis. In: Braveramn LE, Utiger RD, eds. Werner and Ingbar’s the thyroid. Philadelphia; Lippincott-Raven; 738–748.
  4. Vanderpump MPJ, Tunbridge WMG, French JM, et al. 1995 The incidence of thyroid disorders in the community: a twenty-year collow-up of the Whickham survey. Clin Endocrinol (Oxf). 43:55–68.[Medline]
  5. Volpe R. 1985 Autoimmune thyroid disease. In: Volpe R, ed. Autoimmunity and endocrine disease. New York: Marcel Dekker; 109–285.
  6. Vyse TJ, Todd JA. 1996 Genetic analysis of autoimmune disease. Cell. 85:311–318.[CrossRef][Medline]
  7. Harvald B, Hauge M. 1956 A catamnestic investigation of Danish twins. Danish Med Bull. 3:150–158.
  8. Brix TH, Christensen K, Holm NV, Harvald B, Hegedus L. 1997 Genetic versus environment in Graves’ disease–a population based twin study. Thyroid. 7(Suppl 1):S-13.
  9. Brix TH, Kyvik KO, Hegedus L. 2000 A population-based study of chronic autoimmune hypothyroidism in Danish twins. J Clin Endocrinol Metab. 85:536–539.[Abstract/Free Full Text]
  10. Tamai H, Ohsako N, Takeno K, et al. 1980 Changes in thyroid function in euthyroid subjects with family history of Graves’ disease; a followup study of 69 patients. J Clin Endocrinol Metab. 51:1123–1128.[Abstract]
  11. Chopra IJ, Solomon DH, Chopra U, Yodhihara E, Tersaki PL, Smith F. 1977 Abnormalities in thyroid function in relatives of patients with Graves’ disease and Hashimoto’s thyroiditis: lack of correlation with inheritance of HLA-B8. J Clin Endocrinol Metab. 45:45–54.[Medline]
  12. Tamai H, Kumagai LF, Nagataki S. 1986 Immunogenetics of Graves’ disease. In: McGregor AM, ed. Immunology of endocrine diseases. Lancaster: MTP Press; 123–141.
  13. Pauls DL, Zakarija M, McKenzie JM, Egeland JA. 1993 Complex segregation analysis of antibodies to thyroid peroxidase in Old Order Amish families. Am J Med Genet. 47:375–379.[CrossRef][Medline]
  14. Phillips D, McLachlan S, Stephenson A, et al. 1990 Autosomal dominant transmission of autoantibodies to thyroglobulin and thyroid peroxidase. J Clin Endocrinol Metab. 70:742–746.[Abstract]
  15. Phillips DI, Shields DC, Dugoujon JM, Prentice L, McGuffin P, Rees Smith B. 1993 Complex segregation analysis of thyroid autoantibodies: are they inherited as an autosomal dominant trait? Hum Hered. 43:141–146.[CrossRef][Medline]
  16. Miller SA, Dykes DD, Plesky HF. 1988 A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16:1215.[Free Full Text]
  17. Dib C, Faure S, Fizames C, et al. 1996 A comprehensive genetic map of the human genome base on 5,264 microsatellites. Nature. 380:152–154.[CrossRef][Medline]
  18. Weber JL. 1990 Human DNA polymorphisms based on length variations in simple- sequence tandem repeats. Genome Anal. 1:159–181.
  19. Villanueva RB, Inzerillo AM, Tomer Y, et al. 2000 Limited genetic susceptibility to severe graves’ ophthalmopathy: no role for CTLA-4 but evidence for an environmental etiology. Thyroid. 10:791–798.[Medline]
  20. Lee KP, Taylor C, Petryniak B, Turka LA, June CH, Thompson CB. 1990 The genomic organization of the CD28 gene: implications for the regulation of CD28 mRNA expression and heterogeneity. J Immunol. 145:344–352.[Abstract]
  21. Ott J. 1976 A computer program for linkage analysis of general human pedigrees. Am J Hum Genet. 28:528–529.[Medline]
  22. Greenberg DA, Abreu P, Hodge SE. 1998 The power to detect linkage in complex disease by means of simple LOD-score analyses. Am J Hum Genet. 63:870–879.[CrossRef][Medline]
  23. Lander E, Kruglyak L. 1995 Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet. 11:241–247.[CrossRef][Medline]
  24. Kruglyak L, Daly MJ, Reeve-Daly MP, Lander ES. 1996 Parametric and nonparametric linkage analysis: a unified multipoint approach. Am J Hum Genet. 58:1347–1363.[Medline]
  25. Tomer Y, Barbesino G, Greenberg DA, Concepcion ES, Davies TF. 1999 Mapping the major susceptibility loci for familial Graves’ and Hashimoto’s diseases: evidence for genetic heterogeneity and gene interactions. J Clin Endocrinol Metab. 84:4656–4664.[Abstract/Free Full Text]
  26. Burek CL, Hoffman WH, Rose NR. 1982 The presence of thyroid autoantibodies in children and adolescents with AITD and in their siblings and parents. Clin Immunol Immunopathol. 25:395–404.[CrossRef][Medline]
  27. Aho K, Gordin A, Sievers K, Takala J. 1983 Thyroid autoimmunity in siblings: a population study. Acta Endocrinol. 251(Suppl):11–15.
  28. Ott J. 1996 Analysis of human genetic linkage. Baltimore: Johns Hopkins University Press.
  29. Thomson G. 1994 Identifying complex disease genes: progress and paradigms. Nat Genet. 8:108–110.[CrossRef][Medline]
  30. Ott J. 1983 Linkage analysis and family classification under heterogeneity. Ann Hum Genet. 47:311–320.[Medline]
  31. Donner H, Rau H, Walfish PG, et al. 1997 CTLA4 alanine-17 confers genetic susceptibility to Graves’ disease and to type 1 diabetes mellitus. J Clin Endocrinol Metab. 82:143–146.[Abstract/Free Full Text]
  32. Heward JM, Allahabadia A, Armitage M, et al. 1999 The development of Graves’ disease and the CTLA-4 gene on chromosome 2q33. J Clin Endocrinol Metab. 84:2398–2401.[Abstract/Free Full Text]
  33. Davies TF. 1996 The pathogenesis of Graves’ disease. In: Braverman LE, Utiger RD, eds. Werner and Ingbar’s the thyroid: a fundamental and clinical text. Philadelphia: Lippincott-Raven; 525–536.
  34. Tomer Y. 1997 Anti-thyroglobulin autoantibodies in autoimmune thyroid diseases: cross- reactive or pathogenic? Clin Immunol Immunopathol. 82:3–11.[CrossRef][Medline]
  35. Kuppers RC, Bresler HS, Lynne Burek C, Gleason SL, Rose NR. 1992 Immunodominant determinants of thyroglobulin associated with autoimmune thyroiditis. In: Bona CA, Kaushik AK, eds. Molecular immunobiology of self-reactivity. New York: Marcel Dekker; 247–284.
  36. Hall R, Stanbury JB. 1967 Familial studies of autoimmune thyroiditis. Clin Exp Immunol. 2:719–725.
  37. Tunbridge WMG, Evered DC, Hall R, et al. 1977 The spectrum of thyroid disease in a community: the Whickham survey. Clin Endocrinol (Oxf). 7:481–493.[Medline]
  38. Jaume JC, Guo J, Pauls DL, et al. 1999 Evidence for genetic transmission of thyroid peroxidase autoantibody epitopic "fingerprints." J Clin Endocrinol Metab. 84:1424–1431.[Abstract/Free Full Text]
  39. Yanagawa T, Hidaka Y, Guimaraes V, Soliman M, DeGroot LJ. 1995 CTLA-4 gene polymorphism associated with Graves’ disease in a caucasian population. J Clin Endocrinol Metab. 80:41–45.[Abstract]
  40. Kotsa K, Watson PF, Weetman AP. 1997 A CTLA-4 gene polymorphism is associated with both Graves’ disease and autoimmune hypothyroidism. Clin Endocrinol (Oxf). 46:551–554.[CrossRef][Medline]
  41. Nistico L, Buzzetti R, Pritchard LE, et al. 1996 The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes. Belgian Diabetes Registry Hum Mol Genet. 5:1075–1080.
  42. Donner H, Braun J, Seidl C, et al. 1997 Codon 17 polymorphism of the cytotoxic T lymphocyte antigen 4 gene in Hashimoto’s thyroiditis and Addison’s disease. J Clin Endocrinol Metab. 82:4130–4132.[Abstract/Free Full Text]
  43. Braun J, Donner H, Siegmund T, Walfish PG, Usadel KH, Badenhoop K. 1998 CTLA-4 promoter variants in patients with Graves’ disease and Hashimoto’s thyroiditis. Tissue Antigens. 51:563–566.[Medline]
  44. Sale MM, Akamizu T, Howard TD, et al. 1997 Association of autoimmune thyroid disease with a microsatellite marker for the thyrotropin receptor gene and CTLA-4 in a Japanese population. Proc Assoc Am Physicians. 109:453–461.[Medline]
  45. Vaidya B, Imrie H, Perros P, et al. 1999 The cytotoxic T lymphocyte antigen-4 is a major Graves’ disease locus. Hum Mol Genet. 8:1195–1199.[Abstract/Free Full Text]
  46. Vaidya B, Imrie H, Perros P, et al. 1999 Cytotoxic T lymphocyte antigen-4 (CTLA-4) gene polymorphism confers susceptibility to thyroid associated orbitopathy [Letter]. Lancet. 354:743–744.
  47. Tomer Y, Davies TF. 1993 Infection, thyroid disease and autoimmunity. Endocr Rev. 14:107–120.[Abstract]
  48. Kouki T, Sawai Y, Gardine CA, Fisfalen ME, Alegre ML, DeGroot LJ. 2000 CTLA-4 gene polymorphism at position 49 in exon 1 reduces the inhibitory function of CTLA-4 and contributes to the pathogenesis of Graves’ disease J Immunol. 165:6606–6611.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
J.-Y. Hsiao, M.-C. Hsieh, K.-J. Tien, S.-C. Hsu, S.-J. Shin, and S.-R. Lin
Association between a C/T Polymorphism in Exon 33 of the Thyroglobulin Gene Is Associated with Relapse of Graves' Hyperthyroidism after Antithyroid Withdrawal in Taiwanese
J. Clin. Endocrinol. Metab., August 1, 2007; 92(8): 3197 - 3201.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
B. MARASINI, P. A. FERRARI, N. SOLARO, and C. SELMI
Thyroid Dysfunction in Women with Systemic Sclerosis
Ann. N.Y. Acad. Sci., June 1, 2007; 1108(1): 305 - 311.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
P. S Hansen, T. H Brix, I. Iachine, K. O Kyvik, and L. Hegedus
The relative importance of genetic and environmental effects for the early stages of thyroid autoimmunity: a study of healthy Danish twins
Eur. J. Endocrinol., January 1, 2006; 154(1): 29 - 38.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Golden, L. Levin, Y. Ban, E. Concepcion, D. A. Greenberg, and Y. Tomer
Genetic Analysis of Families with Autoimmune Diabetes and Thyroiditis: Evidence for Common and Unique Genes
J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4904 - 4911.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Ban, E. S. Concepcion, R. Villanueva, D. A. Greenberg, T. F. Davies, and Y. Tomer
Analysis of Immune Regulatory Genes in Familial and Sporadic Graves' Disease
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4562 - 4568.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P.-W. Wang, R.-T. Liu, S.-H. H. Juo, S.-T. Wang, Y.-H. Hu, C.-J. Hsieh, M.-H. Chen, I-Y. Chen, and C.-L. Wu
Cytotoxic T Lymphocyte-Associated Molecule-4 Polymorphism and Relapse of Graves' Hyperthyroidism after Antithyroid Withdrawal
J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 169 - 173.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Ban, D. A. Greenberg, E. Concepcion, L. Skrabanek, R. Villanueva, and Y. Tomer
Amino acid substitutions in the thyroglobulin gene are associated with susceptibility to human and murine autoimmune thyroid disease
PNAS, December 9, 2003; 100(25): 15119 - 15124.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
Y. Tomer and T. F. Davies
Searching for the Autoimmune Thyroid Disease Susceptibility Genes: From Gene Mapping to Gene Function
Endocr. Rev., October 1, 2003; 24(5): 694 - 717.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. E. Collins, J. M. Heward, J. Carr-Smith, J. Daykin, J. A. Franklyn, and S. C. L. Gough
Association of a Rare Thyroglobulin Gene Microsatellite Variant with Autoimmune Thyroid Disease
J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 5039 - 5042.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Dittmar and G. J. Kahaly
Polyglandular Autoimmune Syndromes: Immunogenetics and Long-Term Follow-Up
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2983 - 2992.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
H. H. Kacem, A. Rebai, N. Kaffel, S. Masmoudi, M. Abid, and H. Ayadi
PDS Is a New Susceptibility Gene to Autoimmune Thyroid Diseases: Association and Linkage Study
J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 2274 - 2280.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Vaidya, P. Kendall-Taylor, and S. H. S. Pearce
The Genetics of Autoimmune Thyroid Disease
J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5385 - 5397.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Anjos, A. Nguyen, H. Ounissi-Benkalha, M.-C. Tessier, and C. Polychronakos
A Common Autoimmunity Predisposing Signal Peptide Variant of the Cytotoxic T-lymphocyte Antigen 4 Results in Inefficient Glycosylation of the Susceptibility Allele
J. Biol. Chem., November 22, 2002; 277(48): 46478 - 46486.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomer, Y.
Right arrow Articles by Davies, T. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomer, Y.
Right arrow Articles by Davies, T. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals