help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 3 1267-1273
Copyright © 2001 by The Endocrine Society


Original Studies

Regulation of Interleukin 8 Production and Gene Expression in Human Adipose Tissue in Vitro1

Jens M. Bruun, Steen B. Pedersen and Bjørn Richelsen

Department of Endocrinology and Metabolism C, Aarhus Amtssygehus, Aarhus University Hospital and Faculty of Health Sciences, Aarhus University, DK-8000 Aarhus C, Denmark

Address correspondence and requests for reprints to: Jens M. Bruun, M.D., Department of Endocrinology and Metabolism, Aarhus Amtssygehus, Tage Hansensgade 2, DK-8000 Aarhus C, Denmark. E-mail: jmb{at}mail-online.dk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A variety of cytokines and other compounds are produced in the human adipose tissue and may have autocrine functions in the adipose tissue as well as be involved in the complications seen in association with obesity. Because it recently has been reported that interleukin 8 (IL-8), through its effects on the macrophage and endothelial cell, may be involved in the pathogenesis of atherosclerosis, we found it of interest to investigate whether IL-8 is produced in human adipose tissue in vitro. Human sc adipose tissue was investigated both in incubations with whole adipose tissue fragments as well as with isolated mature adipocytes. In adipose tissue fragments, IL-1ß (3 nM) and tumor necrosis factor {alpha} (0.6 nM) were able to stimulate IL-8 production by 12-fold and 5-fold, respectively (P < 0.001), when incubated for 48 h. Incubations with isolated adipocytes were performed up to 6 h, and IL-1ß and tumor necrosis factor {alpha} significantly increased IL-8 production by 50–60% (P < 0.05). Dexamethasone (50 nM) decreased IL-8 production from adipose tissue fragments by 57% (P < 0.01) and from adipocytes by 37% (P < 0.05). IL-8 messenger RNA expression in adipocytes incubated with IL-1ß was increased already after 2 h (P < 0.05). Thus, the effect of proinflammatory cytokines and dexamethasone on IL-8 production in adipose tissue seems to be mediated at the transcriptional level. In conclusion, it is demonstrated for the first time that IL-8 is produced and released from human adipose tissue and from isolated adipocytes in vitro, which may indicate that IL-8 from adipose tissue could be involved in some of the obesity-related complications.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN ADDITION TO its well known role for storage of energy, the adipose tissue participates actively in local and whole body metabolism, through a network of endocrine, paracrine, and autocrine signals (1). One of the best described adipocyte-derived endocrine substances is the hormone leptin (2). The adipose tissue, however, also produces and releases a variety of other substances, including several cytokines [e.g. tumor necrosis factor {alpha} (TNF-{alpha}) and interleukin-6 (IL-6); Refs. 3 and 4 ] and prostaglandins (5). It has been suggested that TNF-{alpha} may be involved in the pathogenesis of the insulin resistance generally seen in association with obesity. Rodent models have shown a 5- to 10-fold elevated TNF-{alpha} messenger RNA (mRNA) in the adipose tissue from genetically obese and insulin-resistant animals compared with lean controls. When these obese animals were treated with a neutralizing, recombinant, soluble TNF-{alpha} receptor, a significant improvement in the peripheral glucose uptake was seen (6). Studies on human adipose tissue have revealed a 2.5-fold higher expression of TNF-{alpha} mRNA in obese compared with lean subjects (7). Furthermore, serum levels of TNF-{alpha} have also been found to be elevated in obese compared with lean subjects and to be significantly decreased after weight loss (8, 9). However, not all studies have found that TNF-{alpha} is of importance for the obesity-associated insulin resistance (10, 11, 12). Like TNF-{alpha}, IL-6 is known to be involved in the regulation of insulin signaling and lipid metabolism. IL-6 treatment in rats causes hypertriglyceridemia by increasing the hepatic triglyceride secretion as well as stimulates lipolysis (13). In humans, serum levels of IL-6 are shown to be positively correlated with the degree of obesity as assessed by body mass index (BMI; Ref. 14). Fried et al. (15) have recently reported that omental adipose tissue releases two to three times more IL-6 than sc adipose tissue.

One of the well known and important complications to obesity is atherosclerosis. Because it is generally recognized that atherosclerosis might have inflammation as a important part of its pathology, another cytokine-like substance, IL-8 has recently been suggested to contribute to atherogenesis through the following actions primarily reported from observations done in proximity to the initial preatherosclerotic lesion as well as in the advanced atherosclerotic plaque. Oxidized low-density lipoprotein, which is well described in the atherosclerotic process, stimulates the release of IL-8 from macrophages in the atherosclerotic lesion (16). IL-8 then acts as a local chemoattractant for neutrophils and T cells, induces adhesion of monocytes to the surface of the atherosclerotic lesion/plaque, and stimulates smooth muscle cell migration and proliferation, elements that all are reported to be part of the pathogenesis of atherosclerosis (17). Furthermore, IL-8 has been shown to decrease the specific tissue inhibitors of metalloproteinases and thereby increase the local release of matrix-degrading metalloproteinases, leading to instability of the advanced atherosclerotic plaque (18). IL-8 is a member of the CXC chemokine superfamily, which consists of small proteins of 70–80 amino acids with four conserved cysteines forming two disulfide bonds, a short amino-terminal, and a longer carboxyl-terminal. The subfamilies are distinguished according to the arrangement of the first two cysteines, which are either separated by one amino acid (CXC chemokines) or adjacent (CC chemokines). The CXC chemokines primarily act as chemoattractants for neutrophils, whereas CC chemokines act on monocytes (19). IL-8 has, besides its implications for atherosclerosis, mostly been known for its association with different inflammatory processes (19, 20). Because the adipose tissue is able to produce and release various cytokines and IL-8 has been implicated in the atherosclerotic process, we found it of interest to investigate the ability of human adipose tissue and isolated adipocytes to express and release IL-8. In this study, it is shown for the first time that IL-8 is produced and released both from mature isolated adipocytes as well as from cultured adipose tissue fragments in a regulated manner.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Subjects

For the adipose tissue fragment incubations, sc adipose tissue was obtained from the abdominal region from 10 healthy normal to overweight women undergoing liposuction at a plastic surgical clinic. The subjects had an age range of 30–52 yr, a mean weight of 72.4 ± 2.9 kg, and a mean BMI of 25.6 ± 1.1 kg/m2 (range, 22–28). All subjects were fasted overnight before tissue removal. The adipose tissue was mixed with isotonic NaCl and transported to the laboratory in a sterile container within 30 min after removal.

For the isolated adipocyte incubations, sc adipose tissue was removed from the abdominal region from six obese women [age range, 26–42 yr; mean weight, 89.7 ± 14.6 kg; mean BMI, 28.8 ± 2.7 kg/m2 (range, 28–41). The subjects were fasted overnight, and the adipose tissue was removed by a biopsy using sterile technique, performed at our laboratory as described previously (21). In brief, the skin was first anesthetized with lidocain (10 mg/mL) before a small incision was made. Then, 15 mL isotonic NaCl and 10 mL lidocain (10 mg/mL) was injected into the sc adipose tissue, and 10–15 g tissue was removed by a needle, to which partial vacuum was applied. None of the subjects had any metabolic disorders or received any medication that influences adipose tissue metabolism. The study had been approved by the local ethic committee.

Whole adipose tissue cultures

The adipose tissue was placed in medium 199, and all subsequent procedures were carried out under a laminar airflow hood. The tissue was minced into fragments of less than 10 mg each and placed in organ culture, as described previously (22, 23). In brief, a total amount of about 500 mg adipose tissue fragments floated freely in 5 mL serum free medium 199 without phenol red in 50-mL plastic tubes. The plastic tubes containing the cultures were placed in a humidified incubator at 37 C and at an atmosphere of 5% CO2. Medium 199 was supplemented with 25 mM HEPES; 1% bovine albumin; 1 nM insulin, antipain, and leupeptin; 20 µl/100 mL medium; penicillin and streptomycin (10,000 IU); and 1 mL/100 mL medium. The adipose tissue was preincubated for 24 h. Hereafter, the medium was replaced and the indicated substances were added, and the incubation continued for the time indicated (maximum, 48 h). All incubations were performed in duplicate, and in the dose-response and time-course experiments each data point represented the mean of duplicate incubations from four individuals. The culture medium obtained from the different incubations was kept at -20 C until IL-8 was measured, and the adipose tissue was immediately frozen in liquid nitrogen and kept at -80 C for later RNA extraction.

Isolated adipocytes

Immediately after removal, the adipose tissue was quickly transported to the laboratory and washed several times in isotonic NaCl. The adipocytes were isolated by collagenase digestion (0.15 mg/g adipose tissue) of adipose tissue fragments in 10 mmol/L HEPES buffer for 45–60 min at 37 C, as described previously (24). The isolated adipocytes were washed three times in buffer containing 5% albumin and were finally resuspended in medium 199 containing 1% BSA and 25 mM HEPES. Two hundred microliters of cell suspension containing 10% adipose cells were used, which corresponds to about 100,000 adipocytes being suspended in each tube. For each tested variable, the adipocytes were incubated with the indicated substances for up to 6 h and each data point represented the mean of duplicate incubations from six individuals.

IL-8 expression and measurements

RNA was isolated using Trizol reagents. The RT was made with random hexamer primers as described by the manufacturer (GeneAmp PCR kit; Perkin-Elmer Corp., Norwalk, CT). The PCR amplification was performed using Hot Start Taq DNA polymerase (5 U/µL). The IL-8 sense primer was TTGGCAGCCTTCCTGATTTC, and the antisense primer was AACTTCTCCACAACCCTCTG and spanned a product of 291 bp. ß-actin mRNA was amplified as a housekeeping marker, and a semiquantitative multiplex PCR method "primer-dropping" (23, 25) was used to monitor mRNA expression. Semiquantitative multiplex PCR estimates the relative amount of target mRNA to a known housekeeping gene (ß-actin) to control the sample variability. In the adipose tissue fragments, IL-8 complementary DNA was amplified for 10 cycles before ß-actin primers were added, after which the amplification was continued for the remaining 23 cycles. In the isolated adipocytes, IL-8 complementary DNA was amplified for nine cycles before ß-actin primers were added, and the amplification was continued for the remaining 27 cycles. The PCR products were loaded on a 3% agarose gel stained with ethidium bromide and analyzed using the Bio-Rad Gel Doc 1000 system (Bio-Rad Laboratories, Inc., Hercules, CA).

IL-8 was measured in the culture medium samples using a specific human enzyme-linked immunosorbent assay method (R&D Systems, Minneapolis, MN). The range of the standard curve in this assay was 31.2–2000 pg/mL, and the lower limit of detection was 10 pg/mL. The intra-assay coefficient of variation was 6.4 ± 1.1% (n = 12), and the interassay coefficient of variation was 7.9 ± 1.8% (n = 6). In the time course studies on adipose tissue fragments, test samples from the culture medium were diluted 1:200, 1:500, or 1:700 to measure the samples within the range of the standard curve. The test samples from the isolated adipocytes were not diluted.

Materials

Collagenase was obtained from Worthington Biochemical Corp. (Freehold, NJ); penicillin/streptomycin, medium 199, and Trizol were obtained from Life Technologies, Inc. (Roskilde, Denmark); PCR buffers and Hot Start Taq DNA polymerase were obtained from QIAGEN (Merck Kebolab, Albertsluno, Denmark); PCR buffer II GeneAmp, dNTP-mix GeneAmp, RT reverse transcriptase, and RNAse inhibitors were purchased from PE Biosystems (Norwalk, CT); random hexamer primers were obtained from Roche Diagnostics Biochemicals (Hvidovre, Denmark). All other chemicals and reagents were obtained from Sigma (St. Louis, MO).

Statistical analysis

The values are presented as means ± SEM. The SPSS statistical packet (SPSS /8.0; SPSS, Inc., Chicago, IL) was used for the calculations. For the comparison of data over several time points (see Figs. 2Go and 5Go), a general linear model for repeated measures with a post hoc Bonferroni test was used. For comparison between the adipose tissue fragment incubations (Fig. 1Go), an ANOVA with a Dunnett’s test for post hoc multiple comparison was used.



View larger version (12K):
[in this window]
[in a new window]
 
Figure 2. Effects of IL-1ß on IL-8 release in adipose tissue fragments. Adipose tissue was incubated with ({circ}) or without (•) IL-1ß (3 nM) for the indicated time period. The variation of IL-8 concentration in the medium in control, nonstimulated incubations is shown in the inserted figure. Data represent mean values ± SEM (n = 4). Comparison between IL-1ß stimulation and control: *, P < 0.05; **, P < 0.01; and ***, P < 0.001.

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. IL-8 production and IL-8 gene expression in isolated adipocytes. A, Incubations were performed with either IL-1ß (0.1 nM), TNF-{alpha} (0.6 nM), or dexamethasone (50 nM) for up to 6 h. B, IL-8 gene expression on incubations with either IL-1ß or dexamethasone was measured by RT-PCR. Data represent mean values ± SEM (n = 6). *P < 0.05, **P < 0.01, and ***P < 0.001 as compared with controls.

 


View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. Hormonal regulation of IL-8 production in adipose tissue fragments. Adipose tissue fragments were incubated with either dexamethasone (50 nM), IL-1ß (3 nM), TNF-{alpha} (0.6 nM), insulin (100 nM), IL-6 (2 nM), or GH (50 nM) for 48 h. Data represent mean values ± SEM (n = 4). *P < 0.05 and **P < 0.001 as compared with control levels.

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Adipose tissue fragments

Regulation of IL-8 production (Fig. 1Go). In the following experiments, adipose tissue fragments were incubated for 48 h with various hormones and cytokines. The proinflammatory cytokines IL-1ß (3 nM) and TNF-{alpha} (0.6 nM) both stimulated IL-8 production significantly. IL-1ß and TNF-{alpha} increased IL-8 concentration in the medium 12-fold (P < 0.001) and 5-fold (P < 0.001), respectively (Fig. 1Go). Dexamethasone (50 nM) was found significantly to decrease the nonstimulated IL-8 production by 57% (7.2 ± 0.9 nM vs. 3.1 ± 0.4 nM, P < 0.05). IL-6 (2 nM) had a small stimulatory effect on IL-8 production (47% above control incubations; P = 0.069). There were no significant differences in IL-8 concentration when incubating with either GH (50 nM) or insulin (100 nM).

Time-course studies (Fig. 2Go)

As described in Materials and Methods, the adipose tissue fragments were preincubated for 24 h before the addition of various hormones (t = 0). The time-course was performed for up to 48 h. IL-1ß at a concentration of 3 nM had a significant stimulatory effect on IL-8 release, which was already observed after 4 h (P < 0.05; Fig. 2Go). After incubation for 48 h, IL-1ß induced a 15-fold increase in IL-8 production (5.1 ± 0.6 nM vs. 74.3 ± 10.0 nM, P < 0.001). The concentration of IL-8 per hour of incubation in the basal, nonstimulated situation was stable during the incubation period.

IL-8 mRNA expression was measured with PCR after incubation for 48 h. A 30% increment in IL-8 expression was found after IL-1ß stimulation as compared with control incubations (1.6 ± 0.2 vs. 2.1 ± 0.3 arbitrary units, P < 0.01; data not shown).

Dose-response studies for IL-1ß and TNF-{alpha} (Figs. 3Go and 4Go)

Both IL-1ß and TNF-{alpha} stimulated IL-8 production in a dose-dependent manner (Fig. 3Go). The half-maximal stimulatory concentration (EC50) was obtained by IL-1ß at a concentration of 6.5 ± 2.3 pM and by TNF-{alpha} at 15.9 ± 9.4 pM. The maximal stimulatory effect (EMax) of IL-1ß was significantly higher than that induced by TNF-{alpha} (36.7 ± 2.0 nM vs. 18.3 ± 2.2 nM, P < 0.05).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 3. Dose-response studies on IL-8 production. Adipose tissue fragments were incubated for 24 h with increasing concentrations of IL-1ß ({blacksquare}) or TNF-{alpha} (•). The half-maximal stimulatory concentration (EC50) of IL-1ß and TNF-{alpha} was 6.5 ± 2.3 pM and 15.9 ± 9.4 pM, respectively. Data represent mean values ± SEM (n = 4).

 


View larger version (9K):
[in this window]
[in a new window]
 
Figure 4. Effect of dexamethasone on IL-8 production. Adipose tissue fragments were incubated with increasing concentrations of dexamethasone together with IL-1ß (0.1 nM). The half-maximal inhibitory concentration (IC50) for dexamethasone was 24.8 ± 7.1 nM. Data represent mean values ± SEM (n = 4).

 
In experiments investigating the inhibitory effect of dexamethasone, IL-8 production was stimulated by IL-1ß at a concentration of 0.1 nM. The half-maximal inhibitory concentration (IC50) of dexamethasone was obtained at a concentration of 24.8 ± 7.1 nM.

Isolated adipocytes

It is well known that the adipose tissue fragments contained both adipocytes as well as other cell types (e.g. stromal-endothelial cells) that are able to produce IL-8. Thus, to test whether adipocytes alone is able to produce IL-8, we investigated IL-8 production and IL-8 gene expression in incubations with isolated mature adipocytes. Isolated mature human adipocytes can only be incubated for relatively short periods as compared with whole adipose tissue fragments because of cell rupture, which can be detected directly by observing a layer of free triglyceride at the top of the incubation tubes. Accordingly, these incubations were only performed for up to 6 h.

It was found that IL-1ß (0.1 nM) was able to significantly stimulate IL-8 production both after 4 and 6 h of incubation with isolated adipocytes by 49% and 60%, respectively (P < 0.05; Fig. 5AGo). TNF-{alpha} (0.6 nM) stimulated, after 6 h, the release of IL-8 by 49% (85.0 ± 14.9 pM vs. 126.7 ± 6.6 pM, P < 0.05). During nonstimulated conditions, dexamethasone (50 nM) decreased IL-8 production by 37% (85.0 ± 14.9 pM vs. 53.5 ± 12.9 pM, P < 0.05; Fig. 5AGo).

At the mRNA level, the increase in IL-8 expression was found already after 2 h of incubation with IL-1ß 0.1 nM (P < 0.05). This increase in IL-8 mRNA expression was sustained for 6 h (P < 0.001; Fig. 5BGo). Dexamethasone (50 nM) decreased IL-8 mRNA expression by 33% (P < 0.05) after 4 h (Fig. 5BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Growing evidence suggests that the human adipose tissue could be one of the contributors of the endocrine, paracrine, and autocrine signaling in the human body (1). There are also several reports on chemokines [e.g. IL-8 and monocyte chemoattractant and activating protein-1 (MCP-1)]. MCP-1 is a CC chemokine acting as a potent chemoattractants for monocytes, being involved in the pathogenesis of atherosclerosis and thereby in cardiovascular disease (17). The present study shows, for the first time, that the chemokine IL-8 is produced and released from human adipose tissue in vitro. IL-8 is released from human adipose tissue fragments as well as from mature isolated adipocytes. The release is stimulated by the proinflammatory cytokines IL-1ß and TNF-{alpha} in a dose- and time-dependent manner, thus supporting findings in other cell types, where IL-1ß and TNF-{alpha} have also been shown to stimulate IL-8 production and release (26). The release of IL-8 from adipose tissue fragments was significantly increased over 48 h when incubated with both IL-1ß and TNF-{alpha}. IL-8 production and release were found to be inhibited in a time- and dose-dependent manner by dexamethasone. These results are in agreement with other studies, where the production of IL-8, but also several other cytokines such as IL-1, IL-2, IL-4, IL-6 and TNF-{alpha}, were inhibited by dexamethasone in different cell-types (27).

The concentration of IL-8 that accumulates in the adipose tissue incubations after 48 h was up to 7.2 nM in the control situation and up to 83 nM when stimulated with IL-1ß (3 nM). At present, the concentration of IL-8 released from the adipose tissue in vivo is unknown. However, measurements of IL-8 levels in serum from healthy subjects have shown concentrations in the picomolar range (28, 29), and the results found in our in vitro experiments correlate well with IL-8 concentration demonstrated to elicit biological effects in other in vitro experiments [e.g. human aortic smooth cell migration (30) and monocyte arrest and firm adhesion to the vascular endothelium (31)].

Neither insulin nor GH was found to have any effect on the production and release of IL-8 from the adipose tissue fragments. It should, however, be mentioned that all incubations were performed in the presence 1 nM insulin, which may obscure a possible effect of insulin.

IL-6 was found to have a small but nonsignificant stimulatory effect on IL-8 production in adipose tissue. In other cell types it has been reported that IL-6 has a more pronounced stimulatory effect on IL-8 (32). Romano et al. (33) found an induction of the IL-8 expression in endothelial cells, using a IL-6-IL-6 receptor complex. However, Oh et al. (34) found no effect on IL-8 expression in human astrocytes and astroglioma cell lines, using a IL-6-IL-6 receptor complex.

In adipose tissue fragments as well as in isolated adipocytes a significant induction of IL-8 gene transcription was observed. Incubating isolated adipocytes with either IL-1ß or dexamethasone affected IL-8 mRNA expression significantly before a change in IL-8 protein levels could be observed, indicating that the effect of these substances on IL-8 production and secretion was at the transcriptional level. These findings were consistent with observations done in other tissues (35).

Several authors have implicated that the CXC chemokine IL-8, among other things, is involved in the pathogenesis of atherosclerosis through numerous different actions (e.g. leukocyte recruitment, adhesion of monocytes to the endothelium, and vascular smooth cell migration; Refs. 17 and 30). The findings in this study could, therefore, suggest that the correlation found between the severity of obesity and the development of atherosclerosis and cardiovascular disease might be related to the ability of human adipose tissue to produce and release IL-8, both in the basal situation and when adequately stimulated (e.g. with proinflammatory cytokines like TNF-{alpha} and IL-1ß). This hypothesis of an association between obesity, IL-8, and cardiovascular disease waits, however, to be substantiated by further investigations.


    Acknowledgments
 
The technical assistance of Lenette Pedersen, Dorte Phillip, and Pia Hornbek is gratefully appreciated.


    Footnotes
 
1 Supported by the Novo Nordic Foundation, Aarhus University, the Danish Medical Research Council, and the Aarhus University-Novo Nordic Center for Research in Growth and Regeneration. Back

Received June 13, 2000.

Revised November 6, 2000.

Accepted November 13, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mohamed-Ali V, Pinkney JH, Coppack SW. 1998 Adipose tissue as an endocrine and paracrine organ. Int J Obes Relat Metab Disord. 22:1145–1158.[CrossRef][Medline]
  2. Van Gaal LF, Wauters MA, Mertens IL, Considine RV, De Leeuw I. 1999 Clinical endocrinology of human leptin. Int J Obes Relat Metab Disord. 23(Suppl 1):29–36.
  3. Hotamisligil GS. 1999 Mechanisms of TNF-{alpha}-induced insulin resistance [see comments]. Exp Clin Endocrinol Diabetes. 107:119–125.[Medline]
  4. Mohamed-Ali V, Goodrick S, Rawesh A, et al. 1997 Subcutaneous adipose tissue releases interleukin-6, but not tumor necrosis factor-{alpha}, in vivo. J Clin Endocrinol Metab. 82:4196–4200.[Abstract/Free Full Text]
  5. Richelsen B. 1992 Release and effects of prostaglandins in adipose tissue. Prostaglandins Leukot Essent Fatty Acids. 47:171–182.[CrossRef][Medline]
  6. Hotamisligil GS, Shargill NS, Spiegelman BM. 1993 Adipose expression of tumor necrosis factor-{alpha}: direct role in obesity-linked insulin resistance. Science. 259:87–91.[Abstract/Free Full Text]
  7. Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM. 1995 Increased adipose tissue expression of tumor necrosis factor-{alpha} in human obesity and insulin resistance. J Clin Invest. 95:2409–2415.
  8. Katsuki A, Sumida Y, Murashima S, et al. 1998 Serum levels of tumor necrosis factor-{alpha} are increased in obese patients with noninsulin-dependent diabetes mellitus. J Clin Endocrinol Metab. 83:859–862.[Abstract/Free Full Text]
  9. Dandona P, Weinstock R, Thusu K, Abdel-Rahman E, Aljada A, Wadden T. 1998 Tumor necrosis factor-{alpha} in sera of obese patients: fall with weight loss. J Clin Endocrinol Metab. 83:2907–2910.[Abstract/Free Full Text]
  10. Ofei F, Hurel S, Newkirk J, Sopwith M, Taylor R. 1996 Effects of an engineered human anti-TNF-{alpha} antibody (CDP571) on insulin sensitivity and glycemic control in patients with NIDDM. Diabetes. 45:881–885.[Abstract]
  11. Schreyer SA, Chua SCJ, LeBoeuf RC. 1998 Obesity and diabetes in TNF-{alpha} receptor-deficient mice. J Clin Invest. 102:402–411.[Medline]
  12. Koistinen HA, Bastard JP, Dusserre E, et al. 2000 Subcutaneous adipose tissue expression of tumour necrosis factor-{alpha} is not associated with whole body insulin resistance in obese nondiabetic or in type-2 diabetic subjects. Eur J Clin Invest. 30:302–310.[CrossRef][Medline]
  13. Nonogaki K, Fuller GM, Fuentes NL, et al. 1995 Interleukin-6 stimulates hepatic triglyceride secretion in rats. Endocrinology. 136:2143–2149.[Abstract]
  14. Vgontzas AN, Papanicolaou DA, Bixler EO, Kales A, Tyson K, Chrousos GP. 1997 Elevation of plasma cytokines in disorders of excessive daytime sleepiness: role of sleep disturbance and obesity [see comments]. J Clin Endocrinol Metab. 82:1313–1316.[Abstract/Free Full Text]
  15. Fried SK, Bunkin DA, Greenberg AS. 1998 Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab. 83:847–850.[Abstract/Free Full Text]
  16. Liu Y, Hulten LM, Wiklund O. 1997 Macrophages isolated from human atherosclerotic plaques produce IL-8, and oxysterols may have a regulatory function for IL-8 production. Arterioscler Thromb Vasc Biol. 17:317–323.[Abstract/Free Full Text]
  17. Reape TJ, Groot PH. 1999 Chemokines and atherosclerosis. Atherosclerosis. 147:213–225.[CrossRef][Medline]
  18. Moreau M, Brocheriou I, Petit L, Ninio E, Chapman MJ, Rouis M. 1999 Interleukin-8 mediates downregulation of tissue inhibitor of metalloproteinase-1 expression in cholesterol-loaded human macrophages: relevance to stability of atherosclerotic plaque. Circulation. 99:420–426.[Abstract/Free Full Text]
  19. Baggiolini M, Loetscher P, Moser B. 1995 Interleukin-8 and the chemokine family. Int J Immunopharmacol. 17:103–108.[CrossRef][Medline]
  20. Roebuck KA. 1999 Regulation of interleukin-8 gene expression. J Interferon Cytokine Res. 19:429–438.[CrossRef][Medline]
  21. Pedersen SB, Borglum J, Jorgensen JO, Richelsen B. 1995 Growth hormone treatment of obese premenopausal women: effects on isolated adipocyte metabolism. Endocrinol Metab. 2:251–258.
  22. Ottosson M, Vikman-Adolfsson K, Enerback S, Olivecrona G, Bjorntorp P. 1994 The effects of cortisol on the regulation of lipoprotein lipase activity in human adipose tissue. J Clin Endocrinol Metab. 79:820–825.[Abstract]
  23. Kristensen K, Pedersen SB, Richelsen B. 1999 Regulation of leptin by steroid hormones in rat adipose tissue. Biochem Biophys Res Commun. 259:624–630.[CrossRef][Medline]
  24. Richelsen B. 1988 Prostaglandin E2 action and binding in human adipocytes: effects of sex, age, and obesity. Metabolism. 37:268–275.[CrossRef][Medline]
  25. Wong H, Anderson WD, Cheng T, Riabowol KT. 1994 Monitoring mRNA expression by polymerase chain reaction: the "primer-dropping" method. Anal Biochem. 223:251–258.[CrossRef][Medline]
  26. Matsushima K, Oppenheim JJ. 1989 Interleukin 8 and MCAF: novel inflammatory cytokines inducible by IL 1 and TNF. Cytokine. 1:2–13.[CrossRef][Medline]
  27. Frieri M. 1999 Corticosteroid effects on cytokines and chemokines. Allergy Asthma Proc. 20:147–159.[CrossRef][Medline]
  28. Zozulinska D, Majchrzak A, Sobieska M, Wiktorowicz K, Wierusz-Wysocka B. 1999 Serum interleukin-8 level is increased in diabetic patients (letter). Diabetologia. 42:117–118.[CrossRef][Medline]
  29. Johansen KM, Skorpe S, Olsen JO, Osterud B. 1999 The effect of red wine on the fibrinolytic system and the cellular activation reactions before and after exercise. Thromb Res. 96:355–363.[CrossRef][Medline]
  30. Yue TL, Mckenna PJ, Gu JL, Feuerstein GZ. 1993 Interleukin-8 is chemotactic for vascular smooth muscle cells. Eur J Pharmacol. 240:81–84.[CrossRef][Medline]
  31. Gerszten RE, Garcia-Zepeda EA, Lim YC, et al. 1999 MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Nature. 398:718–723.[CrossRef][Medline]
  32. De Benedetti F, Pignatti P, Bernasconi S, et al. 1999 Interleukin 8 and monocyte chemoattractant protein-1 in patients with juvenile rheumatoid arthritis. Relation to onset types, disease activity, and synovial fluid leukocytes. J Rheumatol. 26:425–431.[Medline]
  33. Romano M, Sironi M, Toniatti C, et al. 1997 Role of IL-6 and its soluble receptor in induction of chemokines and leukocyte recruitment. Immunity. 6:315–325.[CrossRef][Medline]
  34. Oh JW, Schwiebert LM, Benveniste EN. 1999 Cytokine regulation of CC and CXC chemokine expression by human astrocytes. J Neurovirol. 5:82–94.[Medline]
  35. Matsushima K, Baldwin ET, Mukaida N. 1992 Interleukin-8 and MCAF: novel leukocyte recruitment and activating cytokines. Chem Immunol. 51:236–265.[Medline]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
J. C. Strum, J. H. Johnson, J. Ward, H. Xie, J. Feild, A. Hester, A. Alford, and K. M. Waters
MicroRNA 132 Regulates Nutritional Stress-Induced Chemokine Production through Repression of SirT1
Mol. Endocrinol., November 1, 2009; 23(11): 1876 - 1884.
[Abstract] [Full Text] [PDF]


Home page
EuropaceHome page
V. Melenovsky and G. Y.H. Lip
Interleukin-8 and atrial fibrillation
Europace, July 1, 2008; 10(7): 784 - 785.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S.-A. Lee, A. Kallianpur, Y.-B. Xiang, W. Wen, Q. Cai, D. Liu, S. Fazio, M. F. Linton, W. Zheng, and X. O. Shu
Intra-individual Variation of Plasma Adipokine Levels and Utility of Single Measurement of These Biomarkers in Population-Based Studies
Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2464 - 2470.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
J. M Bruun, B. Stallknecht, J. W Helge, and B. Richelsen
Interleukin-18 in plasma and adipose tissue: effects of obesity, insulin resistance, and weight loss
Eur. J. Endocrinol., October 1, 2007; 157(4): 465 - 471.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Thalmann and C. A. Meier
Local adipose tissue depots as cardiovascular risk factors
Cardiovasc Res, September 1, 2007; 75(4): 690 - 701.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Skurk, C. Alberti-Huber, C. Herder, and H. Hauner
Relationship between Adipocyte Size and Adipokine Expression and Secretion
J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1023 - 1033.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
A. De Lorenzo, V. Del Gobbo, M. G. Premrov, M. Bigioni, F. Galvano, and L. Di Renzo
Normal-weight obese syndrome: early inflammation?
Am. J. Clinical Nutrition, January 1, 2007; 85(1): 40 - 45.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. N. Reeds, W. T. Cade, B. W. Patterson, W. G. Powderly, S. Klein, and K. E. Yarasheski
Whole-Body Proteolysis Rate Is Elevated in HIV-Associated Insulin Resistance.
Diabetes, October 1, 2006; 55(10): 2849 - 2855.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
F. Samad, K. D. Hester, G. Yang, Y. A. Hannun, and J. Bielawski
Altered Adipose and Plasma Sphingolipid Metabolism in Obesity: A Potential Mechanism for Cardiovascular and Metabolic Risk
Diabetes, September 1, 2006; 55(9): 2579 - 2587.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. R. Smith and P. W. F. Wilson
Free Fatty acids and atherosclerosis--guilty or innocent?
J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2506 - 2508.
[Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. M. Bruun, J. W. Helge, B. Richelsen, and B. Stallknecht
Diet and exercise reduce low-grade inflammation and macrophage infiltration in adipose tissue but not in skeletal muscle in severely obese subjects
Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E961 - E967.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. K. Paulsen, S. B. Pedersen, J. O. L. Jorgensen, S. Fisker, J. S. Christiansen, A. Flyvbjerg, and B. Richelsen
Growth Hormone (GH) Substitution in GH-Deficient Patients Inhibits 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Messenger Ribonucleic Acid Expression in Adipose Tissue
J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1093 - 1098.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
C. Herder, S. Muller-Scholze, P. Rating, W. Koenig, B. Thorand, B. Haastert, R. Holle, T. Illig, W. Rathmann, J. Seissler, et al.
Systemic monocyte chemoattractant protein-1 concentrations are independent of type 2 diabetes or parameters of obesity: results from the Cooperative Health Research in the Region of Augsburg Survey S4 (KORA S4)
Eur. J. Endocrinol., February 1, 2006; 154(2): 311 - 317.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. G. Romero, G. R. Vergara, Z. Zhu, G. S. Covington, M. W. Plonczynski, L. L. Yanes, E. P. Gomez-Sanchez, and C. E. Gomez-Sanchez
Interleukin-8 Synthesis, Regulation, and Steroidogenic Role in H295R Human Adrenocortical Cells
Endocrinology, February 1, 2006; 147(2): 891 - 898.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E. Henrichot, C. E. Juge-Aubry, A. Pernin, J.-C. Pache, V. Velebit, J.-M. Dayer, P. Meda, C. Chizzolini, and C. A. Meier
Production of Chemokines by Perivascular Adipose Tissue: A Role in the Pathogenesis of Atherosclerosis?
Arterioscler Thromb Vasc Biol, December 1, 2005; 25(12): 2594 - 2599.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Herder, B. Haastert, S. Muller-Scholze, W. Koenig, B. Thorand, R. Holle, H.-E. Wichmann, W. A. Scherbaum, S. Martin, and H. Kolb
Association of Systemic Chemokine Concentrations With Impaired Glucose Tolerance and Type 2 Diabetes: Results from the Cooperative Health Research in the Region of Augsburg Survey S4 (KORA S4)
Diabetes, December 1, 2005; 54(suppl_2): S11 - S17.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. Dietze-Schroeder, H. Sell, M. Uhlig, M. Koenen, and J. Eckel
Autocrine Action of Adiponectin on Human Fat Cells Prevents the Release of Insulin Resistance-Inducing Factors
Diabetes, July 1, 2005; 54(7): 2003 - 2011.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. M. Bruun, A. S. Lihn, S. B. Pedersen, and B. Richelsen
Monocyte Chemoattractant Protein-1 Release Is Higher in Visceral than Subcutaneous Human Adipose Tissue (AT): Implication of Macrophages Resident in the AT
J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2282 - 2289.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
M. Lappas, K. Yee, M. Permezel, and G. E. Rice
Sulfasalazine and BAY 11-7082 Interfere with the Nuclear Factor-{kappa}B and I{kappa}B Kinase Pathway to Regulate the Release of Proinflammatory Cytokines from Human Adipose Tissue and Skeletal Muscle in Vitro
Endocrinology, March 1, 2005; 146(3): 1491 - 1497.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Lappas, M. Permezel, and G. E. Rice
Release of Proinflammatory Cytokines and 8-Isoprostane from Placenta, Adipose Tissue, and Skeletal Muscle from Normal Pregnant Women and Women with Gestational Diabetes Mellitus
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5627 - 5633.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Skurk, V. van Harmelen, and H. Hauner
Angiotensin II Stimulates the Release of Interleukin-6 and Interleukin-8 From Cultured Human Adipocytes by Activation of NF-{kappa}B
Arterioscler Thromb Vasc Biol, July 1, 2004; 24(7): 1199 - 1203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. M. Brown, M. S. Boysen, S. Chung, O. Fabiyi, R. F. Morrison, S. Mandrup, and M. K. McIntosh
Conjugated Linoleic Acid Induces Human Adipocyte Delipidation: AUTOCRINE/PARACRINE REGULATION OF MEK/ERK SIGNALING BY ADIPOCYTOKINES
J. Biol. Chem., June 18, 2004; 279(25): 26735 - 26747.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. N. Fain, A. K. Madan, M. L. Hiler, P. Cheema, and S. W. Bahouth
Comparison of the Release of Adipokines by Adipose Tissue, Adipose Tissue Matrix, and Adipocytes from Visceral and Subcutaneous Abdominal Adipose Tissues of Obese Humans
Endocrinology, May 1, 2004; 145(5): 2273 - 2282.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. M. Bruun, A. S. Lihn, A. K. Madan, S. B. Pedersen, K. M. Schiott, J. N. Fain, and B. Richelsen
Higher production of IL-8 in visceral vs. subcutaneous adipose tissue. Implication of nonadipose cells in adipose tissue
Am J Physiol Endocrinol Metab, January 1, 2004; 286(1): E8 - E13.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. S. Lihn, B. Richelsen, S. B. Pedersen, S. B. Haugaard, G. S. Rathje, S. Madsbad, and O. Andersen
Increased expression of TNF-{alpha}, IL-6, and IL-8 in HALS: implications for reduced adiponectin expression and plasma levels
Am J Physiol Endocrinol Metab, November 1, 2003; 285(5): E1072 - E1080.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. M. Bruun, A. S. Lihn, C. Verdich, S. B. Pedersen, S. Toubro, A. Astrup, and B. Richelsen
Regulation of adiponectin by adipose tissue-derived cytokines: in vivo and in vitro investigations in humans
Am J Physiol Endocrinol Metab, September 1, 2003; 285(3): E527 - E533.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. A.Z. Loudon, C. L. Elliott, F. Hills, and P. R. Bennett
Progesterone Represses Interleukin-8 and Cyclo-Oxygenase-2 in Human Lower Segment Fibroblast Cells and Amnion Epithelial Cells
Biol Reprod, July 1, 2003; 69(1): 331 - 337.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Straczkowski, S. Dzienis-Straczkowska, A. Stepien, I. Kowalska, M. Szelachowska, and I. Kinalska
Plasma Interleukin-8 Concentrations Are Increased in Obese Subjects and Related to Fat Mass and Tumor Necrosis Factor-{alpha} System
J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4602 - 4606.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. Lyngso, L. Simonsen, and J. Bulow
Interleukin-6 production in human subcutaneous abdominal adipose tissue: the effect of exercise
J. Physiol., August 15, 2002; 543(1): 373 - 378.
[Abstract] [Full Text] [PDF]


Home page
British Journal of Diabetes & Vascular DiseaseHome page
C. Perry, N. Sattar, and J. Petrie
Review: Adipose tissue: passive sump or active pump?
The British Journal of Diabetes & Vascular Disease, November 1, 2001; 1(2): 110 - 114.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bruun, J. M.
Right arrow Articles by Richelsen, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals