| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Endocrinology and Metabolism C, Aarhus Amtssygehus, Aarhus University Hospital and Faculty of Health Sciences, Aarhus University, DK-8000 Aarhus C, Denmark
Address correspondence and requests for reprints to: Jens M. Bruun, M.D., Department of Endocrinology and Metabolism, Aarhus Amtssygehus, Tage Hansensgade 2, DK-8000 Aarhus C, Denmark. E-mail: jmb{at}mail-online.dk
| Abstract |
|---|
|
|
|---|
(0.6
nM) were able to stimulate IL-8 production by 12-fold and
5-fold, respectively (P < 0.001), when incubated
for 48 h. Incubations with isolated adipocytes were performed up
to 6 h, and IL-1ß and tumor necrosis factor
significantly
increased IL-8 production by 5060% (P < 0.05).
Dexamethasone (50 nM) decreased IL-8 production from
adipose tissue fragments by 57% (P < 0.01) and
from adipocytes by 37% (P < 0.05). IL-8 messenger
RNA expression in adipocytes incubated with IL-1ß was increased
already after 2 h (P < 0.05). Thus, the
effect of proinflammatory cytokines and dexamethasone on IL-8
production in adipose tissue seems to be mediated at the
transcriptional level. In conclusion, it is demonstrated for the first
time that IL-8 is produced and released from human adipose tissue and
from isolated adipocytes in vitro, which may indicate
that IL-8 from adipose tissue could be involved in some of the
obesity-related complications. | Introduction |
|---|
|
|
|---|
(TNF-
) and interleukin-6
(IL-6); Refs. 3 and 4 ] and prostaglandins
(5). It has been suggested that TNF-
may be involved in
the pathogenesis of the insulin resistance generally seen in
association with obesity. Rodent models have shown a 5- to 10-fold
elevated TNF-
messenger RNA (mRNA) in the adipose tissue from
genetically obese and insulin-resistant animals compared with lean
controls. When these obese animals were treated with a neutralizing,
recombinant, soluble TNF-
receptor, a significant improvement in the
peripheral glucose uptake was seen (6). Studies on human
adipose tissue have revealed a 2.5-fold higher expression of TNF-
mRNA in obese compared with lean subjects (7).
Furthermore, serum levels of TNF-
have also been found to be
elevated in obese compared with lean subjects and to be significantly
decreased after weight loss (8, 9). However, not all
studies have found that TNF-
is of importance for the
obesity-associated insulin resistance (10, 11, 12). Like
TNF-
, IL-6 is known to be involved in the regulation of insulin
signaling and lipid metabolism. IL-6 treatment in rats causes
hypertriglyceridemia by increasing the hepatic triglyceride secretion
as well as stimulates lipolysis (13). In humans, serum
levels of IL-6 are shown to be positively correlated with the degree of
obesity as assessed by body mass index (BMI; Ref. 14).
Fried et al. (15) have recently reported that
omental adipose tissue releases two to three times more IL-6 than sc
adipose tissue. One of the well known and important complications to obesity is atherosclerosis. Because it is generally recognized that atherosclerosis might have inflammation as a important part of its pathology, another cytokine-like substance, IL-8 has recently been suggested to contribute to atherogenesis through the following actions primarily reported from observations done in proximity to the initial preatherosclerotic lesion as well as in the advanced atherosclerotic plaque. Oxidized low-density lipoprotein, which is well described in the atherosclerotic process, stimulates the release of IL-8 from macrophages in the atherosclerotic lesion (16). IL-8 then acts as a local chemoattractant for neutrophils and T cells, induces adhesion of monocytes to the surface of the atherosclerotic lesion/plaque, and stimulates smooth muscle cell migration and proliferation, elements that all are reported to be part of the pathogenesis of atherosclerosis (17). Furthermore, IL-8 has been shown to decrease the specific tissue inhibitors of metalloproteinases and thereby increase the local release of matrix-degrading metalloproteinases, leading to instability of the advanced atherosclerotic plaque (18). IL-8 is a member of the CXC chemokine superfamily, which consists of small proteins of 7080 amino acids with four conserved cysteines forming two disulfide bonds, a short amino-terminal, and a longer carboxyl-terminal. The subfamilies are distinguished according to the arrangement of the first two cysteines, which are either separated by one amino acid (CXC chemokines) or adjacent (CC chemokines). The CXC chemokines primarily act as chemoattractants for neutrophils, whereas CC chemokines act on monocytes (19). IL-8 has, besides its implications for atherosclerosis, mostly been known for its association with different inflammatory processes (19, 20). Because the adipose tissue is able to produce and release various cytokines and IL-8 has been implicated in the atherosclerotic process, we found it of interest to investigate the ability of human adipose tissue and isolated adipocytes to express and release IL-8. In this study, it is shown for the first time that IL-8 is produced and released both from mature isolated adipocytes as well as from cultured adipose tissue fragments in a regulated manner.
| Materials and Methods |
|---|
|
|
|---|
For the adipose tissue fragment incubations, sc adipose tissue was obtained from the abdominal region from 10 healthy normal to overweight women undergoing liposuction at a plastic surgical clinic. The subjects had an age range of 3052 yr, a mean weight of 72.4 ± 2.9 kg, and a mean BMI of 25.6 ± 1.1 kg/m2 (range, 2228). All subjects were fasted overnight before tissue removal. The adipose tissue was mixed with isotonic NaCl and transported to the laboratory in a sterile container within 30 min after removal.
For the isolated adipocyte incubations, sc adipose tissue was removed from the abdominal region from six obese women [age range, 2642 yr; mean weight, 89.7 ± 14.6 kg; mean BMI, 28.8 ± 2.7 kg/m2 (range, 2841). The subjects were fasted overnight, and the adipose tissue was removed by a biopsy using sterile technique, performed at our laboratory as described previously (21). In brief, the skin was first anesthetized with lidocain (10 mg/mL) before a small incision was made. Then, 15 mL isotonic NaCl and 10 mL lidocain (10 mg/mL) was injected into the sc adipose tissue, and 1015 g tissue was removed by a needle, to which partial vacuum was applied. None of the subjects had any metabolic disorders or received any medication that influences adipose tissue metabolism. The study had been approved by the local ethic committee.
Whole adipose tissue cultures
The adipose tissue was placed in medium 199, and all subsequent procedures were carried out under a laminar airflow hood. The tissue was minced into fragments of less than 10 mg each and placed in organ culture, as described previously (22, 23). In brief, a total amount of about 500 mg adipose tissue fragments floated freely in 5 mL serum free medium 199 without phenol red in 50-mL plastic tubes. The plastic tubes containing the cultures were placed in a humidified incubator at 37 C and at an atmosphere of 5% CO2. Medium 199 was supplemented with 25 mM HEPES; 1% bovine albumin; 1 nM insulin, antipain, and leupeptin; 20 µl/100 mL medium; penicillin and streptomycin (10,000 IU); and 1 mL/100 mL medium. The adipose tissue was preincubated for 24 h. Hereafter, the medium was replaced and the indicated substances were added, and the incubation continued for the time indicated (maximum, 48 h). All incubations were performed in duplicate, and in the dose-response and time-course experiments each data point represented the mean of duplicate incubations from four individuals. The culture medium obtained from the different incubations was kept at -20 C until IL-8 was measured, and the adipose tissue was immediately frozen in liquid nitrogen and kept at -80 C for later RNA extraction.
Isolated adipocytes
Immediately after removal, the adipose tissue was quickly transported to the laboratory and washed several times in isotonic NaCl. The adipocytes were isolated by collagenase digestion (0.15 mg/g adipose tissue) of adipose tissue fragments in 10 mmol/L HEPES buffer for 4560 min at 37 C, as described previously (24). The isolated adipocytes were washed three times in buffer containing 5% albumin and were finally resuspended in medium 199 containing 1% BSA and 25 mM HEPES. Two hundred microliters of cell suspension containing 10% adipose cells were used, which corresponds to about 100,000 adipocytes being suspended in each tube. For each tested variable, the adipocytes were incubated with the indicated substances for up to 6 h and each data point represented the mean of duplicate incubations from six individuals.
IL-8 expression and measurements
RNA was isolated using Trizol reagents. The RT was made with random hexamer primers as described by the manufacturer (GeneAmp PCR kit; Perkin-Elmer Corp., Norwalk, CT). The PCR amplification was performed using Hot Start Taq DNA polymerase (5 U/µL). The IL-8 sense primer was TTGGCAGCCTTCCTGATTTC, and the antisense primer was AACTTCTCCACAACCCTCTG and spanned a product of 291 bp. ß-actin mRNA was amplified as a housekeeping marker, and a semiquantitative multiplex PCR method "primer-dropping" (23, 25) was used to monitor mRNA expression. Semiquantitative multiplex PCR estimates the relative amount of target mRNA to a known housekeeping gene (ß-actin) to control the sample variability. In the adipose tissue fragments, IL-8 complementary DNA was amplified for 10 cycles before ß-actin primers were added, after which the amplification was continued for the remaining 23 cycles. In the isolated adipocytes, IL-8 complementary DNA was amplified for nine cycles before ß-actin primers were added, and the amplification was continued for the remaining 27 cycles. The PCR products were loaded on a 3% agarose gel stained with ethidium bromide and analyzed using the Bio-Rad Gel Doc 1000 system (Bio-Rad Laboratories, Inc., Hercules, CA).
IL-8 was measured in the culture medium samples using a specific human enzyme-linked immunosorbent assay method (R&D Systems, Minneapolis, MN). The range of the standard curve in this assay was 31.22000 pg/mL, and the lower limit of detection was 10 pg/mL. The intra-assay coefficient of variation was 6.4 ± 1.1% (n = 12), and the interassay coefficient of variation was 7.9 ± 1.8% (n = 6). In the time course studies on adipose tissue fragments, test samples from the culture medium were diluted 1:200, 1:500, or 1:700 to measure the samples within the range of the standard curve. The test samples from the isolated adipocytes were not diluted.
Materials
Collagenase was obtained from Worthington Biochemical Corp. (Freehold, NJ); penicillin/streptomycin, medium 199, and Trizol were obtained from Life Technologies, Inc. (Roskilde, Denmark); PCR buffers and Hot Start Taq DNA polymerase were obtained from QIAGEN (Merck Kebolab, Albertsluno, Denmark); PCR buffer II GeneAmp, dNTP-mix GeneAmp, RT reverse transcriptase, and RNAse inhibitors were purchased from PE Biosystems (Norwalk, CT); random hexamer primers were obtained from Roche Diagnostics Biochemicals (Hvidovre, Denmark). All other chemicals and reagents were obtained from Sigma (St. Louis, MO).
Statistical analysis
The values are presented as means ± SEM. The
SPSS statistical packet (SPSS /8.0; SPSS, Inc., Chicago,
IL) was used for the calculations. For the comparison of data over
several time points (see Figs. 2
and 5
), a general linear model for
repeated measures with a post hoc Bonferroni test was used.
For comparison between the adipose tissue fragment incubations (Fig. 1
), an ANOVA with a Dunnetts test for
post hoc multiple comparison was used.
|
|
|
| Results |
|---|
|
|
|---|
Regulation of IL-8 production (Fig. 1
). In the following
experiments, adipose tissue fragments were incubated for 48 h with
various hormones and cytokines. The proinflammatory cytokines IL-1ß
(3 nM) and TNF-
(0.6 nM) both stimulated
IL-8 production significantly. IL-1ß and TNF-
increased IL-8
concentration in the medium 12-fold (P < 0.001) and
5-fold (P < 0.001), respectively (Fig. 1
). Dexamethasone (50
nM) was found significantly to decrease the
nonstimulated IL-8 production by 57% (7.2 ± 0.9
nM vs. 3.1 ± 0.4
nM, P < 0.05). IL-6 (2
nM) had a small stimulatory effect on IL-8
production (47% above control incubations; P = 0.069).
There were no significant differences in IL-8 concentration when
incubating with either GH (50 nM) or insulin (100
nM).
As described in Materials and Methods, the adipose
tissue fragments were preincubated for 24 h before the addition of
various hormones (t = 0). The time-course was performed for up to
48 h. IL-1ß at a concentration of 3 nM had
a significant stimulatory effect on IL-8 release, which was already
observed after 4 h (P < 0.05; Fig. 2
). After
incubation for 48 h, IL-1ß induced a 15-fold increase in IL-8
production (5.1 ± 0.6 nM vs.
74.3 ± 10.0 nM, P <
0.001). The concentration of IL-8 per hour of incubation in the basal,
nonstimulated situation was stable during the incubation period.
IL-8 mRNA expression was measured with PCR after incubation for 48 h. A 30% increment in IL-8 expression was found after IL-1ß stimulation as compared with control incubations (1.6 ± 0.2 vs. 2.1 ± 0.3 arbitrary units, P < 0.01; data not shown).
Dose-response studies for IL-1ß and TNF-
(Figs. 3
and 4
)
Both IL-1ß and TNF-
stimulated IL-8 production in a
dose-dependent manner (Fig. 3
). The half-maximal stimulatory
concentration (EC50) was obtained by IL-1ß at a
concentration of 6.5 ± 2.3 pM and by TNF-
at
15.9 ± 9.4 pM. The maximal stimulatory effect
(EMax) of IL-1ß was significantly higher than
that induced by TNF-
(36.7 ± 2.0 nM vs.
18.3 ± 2.2 nM, P <
0.05).
|
|
Isolated adipocytes
It is well known that the adipose tissue fragments contained both adipocytes as well as other cell types (e.g. stromal-endothelial cells) that are able to produce IL-8. Thus, to test whether adipocytes alone is able to produce IL-8, we investigated IL-8 production and IL-8 gene expression in incubations with isolated mature adipocytes. Isolated mature human adipocytes can only be incubated for relatively short periods as compared with whole adipose tissue fragments because of cell rupture, which can be detected directly by observing a layer of free triglyceride at the top of the incubation tubes. Accordingly, these incubations were only performed for up to 6 h.
It was found that IL-1ß (0.1 nM) was able to
significantly stimulate IL-8 production both after 4 and 6 h of
incubation with isolated adipocytes by 49% and 60%, respectively
(P < 0.05; Fig. 5A
).
TNF-
(0.6 nM) stimulated, after 6 h, the
release of IL-8 by 49% (85.0 ± 14.9 pM
vs. 126.7 ± 6.6 pM,
P < 0.05). During nonstimulated conditions,
dexamethasone (50 nM) decreased IL-8 production
by 37% (85.0 ± 14.9 pM vs.
53.5 ± 12.9 pM, P < 0.05;
Fig. 5A
).
At the mRNA level, the increase in IL-8 expression was found already
after 2 h of incubation with IL-1ß 0.1 nM
(P < 0.05). This increase in IL-8 mRNA expression was
sustained for 6 h (P < 0.001; Fig. 5B
).
Dexamethasone (50 nM) decreased IL-8 mRNA
expression by 33% (P < 0.05) after 4 h (Fig. 5B
).
| Discussion |
|---|
|
|
|---|
in a dose- and time-dependent manner, thus supporting findings
in other cell types, where IL-1ß and TNF-
have also been shown to
stimulate IL-8 production and release (26). The release of
IL-8 from adipose tissue fragments was significantly increased over
48 h when incubated with both IL-1ß and TNF-
. IL-8 production
and release were found to be inhibited in a time- and dose-dependent
manner by dexamethasone. These results are in agreement with other
studies, where the production of IL-8, but also several other cytokines
such as IL-1, IL-2, IL-4, IL-6 and TNF-
, were inhibited by
dexamethasone in different cell-types (27). The concentration of IL-8 that accumulates in the adipose tissue incubations after 48 h was up to 7.2 nM in the control situation and up to 83 nM when stimulated with IL-1ß (3 nM). At present, the concentration of IL-8 released from the adipose tissue in vivo is unknown. However, measurements of IL-8 levels in serum from healthy subjects have shown concentrations in the picomolar range (28, 29), and the results found in our in vitro experiments correlate well with IL-8 concentration demonstrated to elicit biological effects in other in vitro experiments [e.g. human aortic smooth cell migration (30) and monocyte arrest and firm adhesion to the vascular endothelium (31)].
Neither insulin nor GH was found to have any effect on the production and release of IL-8 from the adipose tissue fragments. It should, however, be mentioned that all incubations were performed in the presence 1 nM insulin, which may obscure a possible effect of insulin.
IL-6 was found to have a small but nonsignificant stimulatory effect on IL-8 production in adipose tissue. In other cell types it has been reported that IL-6 has a more pronounced stimulatory effect on IL-8 (32). Romano et al. (33) found an induction of the IL-8 expression in endothelial cells, using a IL-6-IL-6 receptor complex. However, Oh et al. (34) found no effect on IL-8 expression in human astrocytes and astroglioma cell lines, using a IL-6-IL-6 receptor complex.
In adipose tissue fragments as well as in isolated adipocytes a significant induction of IL-8 gene transcription was observed. Incubating isolated adipocytes with either IL-1ß or dexamethasone affected IL-8 mRNA expression significantly before a change in IL-8 protein levels could be observed, indicating that the effect of these substances on IL-8 production and secretion was at the transcriptional level. These findings were consistent with observations done in other tissues (35).
Several authors have implicated that the CXC chemokine IL-8, among
other things, is involved in the pathogenesis of atherosclerosis
through numerous different actions (e.g. leukocyte
recruitment, adhesion of monocytes to the endothelium, and vascular
smooth cell migration; Refs. 17 and 30). The
findings in this study could, therefore, suggest that the correlation
found between the severity of obesity and the development of
atherosclerosis and cardiovascular disease might be related to the
ability of human adipose tissue to produce and release IL-8, both in
the basal situation and when adequately stimulated (e.g.
with proinflammatory cytokines like TNF-
and IL-1ß). This
hypothesis of an association between obesity, IL-8, and cardiovascular
disease waits, however, to be substantiated by further
investigations.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received June 13, 2000.
Revised November 6, 2000.
Accepted November 13, 2000.
| References |
|---|
|
|
|---|
-induced insulin resistance [see comments]. Exp Clin
Endocrinol Diabetes. 107:119125.[Medline]
, in vivo. J Clin Endocrinol Metab. 82:41964200.
: direct role in
obesity-linked insulin resistance. Science. 259:8791.
in human obesity and insulin resistance. J
Clin Invest. 95:24092415.
are increased in obese
patients with noninsulin-dependent diabetes mellitus. J Clin
Endocrinol Metab. 83:859862.
in sera of obese
patients: fall with weight loss. J Clin Endocrinol Metab. 83:29072910.
antibody (CDP571) on
insulin sensitivity and glycemic control in patients with NIDDM. Diabetes. 45:881885.[Abstract]
receptor-deficient mice. J Clin Invest. 102:402411.[Medline]
is
not associated with whole body insulin resistance in obese nondiabetic
or in type-2 diabetic subjects. Eur J Clin Invest. 30:302310.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
J. C. Strum, J. H. Johnson, J. Ward, H. Xie, J. Feild, A. Hester, A. Alford, and K. M. Waters MicroRNA 132 Regulates Nutritional Stress-Induced Chemokine Production through Repression of SirT1 Mol. Endocrinol., November 1, 2009; 23(11): 1876 - 1884. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Melenovsky and G. Y.H. Lip Interleukin-8 and atrial fibrillation Europace, July 1, 2008; 10(7): 784 - 785. [Full Text] [PDF] |
||||
![]() |
S.-A. Lee, A. Kallianpur, Y.-B. Xiang, W. Wen, Q. Cai, D. Liu, S. Fazio, M. F. Linton, W. Zheng, and X. O. Shu Intra-individual Variation of Plasma Adipokine Levels and Utility of Single Measurement of These Biomarkers in Population-Based Studies Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2464 - 2470. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M Bruun, B. Stallknecht, J. W Helge, and B. Richelsen Interleukin-18 in plasma and adipose tissue: effects of obesity, insulin resistance, and weight loss Eur. J. Endocrinol., October 1, 2007; 157(4): 465 - 471. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Thalmann and C. A. Meier Local adipose tissue depots as cardiovascular risk factors Cardiovasc Res, September 1, 2007; 75(4): 690 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Skurk, C. Alberti-Huber, C. Herder, and H. Hauner Relationship between Adipocyte Size and Adipokine Expression and Secretion J. Clin. Endocrinol. Metab., March 1, 2007; 92(3): 1023 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. De Lorenzo, V. Del Gobbo, M. G. Premrov, M. Bigioni, F. Galvano, and L. Di Renzo Normal-weight obese syndrome: early inflammation? Am. J. Clinical Nutrition, January 1, 2007; 85(1): 40 - 45. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. N. Reeds, W. T. Cade, B. W. Patterson, W. G. Powderly, S. Klein, and K. E. Yarasheski Whole-Body Proteolysis Rate Is Elevated in HIV-Associated Insulin Resistance. Diabetes, October 1, 2006; 55(10): 2849 - 2855. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Samad, K. D. Hester, G. Yang, Y. A. Hannun, and J. Bielawski Altered Adipose and Plasma Sphingolipid Metabolism in Obesity: A Potential Mechanism for Cardiovascular and Metabolic Risk Diabetes, September 1, 2006; 55(9): 2579 - 2587. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Smith and P. W. F. Wilson Free Fatty acids and atherosclerosis--guilty or innocent? J. Clin. Endocrinol. Metab., July 1, 2006; 91(7): 2506 - 2508. [Full Text] [PDF] |
||||
![]() |
J. M. Bruun, J. W. Helge, B. Richelsen, and B. Stallknecht Diet and exercise reduce low-grade inflammation and macrophage infiltration in adipose tissue but not in skeletal muscle in severely obese subjects Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E961 - E967. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Paulsen, S. B. Pedersen, J. O. L. Jorgensen, S. Fisker, J. S. Christiansen, A. Flyvbjerg, and B. Richelsen Growth Hormone (GH) Substitution in GH-Deficient Patients Inhibits 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Messenger Ribonucleic Acid Expression in Adipose Tissue J. Clin. Endocrinol. Metab., March 1, 2006; 91(3): 1093 - 1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Herder, S. Muller-Scholze, P. Rating, W. Koenig, B. Thorand, B. Haastert, R. Holle, T. Illig, W. Rathmann, J. Seissler, et al. Systemic monocyte chemoattractant protein-1 concentrations are independent of type 2 diabetes or parameters of obesity: results from the Cooperative Health Research in the Region of Augsburg Survey S4 (KORA S4) Eur. J. Endocrinol., February 1, 2006; 154(2): 311 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Romero, G. R. Vergara, Z. Zhu, G. S. Covington, M. W. Plonczynski, L. L. Yanes, E. P. Gomez-Sanchez, and C. E. Gomez-Sanchez Interleukin-8 Synthesis, Regulation, and Steroidogenic Role in H295R Human Adrenocortical Cells Endocrinology, February 1, 2006; 147(2): 891 - 898. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Henrichot, C. E. Juge-Aubry, A. Pernin, J.-C. Pache, V. Velebit, J.-M. Dayer, P. Meda, C. Chizzolini, and C. A. Meier Production of Chemokines by Perivascular Adipose Tissue: A Role in the Pathogenesis of Atherosclerosis? Arterioscler Thromb Vasc Biol, December 1, 2005; 25(12): 2594 - 2599. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Herder, B. Haastert, S. Muller-Scholze, W. Koenig, B. Thorand, R. Holle, H.-E. Wichmann, W. A. Scherbaum, S. Martin, and H. Kolb Association of Systemic Chemokine Concentrations With Impaired Glucose Tolerance and Type 2 Diabetes: Results from the Cooperative Health Research in the Region of Augsburg Survey S4 (KORA S4) Diabetes, December 1, 2005; 54(suppl_2): S11 - S17. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dietze-Schroeder, H. Sell, M. Uhlig, M. Koenen, and J. Eckel Autocrine Action of Adiponectin on Human Fat Cells Prevents the Release of Insulin Resistance-Inducing Factors Diabetes, July 1, 2005; 54(7): 2003 - 2011. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Bruun, A. S. Lihn, S. B. Pedersen, and B. Richelsen Monocyte Chemoattractant Protein-1 Release Is Higher in Visceral than Subcutaneous Human Adipose Tissue (AT): Implication of Macrophages Resident in the AT J. Clin. Endocrinol. Metab., April 1, 2005; 90(4): 2282 - 2289. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lappas, K. Yee, M. Permezel, and G. E. Rice Sulfasalazine and BAY 11-7082 Interfere with the Nuclear Factor-{kappa}B and I{kappa}B Kinase Pathway to Regulate the Release of Proinflammatory Cytokines from Human Adipose Tissue and Skeletal Muscle in Vitro Endocrinology, March 1, 2005; 146(3): 1491 - 1497. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lappas, M. Permezel, and G. E. Rice Release of Proinflammatory Cytokines and 8-Isoprostane from Placenta, Adipose Tissue, and Skeletal Muscle from Normal Pregnant Women and Women with Gestational Diabetes Mellitus J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5627 - 5633. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Skurk, V. van Harmelen, and H. Hauner Angiotensin II Stimulates the Release of Interleukin-6 and Interleukin-8 From Cultured Human Adipocytes by Activation of NF-{kappa}B Arterioscler Thromb Vasc Biol, July 1, 2004; 24(7): 1199 - 1203. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Brown, M. S. Boysen, S. Chung, O. Fabiyi, R. F. Morrison, S. Mandrup, and M. K. McIntosh Conjugated Linoleic Acid Induces Human Adipocyte Delipidation: AUTOCRINE/PARACRINE REGULATION OF MEK/ERK SIGNALING BY ADIPOCYTOKINES J. Biol. Chem., June 18, 2004; 279(25): 26735 - 26747. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Fain, A. K. Madan, M. L. Hiler, P. Cheema, and S. W. Bahouth Comparison of the Release of Adipokines by Adipose Tissue, Adipose Tissue Matrix, and Adipocytes from Visceral and Subcutaneous Abdominal Adipose Tissues of Obese Humans Endocrinology, May 1, 2004; 145(5): 2273 - 2282. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Bruun, A. S. Lihn, A. K. Madan, S. B. Pedersen, K. M. Schiott, J. N. Fain, and B. Richelsen Higher production of IL-8 in visceral vs. subcutaneous adipose tissue. Implication of nonadipose cells in adipose tissue Am J Physiol Endocrinol Metab, January 1, 2004; 286(1): E8 - E13. [Abstract] [Full Text] |
||||
![]() |
A. S. Lihn, B. Richelsen, S. B. Pedersen, S. B. Haugaard, G. S. Rathje, S. Madsbad, and O. Andersen Increased expression of TNF-{alpha}, IL-6, and IL-8 in HALS: implications for reduced adiponectin expression and plasma levels Am J Physiol Endocrinol Metab, November 1, 2003; 285(5): E1072 - E1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Bruun, A. S. Lihn, C. Verdich, S. B. Pedersen, S. Toubro, A. Astrup, and B. Richelsen Regulation of adiponectin by adipose tissue-derived cytokines: in vivo and in vitro investigations in humans Am J Physiol Endocrinol Metab, September 1, 2003; 285(3): E527 - E533. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A.Z. Loudon, C. L. Elliott, F. Hills, and P. R. Bennett Progesterone Represses Interleukin-8 and Cyclo-Oxygenase-2 in Human Lower Segment Fibroblast Cells and Amnion Epithelial Cells Biol Reprod, July 1, 2003; 69(1): 331 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Straczkowski, S. Dzienis-Straczkowska, A. Stepien, I. Kowalska, M. Szelachowska, and I. Kinalska Plasma Interleukin-8 Concentrations Are Increased in Obese Subjects and Related to Fat Mass and Tumor Necrosis Factor-{alpha} System J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4602 - 4606. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lyngso, L. Simonsen, and J. Bulow Interleukin-6 production in human subcutaneous abdominal adipose tissue: the effect of exercise J. Physiol., August 15, 2002; 543(1): 373 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Perry, N. Sattar, and J. Petrie Review: Adipose tissue: passive sump or active pump? The British Journal of Diabetes & Vascular Disease, November 1, 2001; 1(2): 110 - 114. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |