| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Dihydrotestosterone Availability
Division of Endocrinology, Department of Pediatrics (A.L.M.B., S.L.S.D.), and Department of Pediatric Urology (R.C.N.), Sophia Children’s Hospital; Department of Endocrinology and Reproduction (A.L.M.B., A.O.B., M.C.T.V.-M., P.d.R.), Erasmus University Rotterdam; and Department of Clinical Genetics (A.L.M.B., M.F.N.), University Hospital Rotterdam, Rotterdam, The Netherlands
Address correspondence and requests for reprints to: Annemie L. M. Boehmer, M.D., Ph.D., Division of Endocrinology, Department of Pediatrics, Sophia Children’s Hospital, P.O. Box 2060, 3000 CB Rotterdam, The Netherlands. E-mail: a.Boehmer{at}JKZ-RKZ.nl
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Two 46,XY siblings with partial AIS sharing the same AR gene mutation,
R846H, but showing very different phenotypes are studied. Their parents
are first cousins. One sibling with grade 5 AIS was raised as a girl;
the other sibling with grade 3 AIS was raised as a boy. In both
siblings serum levels of hormones were measured; a sex hormone-binding
globulin (SHBG) suppression test was completed; and mutation analysis
of the AR gene, Scatchard, and SDS-PAGE analysis of the AR protein was
performed. Furthermore, 5
-reductase 2 expression and activity in
genital skin fibroblasts were investigated, and the 5-reductase 2
gene was sequenced.
The decrease in SHBG serum levels in a SHBG suppression test did
not suggest differences in androgen sensitivity as the cause of the
phenotypic variation. Also, androgen binding characteristics of the AR,
AR expression levels, and the phosphorylation pattern of the AR on
hormone binding were identical in both siblings. However,
5-reductase 2 activity was normal in genital skin fibroblasts from
the phenotypic male patient but undetectable in genital skin
fibroblasts from the phenotypic female patient. The lack of
5-reductase 2 activity was due to absent or reduced expression of
5-reductase 2 in genital skin fibroblasts from the phenotypic female
patient. Exon and flanking intron sequences of the 5-reductase 2
gene showed no mutations in either sibling. Additional intragenic
polymorphic marker analysis gave no evidence for different inherited
alleles for the 5-reductase 2 gene in the two siblings. Therefore,
the absent or reduced expression of 5-reductase 2 is likely to be
additional to the AIS.
Distinct phenotypic variation in this family was caused by
5-reductase 2 deficiency, additional to AIS. This 5-reductase
deficiency is due to absence of expression of the 5-reductase
iso-enzyme 2 as shown by molecular studies. The distinct phenotypic
variation in AIS here is explained by differences in the availability
of 5-dihydrotestosterone during embryonic sex differentiation.
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The AR is a transcription factor that binds either testosterone (T) or
5-dihydrotestosterone (DHT); however, DHT is bound with higher
affinity and has a slower dissociation rate from the receptor than T
(3, 4, 5). When androgen is bound to the AR, the complex
dimerizes and migrates into the nucleus where it recruits transcription
factors and binds to the promoter region of androgen-sensitive target
genes (6).
With the advent of molecular analysis of the AR gene it was hoped that a correlation between a molecular defect and a particular phenotype could be established. Such a relationship would enable prediction of the response to androgen therapy in infants with PAIS, relevant for not only long-term psychosexual outcome but also for genetic counseling of parents and other identified female carrier relatives. Ten years after cloning of the AR gene (7, 8, 9, 10), it is obvious that there is no simple genotype-phenotype relationship in this phenotypically and genotypically heterogeneous syndrome. Identified mutations are associated with different phenotypes in the same kindred (11, 12, 13, 14) or rarely with CAIS in one kindred and with PAIS in another (2). Therefore, additional factors apparently may influence the effect of the mutant receptor on the development of the external genitalia.
Reduced 5-reductase 2 activity has been described in the 70s and 80s
in AIS families and has been suggested to be the cause of the observed
phenotypic variation (15, 16, 17). At that time, molecular
evaluation of the AR and 5-reductase 2 genes was not yet
available.
Here, a family with distinct phenotypes in two siblings with the same AR gene mutation is reported. The identified mutation in the AR gene, R846H (amino acid numbering based on 20 glutamine residues and 16 glycine residues, thus a total of 910 amino acids) is a frequently identified mutation (2). Experimental evidence is provided for a different availability of DHT in these two siblings.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
). The parents (subjects
I-1 and I-2; Fig. 1) were of Moroccan descent and first cousins: their
fathers were brothers. There was no family history of ambiguous
genitalia.
|
), and a shallow (2.5 cm in
length), blindly ending vagina that was connected with the urogenital
sinus. Testes were localized bilaterally in the inguinal region. The
following serum levels of hormones were determined: T, 13.5 nmol/L
(range in normal males, 10–30 nmol/L); DHT, 1.55 nmol/L; T/DHT,
8.7 (normal males, <10); estradiol, 35 pmol/L (normal males,
50–200 pmol/L); and LH, 5.7 U/L (normal males, 1.5–8 U/L). In
accordance with her personal wish, she was not gonadectomized until 2
yr later, at age 15.5 yr. Normally developed epididymides and vasa
deferentia were found. Müllerian duct derivatives were absent.
Serum hormone levels at that time were: T, 31.5 nmol/L; DHT, 2.42
nmol/L; T/DHT, 13; estradiol, 156 pmol/L; and LH, 8.4 U/L. Her voice
had remained high-pitched, the clitoral size remained normal, pubic
hair had remained Tanner stage P2, axillary hair was still absent, and
her breasts had grown to M4. T and DHT, measured every 6 months from
age 13.5 yr, showed T/DHT ratios between 8.6 and 13.0. From age 14, T
had been above 30 nmol/L.
|
), karyotype 46,XY, was born with perineoscrotal
hypospadias, a micropenis with well developed corpora cavernosa, a
bifid scrotum containing testes, and transposition of the scrotum (Fig. 2B). Müllerian duct remnants were absent, as was established by
ultrasound. Bilaterally epididymides were palpable. Serum hormone
levels measured at age 4 days: T, 0.64 nmol/L. Seventy-two hours after
1500 U human CG (hCG) im, T was 18 nmol/L. He was assigned the male
sex. At 5 yr of age his basal serum levels were: LH, 0.1 U/L; T, 0.1
nmol/L; and DHT, <0.1 nmol/L. Seventy-two hours after 1500 U hCG im:
T, 11.8 nmol/L; DHT, 2.1 nmol/L; T/DHT, 5.6. All values are within the
normal range for this age. I-1 and II-3 were normally virilized healthy adult males. II-6 was a normal healthy prepubertal boy with a normal penis length and a normal testis volume for his age. The mother, subject I-2, had a gonadal/somatic mosaïcism for the AR mutation as was shown by segregation analysis of the different AR alleles among affected and nonaffected family members and by allele-specific oligonucleotide analysis, respectively, as described previously (18).
The medical ethical committee of the University Hospital Rotterdam approved the protocol of this study.
SHBG suppression test
Androgen sensitivity in the liver can be measured in vivo with use of an SHBG suppression test. We have used the protocol described by Sinnecker et al. (19): Stanozolol (0.2 mg/kg/day, single evening dose) was administered orally at days 0, 1, and 2. Blood samples were taken before and at days 5, 6, 7, and 8 after the start of the test. The initial SHBG serum level was compared with the lowest level obtained after administration of Stanozolol (days 5, 6, 7, and 8) and expressed as a percentage of the initial value. In normal controls the SHBG serum level after Stanozolol declined to 35.6–62.1% (range) of the initial value. However, in patients with CAIS, the SHBG serum level remained unchanged, and in PAIS patients the SHBG level declined to 48.6–89.1% (range) of the initial value (19).
AR gene mutation detection
Genomic DNA was isolated from peripheral blood leukocytes and from cultured genital skin fibroblasts, following standard procedures (20).
Exon and flanking intron sequences were screened for mutations in the AR gene with the use of PCR-single-strand conformational polymorphism (21). PCR fragments suspected to harbor mutations were analyzed by direct sequencing (22). Furthermore, in DNA isolated from genital skin fibroblasts, the entire AR gene of subject II-5 was sequenced.
AR gene CAGn(CAA)/GGN repeat length
CAGn(CAA) and GGN repeat lengths in exon 1 of the AR gene, encoding poly-glutamine and poly-glycine stretches, respectively, were determined as described previously (21, 22).
Cell culture
Skin biopsies were taken either during surgical correction of
the external genitalia, or gonadectomy or circumcision. Genital skin
fibroblasts were derived from biopsies of the fusion line of the labia
minora of subject II-5 of control individuals, and from scrotal skin of
subject II-8 and from preputium of a normal prepubertal boy obtained at
circumcision. Furthermore, genital skin fibroblasts were analyzed from
biopsies from preputium of a prepubertal 5-reductase 2-deficient
patient with clitoromegaly and posterior fusion of the labia minora.
This patient had a T/DHT ratio after hCG of 16.5. All cell lines were
cultured as described previously (22), with modifications
as described with the experiments.
Androgen characteristics of the AR
Whole cell Scatchard analysis was performed on genital skin fibroblasts, as described previously (22). Genital skin fibroblast (GSF) 1 was used from subject II-5.
SDS-PAGE of the AR
Confluent cell layers in 150 cm2 culture flasks, were cultured in serum-free medium for 24 h, followed by 24 h in medium containing increasing concentrations (0, 5, 30, and 100 nM) of the synthetic, nonmetabolizable androgen methyltrienolone (R1881). GSF 1 was used from subject II-5. Whole cell lysates were prepared, immunoprecipitated, separated on a SDS-PAGE gel, and immunostained as described previously (22).
5-Reductase 2 assay
5-Reductase 2 activity can be influenced by either clonal
origin of the cell line (23) or by the site of origin of
the biopsies (24). Therefore, two different GSF cell lines
from subject II-5 (GSF 1 and 2) derived from separate biopsies taken
1.5 yr apart were used for the studies.
GSF cell lines derived from biopsies from subject II-8, from a normal
male, from a normal female, and from a 5-reductase 2-deficient
patient homozygous for a known pathogenic mutation in the
5-reductase 2 gene (H231R) were used as controls.
Because 5-reductase 2 activity increases with serial subcultures
(25, 26), all cell lines used were the seventh
subculture.
To reduce possible bias by confluency rate, all cell lines were grown
in 75-cm2 culture flasks with medium containing
10% FCS. They were harvested 7 days after subculture. At that time,
the cell lines were confluent and the flasks contained 
1.2 x
106 cells.
Harvesting of cells. Cells were washed multiple times with PBS and with 20 mM Tris saline (pH 7.4), then scraped in Tris saline and pelleted at 800 x g. Pellets were washed twice in Tris saline. Cell-free extracts were prepared by four cycles of freezing in liquid nitrogen and thawing.
Enzyme assay. Forty microliters of cell-free extracts were incubated with 10 µl of 30 mM NADPH and 50 µl reaction mixture [reaction mixture consisted of 500 µl of 10 mM Tris citrate (pH 5.5), 2.4 pmol 1,2,6,7 3H-testosterone (Amersham Pharmacia Biotech, Little Chalfont, UK), and 7.6 pmol testosterone (Steraloids)] at 37 C for 1 h. The reaction was stopped on ice. Each incubation was done in duplicate. Assays were done in triplicate.
To all samples 10 µl of a steroid mixture containing androstanedione,
androstenedione, DHT, testosterone, 3-androstanediol, each 1 mg/mL
ethanol, were added, before extraction of radioactivity with a total of
3 x 500 µL ethylacetate. Extracts were evaporated to dryness,
and the residues were dissolved in 50 µl ethanol and chromatographed
in dichloromethane:ethylacetate:methanol (85:15:3) on a 0.25-mm layer
silica gel plate, 20 x 20 cm (Merck, Darmstadt, Germany).
Steroids were visualized in a control lane by spraying with 20%
H2SO4 in methanol and
developing at 100 C for 15 min. Fractions were collected in separate
vials, resuspended in 500 µl ethanol, and were counted in a liquid
scintillator counter. 5-Reductase activity was calculated from the
sum of 3H-radioactivity in the
androstanediol, DHT, and 3 androstanediol fractions divided through
the sum of 3H radioactivity in the
androstanediol, androstenediol, DHT, T, and 3 androstanediol
fractions. The amount of protein in each cell-free extract was
determined according to Bradford (27).
5-Reductase activity was expressed as femtomoles of 5 reduced
steroids formed per milligram of protein per hour.
Analysis of the 5-reductase 2 gene and polymorphic marker
analysis
Exon and flanking intron sequences of the 5-reductase type 2
gene (SRD5A2) from subject II-5 were analyzed with direct sequencing
after amplification of fragments with primers described by Hiort
et al. (27). As an intragenic polymorphic
marker, codon 89 in exon 1 of the SRD5A2 gene was used. This codon is
either CTA or GTA with unknown allele frequencies
(29, 30). Genomic DNA isolated from GSF 1 (subject II-5)
and GSF (subject II-8) was used.
RT-PCR of 5-reductase 2 messenger RNA (mRNA)
Total RNA was extracted from GSF cell lines using Trizol reagent (Life Technologies, Inc., Breda, The Netherlands) and quantified by absorption at 260 nm. Complementary DNA (cDNA) was synthesized from 2.5 µg RNA with the use of an oligo dT primer (Promega Corp., Madison, WI). Of each investigated cell line, cell pellets from different cell culture flasks were pooled and divided in equal aliquots. RNA was isolated from these aliquots in separate experiments. The various aliquots of RNA were subjected to several independent RT-PCR experiments.
As a control for cDNA synthesis, ß 10 actin was used. ß Actin was
amplified with antisense primer GAGGTAGCAGGTGGCGTTTACGAAGAT and sense
primer AAGGATTCCTATGTGGGCGACGAG. Primers used for amplification of the
5-reductase 2 gene were: antisense primer 5B,
5'-TGACAGTTTTCATCAGCATTG-3' specific for 3' untranslated sequences in
exon 5; and sense primer 120A, 5'-CACTGGAAATGGAGTCCTTC-3', starting at
codon 120 in exon 2. These primers were used in a PCR reaction as
described below.
Three microliters of the obtained cDNA reaction product was used in a
50-µl PCR amplification reaction. The 50-µL PCR reaction mix
contained 1.5 mM MgCl2. Conditions
for the PCR reactions in a Biometra cycle sequencer were: hot start at
94 C for 5 min, then 35 cycles at 94 C for 1 min, at 55 C for 30 sec,
at 72 C for 1 min, and final extension for 10 min at 72 C. The PCR
product was visualized after electrophoresis on a 2% agarose gel that
contained ethidium bromide. Amplification of genomic DNA was prevented
because intervening introns were in total 7.3 kb in size, and
the Amplitaq polymerase (Perkin-Elmer Corp., Norwalk, CT) cannot amplify DNA of this size under the used
conditions.
The resulting PCR product was subcloned into a plasmid using the TOPO TA cloning kit (Invitrogen, San Diego, CA) and subjected to automated sequencing.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
An SHBG suppression test (19) showed a maximal decrease in SHBG of 73.5% on days 5, 6, 7, and 8 in the female patient, subject II-5 [normal males, <63.4%; PAIS, 63.4–93%; CAIS, >92% (31)], whereas a maximal decrease of 92% on day 7 was seen in subject II-8. It can be concluded that both siblings display a suppression in the PAIS range.
Mutation detection and identification in the AR gene
With PCR-single-strand conformational polymorphism, followed by direct sequencing of the AR gene, mutation R846H in the ligand-binding domain of the AR was identified in both individuals II-5 and II-8. No other mutations were identified on sequencing of the exon and flanking intron sequences of the AR gene of subject II-5.
Length of (CAG)nCAA and GGN repeats
In both siblings the (CAG)nCAA and GGN repeats in exon 1 of the AR gene mutant-allele carried 14 glutamine and 24 glycine residues (18), respectively.
AR binding characteristics
AR binding characteristics in GSF of subjects II-5 and II-8 (Table 1) show an increased equilibrium
dissociation constant (Kd) but a normal number of
binding sites (Bmax). The difference in
Bmax and Kd values between
the two siblings should be interpreted as a variance of Scatchard
analysis.
|
AR protein isolated from wild-type cells cultured in the absence
of androgens migrates as a doublet of 110 and 112 kDa during SDS-PAGE.
These represent an unphosphorylated AR isotype and a phosphorylated AR
isotype, respectively. On binding of androgens, the AR undergoes
additional phosphorylation, resulting in a third isoform of 114 kDa. AR
mutants that are either partially defective in ligand binding or in DNA
binding or in transcription activation, migrate with a reduced amount
of the 114 kDa isoform during SDS-PAGE (Ref. 31 ; Fig. 3). At a relatively low androgen
concentration of 5 nM R1881, GSFs of II-5 and II-8 express
equally reduced amounts of the third isoform of 114 kDa compared with
the wild type. Increased androgen levels did not induce the 114-kDa
band as in the wild-type cells (Fig. 3). Moreover, both siblings have
an equally deficient hormone induced upshift of the 114 kDa AR isoform.
A deficient hormone induced upshift is in agreement with the increased
dissociation of the AR hormone complex in GSF of both patients.
|
-Reductase 2 activity
Of subject II-5, two different GSF cell lines were deficient in
5-reductase 2, similar as in a 5-reductase 2-deficient patient
homozygous for SRD5A2 mutation H231R. However, sibling II-8 had normal
5-reductase 2 activity in GSF (Table 2).
|
-reductase 2 gene and polymorphic marker
analysis
No mutations were found in the 5-reductase type 2 gene of
subjects II-5 and II-8 on sequencing exon and flanking intron
sequences.
Both siblings were heterozygous for a known polymorphism in exon 1 of
the 5-reductase 2 gene, CTA/GTA, codon 89
(data not shown). A homozygous defect in the 5-reductase 2 gene,
inherited from the consanguineous parents and present in other parts of
the gene than the sequenced parts such as introns or in a gene
promoter, is, therefore, very unlikely.
5-Reductase 2 mRNA expression
After RT-PCR of 5-reductase 2 mRNA using a primer combination,
as outlined in Subjects and Methods, a 460-bp fragment can
be expected. No 5-reductase 2 cDNA was detectable after RT-PCR of
total RNA preparations from GSFs 1 and 2 of subject II-5, whereas in
total RNA preparations from the GSF of subject II-8 a band of 460-bp
was detected (Fig. 4). This band was
subcloned and sequenced and exhibited the wild-type 5-reductase 2
gene sequence. Therefore, the absence of 5-reductase type 2 activity
in GSFs of subject II-5 is most likely due to lack of or reduced
expression of 5-reductase type 2.
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
5-Reductase activity was found to be totally absent in genital skin
fibroblasts of subject II-5 (Table 2). DHT, formed in the embryonal
urogenital tissues by 5-reductase 2, causes elongation and
enlargement of the urogenital tubercle and fusion of the urogenital
swellings and folds during the development of the embryo (32, 33). We hypothezised that the phenotypic differences between the
siblings might be due to the difference in availability of DHT,
especially because both siblings carry a particular mutant AR (R846H).
When this R846H mutant AR is stimulated with DHT instead of
testosterone, the transcriptional deficit becomes less (34, 35) and the functional defect can even be partially corrected by
the repeated addition of DHT (34). Therefore, a difference
in availability of DHT between the two siblings could have been of
particular influence on the phenotype.
Although, serum dihydrotestosterone levels at puberty in subject II-5
are low but detectable and once fell within the low normal range,
similar DHT serum levels are found in pubertal/adult 5-reductase
2-deficient patients with deficient 5-reductase 2 activity as
established in GSFs (16, 36). When 5-reductase
2-deficient patients enter puberty they start to synthesize some DHT.
The source of this DHT may be either peripheral conversion by
5-reductase type 1 in the liver and skin or, in some cases, residual
activity of the mutant enzyme.
A 5-reductase 2 deficiency secondary to the primary defect AIS has
been reported to cause phenotypic differences in other families with
AIS and was established by 5-reductase 2 assays in GSFs and by
hormonal analysis in serum (15, 16, 17). It has been suggested
that in AIS patients 5-reductase 2 enzyme activity is preserved in
the liver but deficient in the periphery, in contrast to the autosomal
recessive inherited syndrome of 5-reductase 2 deficiency wherein a
generalized severe defect of both hepatic and peripheral 5-reductase
is found (16, 37). These observations were made before
cloning of the AR and 5-reductase 2 genes (7, 10, 29, 38). The nature of the decreased 5-reductase 2 activity
remained unidentified. The repeated observation of this 5-reductase
2 deficiency secondary to AIS and the identification of a mutant AR,
which is especially dependent on DHT for residual androgen action,
provides a basis for further studies on secondary 5-reductase 2
deficiency.
RT-PCR experiments in this family show that the 5 10 reductase 2
deficiency in GSFs of subject II-5 is due to reduced expression of the
5-reductase 2 gene (SRD5A2). A homozygous defect in the SRD5A2 gene
inherited from the consanguineous parents was excluded as no mutations
in the SRD5A2 gene were found in both siblings. The presence of
mutations in the remaining intronic sequences or the promoter region of
the SRD5A2 gene is very unlikely because both siblings are
heterozygotes for the CTA/GTA polymorphism in
exon 1.
With molecular means we show that the additional 5-reductase 2
deficiency in the presented subject II-5 with AIS is due to absent or
reduced expression of the 5-reductase 2 enzyme.
The etiology of this additional 5-reductase 2 deficiency is not
clear. One possible explanation is disruption of a feed forward control
mechanism: formation of trace amounts of DHT that are bound to the AR
induces 5-reductase 2 activity thereby increasing DHT synthesis and
triggering a positive developmental cascade. Such a positive feedback
mechanism exists in the rat embryonic urogenital tract where
5-reductase type 2 expression is increased by either T or DHT
(39). A positive feedback mechanism is also present in
adult rat prostate but is absent in embryonic rat prostate (39, 40). In humans, the presence of such a positive regulation by
androgens is suggested by the presence of reduced 5-reductase 2
expression in urogenital swellings and tubercles in female fetuses. The
expression of 5-reductase 2 in female fetuses is one third of the
expression of 5-reductase 2 found in males, who have higher levels
of androgens (36). Arguments against positive regulation
of 5-reductase 2 enzyme activity in humans are the observations that
in many CAIS patients 5-reductase 2 activity is normal and during
in vitro culture of GSFs no increase of 5-reductase
activity is observed after stimulation with androgen (24, 41, 42). In GSFs, 5-reductase 2 is the predominantly expressed
and active iso-enzyme (43).
Others have suggested a unbalance between estrogen and androgen action
as the cause for secondary 5-reductase deficiency (16, 24).
An interesting possibility is an additional autosomal recessively
inherited defect in a factor regulating 5-reductase 2 expression,
inherited from the consanguineous parents by subject II-5. Because
5-reductase 2 expression appears in fetal rats before testicular
androgen synthesis starts, it was suggested that the early regulation
and most likely the initial induction events are androgen independent
in rat (38). Which factors control the temporal and cell
type-specific pattern of 5-reductase enzymes in the rat or in man is
presently unknown.
These observations support the hypothesis that differences in the
availability of DHT in different target tissues could lead to
phenotypic variation between AIS patients who carry the same AR gene
mutation. This study shows that distinct intrafamilial phenotypic
variation can be associated with additional 5-reductase 2
deficiency, information to be implemented in genetic counseling of
families with androgen insensitivity.
Additional 5-reductase 2 deficiency was shown to be associated with
undetectable 5-reductase 2 mRNA levels in GSFs. The total lack of
enzyme activity is unlikely to be due to mutations in the
5-reductase 2 gene itself. Possible causes for this additional
5-reductase 2 deficiency are a defective autocatalyic regulation or
an autosomal recessively inherited defect in a regulatory protein that
controls the cell type-specific and temporal expression pattern of the
5-reductase 2 gene.
Received December 2, 1999.
Revised July 31, 2000.
Revised November 2, 2000.
Accepted November 5, 2000.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
-reductase
deficiency. J Steroid Biochem. 11:1385–1392.[CrossRef][Medline]
His) in the hormone-binding domain of
the androgen receptor leads to incomplete androgen insensitivity
syndrome associated with a thermolabile androgen receptor. Eur J
Endocrinol. 130:569–574.-reductase deficiency and three patients with the complete form of
testicular feminization. J Clin Endocrinol Metab. 49:861–865.-reductase deficiency. J Clin Endocrinol Metab. 54:931–941.-reductase
deficiency: identification of a novel qualitative androgen receptor
defect and clinical implications. J Clin Endocrinol Metab. 59:679–688.-reductase activity in cloned human skin
fibroblasts. Shift in phenotypic expression from high to low activity
upon subcloning. J Biol Chem. 256:3662–3666.-reductase activity of genital and nongenital skin
fibroblasts from patients with 5-reductase deficiency, androgen
insensitivity, or unknown forms of male pseudohermaphroditism. Am
J Med Genet. 1:407–416.[CrossRef][Medline]
- androstan-3-one in normal skin fibroblast
cultures: influence of origin and passage number. J Clin
Endocrinol Metab. 48:924–930. reductase activity of skin fibroblasts.
Increase with serial subcultures. Mol Cell Endocrinol. 17:41–50.[CrossRef][Medline]
-reductase type 2 gene for the diagnosis of 5 -reductase
deficiency. J Clin Endocrinol Metab. 81:3415–3418.[Abstract]
-reductase 2 gene in male
pseudohermaphroditism. Nature. 354:159–161.[CrossRef][Medline]
-reductase gene. Endocrinology. 131:1571–1573.-reductase isozyme expression. J Clin Invest. 92:903–910.
-reductase 2 deficiency. Endocr Rev. 14:577–593.-reductase. Proc Natl Acad
Sci USA. 88:8044–8047.-reductase in the urogenital tract of the
fetal rat. Mol Endocrinol. 9:1561–1570.-reductase activity in pubic skin fibroblasts. J Clin
Endocrinol Metab. 56:320–325.-reductase type 1 in pubic skin from
normal subjects and hirsute patients. J Clin Endocrinol Metab. 81:1989–1993.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  B. Kohler, S. Lumbroso, J. Leger, F. Audran, E. S. Grau, F. Kurtz, G. Pinto, M. Salerno, T. Semitcheva, P. Czernichow, et al. Androgen Insensitivity Syndrome: Somatic Mosaicism of the Androgen Receptor in Seven Families and Consequences for Sex Assignment and Genetic Counseling J. Clin. Endocrinol. Metab., January 1, 2005; 90(1): 106 - 111. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
