The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 2 834-840
Copyright © 2001 by The Endocrine Society
Construction of Gene Therapy Vectors Targeting Thyroid Cells: Enhancement of Activity and Specificity with Histone Deacetylase Inhibitors and Agents Modulating the Cyclic Adenosine 3',5'-Monophosphate Pathway and Demonstration of Activity in Follicular and Anaplastic Thyroid Carcinoma Cells
Masaki Kitazono,
Yutaka Chuman,
Takashi Aikou and
Tito Fojo
Medicine Branch, DCS, National Cancer Institute, National
Institutes of Health (M.K., T.F.), Bethesda, Maryland 20892; and First
Department of Surgery, Faculty of Medicine, Kagoshima University (Y.C.,
T.A.), Sakuragaoka 8-35-1, Kagoshima 890-8520, Japan
Address all correspondence and requests for reprints to: Dr. Masaki Kitazono, First Department of Surgery, Faculty of Medicine, Kagoshima University, Sakuragaoka 8-35-1, Kagoshima 890-8520, Japan. E-mail:
kita{at}box-k.nih.gov
 |
Abstract
|
|---|
Thyroid carcinoma accounts for the majority of deaths from endocrine
cancers. Although effective therapies exist for well differentiated
tumors, the treatment options for poorly differentiated and anaplastic
tumors are much less effective. In the present study we demonstrate
that the thyroglobulin (Tg) promoter can be used to direct specific
expression of either luciferase or thymidine kinase in thyroid cancer
cells. Furthermore, using a putative enhancer element for the Tg gene,
the activity of the Tg promoter in and its specificity for thyroid
cells were enhanced. In transient transfectants or in stably
transfected thyroid carcinoma cells, treatment with the histone
deacetylase inhibitors, depsipeptide (FR9012228) and sodium butyrate,
alone or in combination with 8-bromo-cAMP, resulted in further
enhancement. In experiments in which the herpes simplex virus thymidine
kinase (HSV-TK) gene was driven by the Tg promoter and the putative
enhancer, HSV-TK expression and ganciclovir sensitivity were augmented.
Similar results were obtained in two cell lines derived from a
follicular thyroid carcinoma and in two anaplastic thyroid carcinoma
cell lines. In summary, we report the construction of a suicide HSV-TK
vector with preferential toxicity for thyroid cells. The results in
anaplastic thyroid carcinoma cells suggest that it may be of use in the
full spectrum of thyroid malignancies.
 |
Introduction
|
|---|
THYROID CARCINOMA is the most common
endocrine malignancy, accounting for the majority of deaths from
endocrine cancers (1). Each year in the United States,
approximately 14,000 new cases of thyroid carcinoma are diagnosed, and
1,200 patients die from this disease (2). Conventional
therapy consists of surgical resection and radioiodine
(131I) therapy (3, 4). However, for
poorly differentiated thyroid carcinomas as well as anaplastic
carcinomas, which do not concentrate iodine, 131I
therapy is ineffective (1, 5). In these patients the
therapeutic options are few and largely unsuccessful. Palliative or
debulking surgery, external radiation, and chemotherapy have all been
tried, with limited success (6, 7, 8, 9, 10, 11). Among experimental
options, restoration of iodine trapping has been pursued, without
convincing efficacy (12, 13, 14, 15, 16).
Suicide gene therapy strategies exploit genes that are expressed
preferentially or exclusively in tumors to target therapy. Endocrine
cancers as a group and thyroid cancers in particular possess numerous
genes whose expression is very restricted or specific. For thyrocytes
and well differentiated thyroid cancers, specific genes include
thyroglobulin (Tg), the
Na+/I- symporter (NIS),
thyroid peroxidase, iodothyronine 5'-deiodinase, and the TSH receptor.
Braiden et al. showed the usefulness of Tg promoters as a
transcriptionally targeted gene therapy (17). The present
studies were designed to enhance the activity of a thyroid-specific Tg
promoter in transcriptionally targeted gene therapy.
 |
Materials and Methods
|
|---|
Cell lines and culture conditions
We used a total of nine cell lines: two follicular thyroid
carcinomas (FTC 133 and FTC 236), two anaplastic thyroid carcinomas
(KAT-4 and SW-1736), an adrenocortical carcinoma (H295)
(18), a colon carcinoma (SW620), a renal cell carcinoma
(A498), a breast carcinoma (MCF7), and a hepatocarcinoma (HepG2). FTC
133 and FTC 236 were derived from cultures obtained from the primary
tumor (FTC 133) and a nodal metastasis (FTC 236) of a follicular
thyroid carcinoma. The anaplastic thyroid carcinoma cell lines were
derived from primary cultures of human anaplastic thyroid carcinoma
tumors. SW-1736 was developed by Drs. Leibowitz and McCombs III at the
Scott and White Memorial Hospital (Temple, TX) in 1977 and was provided
by Nils-Erik Heldin (Uppsala University, Uppsala, Sweden). KAT-4 was
developed and maintained in the laboratory of Kenneth Ain (University
of Kentucky). FTC236, FTC133, KAT-4, SW-1736, and SW620 were maintained
in RPMI 1640 with glutamine medium supplemented with 10% FCS at 37 C
in a 5% CO2 incubator. H295 cells were
maintained in RPMI, with the addition of HEPES, ITS (insulin,
transferrin, selenium), and 2% serum. A498, MCF7, and HepG2 cells were
maintained in Iscoves MEM supplemented with 10% serum. Although the
serum used may contain TSH or TSH-like activity, we observed that
adding supplemental TSH had no effect on the growth rate or plating
efficiency of these cell lines.
RT-PCR
Total ribonucleic acid (RNA) was extracted using RNA STAT-60
(Tel-Test, Friendswood, TX). RT-PCR was performed as
previously described (19). The primers used for
amplification of endogenous Tg gene were: Tg 5' (sense),
5354GAAATCGTCGTCTTCTCCAC5374;
and Tg 3' (antisense),
5565CTGTCAGCACAGTGGCAATA5584.
RNA from a normal thyroid was amplified in every experiment and
included in every gel. Thus, in every experiment the reaction
conditions were internally controlled, and in every gel a reference
standard was included.
Construction of reporter plasmids
The promoter of the Tg gene was isolated using the PCR and DNA
from FTC 236 cells. Primers used were: 5' (sense),
-500GAGCTCTAAGAGGTTGTTAGAG-479;
and 3' (antisense),
+40TTTCCTGGCCCTTCCTGGGAGGAA+17.
The amplified fragment was subcloned into the pCRII TA vector
(Invitrogen, San Diego, CA), and its sequence was
confirmed. After digestion with KpnI and XhoI,
the 540-bp promoter fragment was ligated to the pGL3-B luciferase
vector (Promega Corp., Madison, WI). This construct was
designated Tg promoter-Luc. In addition, the herpes simplex virus
thymidine kinase (HSV-TK) minimum promoter was excised by digesting
pRL-TK (Promega Corp.) with HindIII and
BglII; this was subcloned into pGL3-B and designated TK-Luc.
TK-Luc was used as the positive control.
The enhancer element of the Tg gene was amplified using the PCR
and the following primers: 5' (sense),
CGGGGTACC-2698GTTCTCACGAGCTCAGTGGAG-2677;
and 3' (antisense),
CGGACTAGT-2172CCCATTGCCCTAAAATGCATGC-2193.
KpnI (sense) and SpeI (antisense) restriction
sites flanked the Tg enhancer sequence. The amplified fragment was
inserted into the Tg promoter-Luc plasmid-digested with KpnI
and SpeI. This construct was designated Tg
enhancer/promoter-Luc.
To construct Tg enhancer/promoter-TK, we isolated the TK gene by
digesting pGL3-TK containing the coding region of the HSV-TK gene with
XhoI and XbaI. The TK-coding region was then
inserted into Tg enhancer/promoter-Luc that had been digested
with XhoI and XbaI to release the luciferase
gene. This construct was designated Tg enhancer/promoter-TK. In
addition, to generate a construct that could be used to establish
stable transfectants, the Tg enhancer/promoter-TK-coding region was
subcloned into pcDNA3.1 The total sequence of the cytomegalovirus
promoter was removed by using MluI and
HindIII. This construct was designated Tg
enhancer/promoter-TK-Neo. Finally, the HSV-TK minimum promoter was
excised by digesting pRL-TK (Promega Corp.) with
HindIII and BglII; this was subcloned into pGL3-B
and designated TK-TK. The vectors used in this study are shown in Fig. 1
.

View larger version (40K):
[in this window]
[in a new window]
|
Figure 1. Schema showing vectors used in this study.
Neo, Neomycin resistance gene; Tg, thyroglobulin; TR, thymidine kinase.
|
|
Transfections and luciferase assays
Transient transfections used a liposome-mediated method. Because
of their slow growth rate, 2 x 105 H295
cells were plated in each well of a 24-well plate 2 days before
transfection; for all other cell lines, 34 x
104 cells were plated 24 h before
transfection. Plasmid DNA (0.5 µg) and 4.5 µL TransFast
(Promega Corp.) mixed with 200 µL medium were added to
each well. After incubating for 1 h in the above mixtures, cells
were cultured in the presence or absence of various agents for 2 days.
The agents used and their concentrations were as follows: 1) 0.3 mmol/L
8-bromo-cAMP (8-Br-cAMP), 2) 20 µmol/L forskolin, 3) 1.2 mmol/L
phenylbutyrate, 4) 2 mmol/L sodium butyrate, and 5) 1 ng/mL
depsipeptide (FR901228). After harvesting, the total protein
concentration was measured by protein assay (Bio-Rad Laboratories, Inc., Richmond, CA). Firefly luciferase activity
was assessed using the Luciferase Assay System (Promega Corp.) and was normalized to protein. All transfections were
performed in triplicate. In all experiments TK-Luc and pGL3-B were used
as positive and negative controls, respectively. The result with the
TK-Luc vector was assigned a value of 100%, and all other values were
expressed relative to this as relative luciferase units.
Stable transfection of thyroid cancer cells with the Tg
enhancer/promoter-TK-Neo vector employed TransFast. After 3 weeks in
medium containing 300 µg/mL G418, stable transfectants were
isolated.
Immunoblot analysis
Stable transfectants were scraped into cell lysis buffer
containing 10 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 1% Nonidet P-40,
1 mmol/L ethylenediamine tetraacetate, 20 µg/mL aprotinin, and 100
µg protein was separated on a 10% SDS-PAGE gel. Electroblotting to
Immobilon P transfer membrane (Millipore Corp., Bedford,
MA) was performed, and nonspecific protein binding was blocked using
10% milk in TNE buffer [2 mmol/L Tris (pH 7.4), 2 mmol/L NaCl, 1
mmol/L ethylenediamine tetraacetate, and 0.15% Tween-20] for 1
h. The membrane was incubated for 1 h with a rabbit polyclonal
antibody for HSV-TK (provided by Dr. William C. Summers, Yale
University, New Haven, CT), diluted 1:1000 in 5% milk, and 0.02%
sodium azide in TNE. After washing, antirabbit Ig horseradish
peroxidase-linked secondary antibody (Amersham Pharmacia Biotech, Arlington Heights, IL) was added for 1 h. After
washing, the membrane was developed in ECL Western blotting detection
reagents (Amersham Pharmacia Biotech).
Cell killing assay
The 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium
bromide assay was performed to determine sensitivity to
ganciclovir (GCV). Cells maintained in a
25-cm2 flask with or without the various agents
for 2 days, seeded in 96-well plates (6000 cells/well), and incubated
in various concentrations of GCV for 5 days. Cell survival was
calculated as the percentage of untreated cells.
 |
Results
|
|---|
Preliminary studies demonstrated that the Tg promoter could direct
expression of a luciferase gene preferentially in thyroid cancer cells,
but the level of activity was deemed insufficient. As shown in Fig. 2
, the endogenous levels of Tg were very
low or undetectable in all four cell lines (PCR products detected in
FTC 133 and FTC 236 are not clearly visualized in the photograph).
However, the knowledge that expression of Tg is a property of
differentiated thyrocytes provided the rationale for including a
variety of differentiating agents in the experimental design. The goal
was to improve the specificity and activity of the constructs. As a
first step, we examined the effects of five different agents on the
expression of the endogenous Tg gene. Two cell lines were used: FTC 236
and SW-1736. As shown in Fig. 2
, 8-Br-cAMP, forskolin, and
phenylbutyrate had no effect on the endogenous levels of Tg messenger
RNA. However, treatment with either depsipeptide or sodium butyrate,
two histone deacetylase inhibitors, resulted in a marked increase
in Tg expression.
Figure 3
shows the luciferase activity in
the four thyroid carcinoma cell lines after transient transfection with
either control TK-Luc or the Tg promoter-Luc construct. Luciferase
activity in untreated cells was compared with that in cells treated
with the five agents evaluated in Fig. 2
. For all cell lines, the
luciferase activity of TK-Luc in untreated cells was assigned a value
of 100%, and all luciferase activities are expressed relative to this.
The induction of luciferase activity correlates well with the effects
on the endogenous gene. In agreement with their lack of effect on the
expression of the endogenous gene, neither 8-Br-cAMP, forskolin, nor
phenylbutyrate had any substantial effect on luciferase activity.
In contrast, both depsipeptide and sodium butyrate significantly
augmented luciferase activity in all four cell lines, just as they had
increased the expression of the endogenous Tg gene. The augmentation
achieved with either depsipeptide or sodium butyrate was somewhat more
pronounced in the two anaplastic cell lines (SW-1736 and KAT-4), in
part because their basal level of expression was lower, possibly
reflecting their more undifferentiated phenotype.

View larger version (43K):
[in this window]
[in a new window]
|
Figure 3. Luciferase activity in four thyroid
carcinoma cell lines after transient transfection with either control
TK-Luc or the Tg promoter-Luc construct. Luciferase activity in
untreated cells was compared with that in cells treated with the five
agents (conditions described in Materials and Methods).
For all cell lines, the luciferase activity of TK-Luc in untreated
cells was assigned a value of 100%, and all luciferase activities are
expressed relative to this. The induction of luciferase activity
correlates well with the effects on the endogenous gene shown in Fig. 2 .
|
|
These results indicated that the promoter activity of both the
endogenous gene and the Tg promoter construct could be modulated.
However, we sought to develop a construct with a higher specific
activity. To achieve this, a second construct was prepared by cloning a
putative enhancer element for the Tg gene (19). Once
isolated, it was placed proximal to the Tg promoter, generating a
construct designated Tg enhancer/promoter-Luc. Figure 4
shows the results obtained after
transient transfection of nine different cell lines. The cell lines
used in this experiment include the four thyroid carcinoma cell lines
and five cell lines not of thyroid origin. As with the experiments
described above, luciferase activity was measured after transient
transfections. As in Fig. 3
, for all cell lines the luciferase activity
of TK-Luc in untreated cells was assigned a value of 100%, and all
luciferase activities are expressed relative to this. The basal
activity of this construct was somewhat higher than that of the Tg
promoter-Luc construct, a fact obscured by the marked differences in
the y-axis between Figs. 4
and 3
. For the four thyroid cell
lines, the basal activity for the Tg promoter-Luc vs. the Tg
enhancer/promoter-Luc construct (with TK-Luc = 100%) were as
follows: SW-1736, 14.8% vs. 28.6%; KAT-4, 15.1%
vs. 32.4%; FTC 133, 32.6% vs. 58.5%; and FTC
236, 34.8% vs. 84.5%. The more striking differences were
observed when luciferase activities were measured after treatment with
depsipeptide, sodium butyrate, or either of these agents in combination
with 8-Br-cAMP. Both depsipeptide and sodium butyrate significantly
enhanced the basal activity, and this enhancement was further augmented
by the addition of 8-Br-cAMP. This augmentation was not unexpected, as
the putative enhancer element alone has been previously shown to be
modulated by forskolin and to contain cAMP-like elements
(20). As with the Tg promoter-Luc construct, higher levels
were achieved in the more differentiated cell lines (FTC 133 and FTC
236) than the anaplastic cells (SW-1736 and KAT-4). Furthermore, the
increases were not explained by differences among the vectors in
transfection efficiencies. In FTC133 and SW-1736, cotransfection of the
lacZ gene with the Tg promoter-Luc or Tg
enhancer/promoter-Luc did not demonstrate significant differences in
transfection efficiency (FTC133, 17.0% vs. 13.3%; SW-1736,
25.3% vs. 26.7%) Finally, these studies demonstrated the
specificity of the Tg enhancer/promoter-Luc construct, as evidenced by
the low to undetectable activity seen in the five cell lines that were
not of thyroid origin. Thus, addition of the putative Tg enhancer
increased the activity and specificity. The enhanced basal activity and
the augmentation by depsipeptide, sodium butyrate, and 8-Br-cAMP in the
thyroid carcinoma cells compared with the other cell lines indicated
that this construct had a relatively high thyroid cell specificity.

View larger version (19K):
[in this window]
[in a new window]
|
Figure 4. Luciferase activity in nine carcinoma cell
lines after transient transfection with either control TK-Luc or the Tg
enhancer/promoter-Luc construct. The following cell lines were used:
MCF7 (breast), HepG2 (hepatocarcinoma), H295 (adrenocortical), A498
(renal cell), SW620 (colon), SW-1736 and KAT-4 (anaplastic thyroid),
and FTC 133 and FTC 236 (follicular thyroid). As in Fig. 3 , for all
cell lines the luciferase activity of TK-Luc in untreated cells was
assigned a value of 100%, and all luciferase activities are expressed
relative to this.
|
|
As the eventual goal of these studies is to develop a strategy for the
treatment of thyroid cancer in humans, we wanted to examine whether the
Tg enhancer/promoter fragment could drive expression of a HSV-TK gene
for use in GCV-induced suicide. To do this, the Tg enhancer/promoter
sequence was cloned upstream of the HSV-TK gene in an expression
vector, and its effects were compared with those of two control
vectors: pGL3-TK as a negative control, and TK-TK as a positive
control. The latter vector contains the TK gene under the control of
the TK promoter, a promoter with activity in all of the cell lines
used. Figure 5
shows the results of GCV
sensitivity after transient transfections. In the nine cell lines
examined, previous studies have found transfection efficiencies of
1020%, so that cell killing was probably achieved via a bystander
effect (transfection efficiency data not shown). In the four thyroid
carcinoma cell lines, no significant cytotoxicity was observed with the
pGL-3 negative control. IC50 values of more than
1000 ng/mL were observed with pGL-3, similar to those with GCV alone
(GCV alone data not shown). Some sensitization was observed when cells
were transfected with the TK-TK construct. Greater sensitization was
observed with the Tg enhancer/promoter-TK vector. In agreement with the
results obtained with the luciferase construct, treatment with either
depsipeptide or sodium butyrate with 8-Br-cAMP resulted in even greater
cytotoxicity. As with the luciferase studies the greatest effect was
observed with depsipeptide plus 8-Br-cAMP in combination. With this
latter combination, sensitization of as much as 100,000-fold could be
achieved, and the maximum effect was most pronounced in the follicular
carcinoma cell lines. For comparison, in the four thyroid carcinoma
cell lines, cytotoxicity in stable transfectants is shown. The
construct used to establish the stable transfectants contains a
neomycin resistance gene. The stable transfectants were obtained by
exposing cells to increasing concentrations of G418. As all or nearly
all stably transfected cells contain the TK gene under the control of
the Tg enhancer/promoter, somewhat greater cytotoxicity is observed
compared with transiently transfected cells. Finally, in contrast to
the results obtained with the thyroid carcinoma cell lines, no
enhancement of GCV toxicity was observed with the Tg enhancer/promoter
construct in the cell lines not of thyroid origin. Enhanced toxicity
was not even observed after treatment with depsipeptide and 8-Br-cAMP.
Only with the TK-TK construct was enhanced toxicity found. The similar
degrees of enhancement observed with the TK-TK construct in the nine
cell lines is indirect evidence of comparable, albeit not identical,
transfection efficiencies.

View larger version (32K):
[in this window]
[in a new window]
|
Figure 5. GCV sensitivity after transient
transfections in nine human carcinoma cell lines. The sensitivity of
stable transfectants is also shown for each of the thyroid carcinoma
cell lines. The cell lines used are the same as those in Fig. 4 .
|
|
Evidence that treatment with depsipeptide or sodium butyrate enhances
GCV toxicity at least in part by increasing TK levels is shown in Fig. 6
. In this experiment stable
transfectants were isolated from four thyroid cancer cell lines after
transfection with the Tg enhancer/promoter-TK-Neo construct. As
expected, expression of HSV-TK protein could not be detected in
untransfected parental cells. In contrast, expression could be detected
in the Tg enhancer/promoter-TK-Neo stable transfectants. Furthermore,
expression of HSV-TK protein could be induced by the agents shown to
mediate luciferase expression and GCV cytotoxicity (see Figs. 4
and 5
).
Thus, the Tg enhancer/promoter fragment was able to induce expression
of HSV-TK (Fig. 6
), and this, in turn, could be used to modulate GCV
sensitivity (Fig. 5
).

View larger version (38K):
[in this window]
[in a new window]
|
Figure 6. Immunoblot for TK protein. Stable
transfectants isolated from FTC 236 and SW-1736 cells after
transfection with the Tg enhancer/promoter-TK construct were left
untreated or were treated with the agents described in the figure
(conditions described in Materials and Methods).
Untransfected refers to parental cells.
|
|
 |
Discussion
|
|---|
The present study examines potential alternate strategies for the
treatment of thyroid cancer. Although surgical resection and
radioiodine therapy have been shown to be effective in the therapy of
well differentiated thyroid cancers, alternate strategies are needed
for patients with poorly differentiated and anaplastic thyroid cancers.
We reasoned that a promoter and putative enhancer from a gene expressed
specifically in thyroid cells would provide an ideal candidate for a
gene therapy strategy. We also surmised that differentiating agents
could modulate the expression of thyroid-specific genes and of
constructs using promoters from these genes. Our results demonstrate
that the Tg promoter and a putative Tg enhancer can direct the
expression of luciferase and thymidine kinase in cells of thyroid
origin with high specificity. The activity and specificity can be
further enhanced by treating cells with the histone deacetylase
inhibitors, depsipeptide or sodium butyrate, and with 8-Br-cAMP.
To successfully develop a cancer-specific gene therapy, two
requirements must be satisfied: 1) tissue specificity, and 2)
sufficient activity to allow therapeutic benefit. The first
requirement, specificity, can be achieved if the promoter used
restricts expression of the therapeutic gene to tumor cells. To achieve
specificity, the Tg promoter appears to be an ideal candidate for
thyroid cancer. With the exception of a recent study demonstrating very
low levels of expression in the normal kidney (21),
previous studies have demonstrated Tg expression exclusively in normal
thyroid tissue and in a majority of thyroid cancers (22).
Furthermore, as demonstrated in the present study, Tg expression can be
modulated in cells of thyroid origin, including anaplastic thyroid
cells, with depsipeptide or sodium butyrate, two histone deacetylase
inhibitors. Luciferase activity and GCV sensitivity were demonstrated
in four thyroid carcinoma cells, without significant luciferase
activity or GCV sensitivity in five carcinoma cell lines derived from
tissues other than the thyroid, including the renal carcinoma cell
line, A498. Taken together, these results suggest that the Tg
enhancer/promoter may be valuable as a thyroid-specific construct in a
suicide gene therapy strategy. The second requirement, the need for
sufficient expression, is essential for successful therapy and impacts
the issue of specificity. The level of expression of the Tg promoter in
thyroid carcinoma cells was about 2035% that of the HSV-TK promoter
in the absence of other agents and was 6085% after treatment with
either sodium butyrate or depsipeptide. Some reports indicate that
HSV-TK activity and GCV sensitivity may not be directly correlated to
the activity of the promoter driving the HSV-TK gene (23, 24). However, we believe that the activity of the Tg promoter
alone would not be sufficient. To augment the activity of this
construct we introduced a putative Tg enhancer proximal to the Tg
promoter. With this construct, higher levels of activity were achieved
without sacrificing specificity. The augmentation achieved by
introducing the putative enhancer was most pronounced after
depsipeptide or sodium butyrate treatment, alone or in combination with
8-Br-cAMP, as shown by luciferase activity. This drug-mediated
enhancement was not found in the nonthyroid cell lines. Consistent with
the results of the luciferase assay, transient transfection of the four
thyroid cell lines resulted in much higher sensitivity to GCV, and this
sensitivity was augmented further by treatment with depsipeptide or
sodium butyrate alone or in combination with 8-Br-cAMP. Enhancement in
sensitivity of as much as 100,000-fold was achieved despite low
transfection efficiencies, emphasizing the magnitude of this effect.
Even greater sensitization may be possible under optional conditions,
as shown by the results with the stable transfectants. As with all gene
therapy strategies, in vivo toxicities will need to be assessed in
preclinical models. Although low levels of expression in normal kidney
cells, which do not divide, will probably not result in significant
toxicity, attention will be directed to this tissue.
Unlike other tumor-targeted strategies that exploit the expression of
genes acquired during malignant transformation, Tg expression is a
differentiated function. Tumor dedifferentiation is expected to result
in lower expression of Tg and other thyroid markers such as
5'-deiodinase, thyroid peroxidase, the TSH receptor, and NIS. Indeed,
the inability of poorly differentiated and anaplastic thyroid cancers
to trap iodine is thought to be a consequence of a loss of NIS
expression. Differentiating agents might up-regulate their
transcription. To be sure, the choice of differentiating agent will be
important. Our results suggest that histone deacetylase inhibitors may
be effective. Histone deacetylase inhibitors have emerged as
interesting chemotherapeutic agents, because they affect histone
acetylation and, in turn, gene transcription. Numerous studies have
demonstrated that histone deacetylases are components of many
transcription complexes. The two histone deacetylase inhibitors used in
the present study have been tried in patients. Although sodium butyrate
is difficult to administer, phase I trials with depsipeptide have found
it to be well tolerated, and the levels achieved greatly exceed those
used in the present study (our unpublished observations).
In conclusion, we report the construction of a suicide vector with
preferential toxicity in thyroid cells. Using the promoter of the Tg
gene and a putative enhancer, a construct with high activity and
specificity for thyroid cells was constructed. Luciferase and TK
expression as well as GCV sensitivity were enhanced by treatment with
the histone deacetylase inhibitors, depsipeptide and sodium butyrate,
alone or in combination with 8-Br-cAMP. Current efforts are directed at
generating a recombinant adenovirus containing the HSV-TK gene under
the control of the Tg enhancer/promoter sequences.
Received July 19, 2000.
Revised October 24, 2000.
Accepted October 27, 2000.
 |
References
|
|---|
-
Robbins J, Merino MJ, Boice Jr JD, et al. 1991 Thyroid cancer: a lethal endocrine neoplasm. Ann Intern Med. 115:133147.
-
Fraker DL, Skarulis M, LiVolsi V.. 1997 Thyroid
tumors. In: DeVita Jr VT, Hellman S, Rosenberg SA, eds. Cancer:
principles and practice of oncology, 5th Ed. Phildadelphia:
Lippincott-Raven; 16291652.
-
Solomon BL, Wartofsky L, Burman KD. 1996 Current
trends in the management of well differentiated papillary thyroid
carcinoma. J Clin Endocrinol Metab. 81:333339.[Abstract]
-
Singer PA, Cooper DS, Daniels GH, et al. 1996 Treatment guidelines for patients with thyroid nodules and
well-differentiated thyroid cancer. American Thyroid Association. Arch
Intern Med. 156:21652172.[Abstract]
-
DeGroot LJ. 1994 Long-term impact of initial and
surgical therapy on papillary and follicular thyroid cancer. Am J
Med. 97:499500.[CrossRef][Medline]
-
Niederle B, Roka R, Schemper M, Fritsch A, Weissel M,
Ramach W. 1986 Surgical treatment of distant metastases in
differentiated thyroid cancer:indication and results. Surgery. 100:10881097.[Medline]
-
Tubiana M, Haddad E, Schlumberger M, Hill C, Rougier P,
Sarrazin D. 1985 External radiotherapy in thyroid cancers. Cancer. 55:20622071.[CrossRef][Medline]
-
Shimaoka K, Schoenfeld DA, DeWys WD, Creech RH, DeConti
R. 1985 A randomized trial of doxorubicin versus doxorubicin plus
cisplatin in patients with advanced thyroid carcinoma. Cancer. 56:21552160.[CrossRef][Medline]
-
Williams SD, Birch R, Einhorn LH. 1986 Phase II
evaluation of doxorubicin plus cisplatin in advanced thyroid cancer: a
Southeastern Cancer Study Group Trial. Cancer Treat Rep. 70:405407.[Medline]
-
Ain KB, Tofiq S, Taylor KD. 1996 Antineoplastic
activity of taxol against human anaplastic thyroid carcinoma cell lines
in vitro and in vivo. J Clin Endocrinol
Metab. 81:36503653.[Abstract]
-
Kim JH, Leeper RD. 1983 Treatment of anaplastic
giant and spindle cell carcinoma of the thyroid gland with combination
adriamycin and radiation therapy. A new approach. Cancer. 52:954957.[CrossRef][Medline]
-
Schmutzler C, Brtko J, Bienert K, Kohrle J. 1996 Effects of retinoids and role of retinoic acid receptors in human
thyroid carcinomas and cell lines derived therefrom. Exp Clin
Endocrinol Diabetes. 104(Suppl 4):1619.
-
Simon D, Kohrle J, Schmutzler C, Mainz K, Reiners C,
Roher HD. 1996 Redifferentiation therapy of differentiated thyroid
carcinoma with retinoic acid: basics and first clinical results. Exp
Clin Endocrinol Diabetes. 104(Suppl 4):1315.
-
Borner AR, Simon D, Muller-Gartner HW. 1997 Isotretinoin in metastatic thyroid cancer. Ann Intern Med. 127:246.[Free Full Text]
-
Schmutzler C, Winzer R, Meissner-Weigl J, Kohrle J. 1997 Retinoic acid increases sodium/iodide symporter mRNA levels in
human thyroid cancer cell lines and suppresses expression of functional
symporter in nontransformed FRTL-5 rat thyroid cells. Biochem Biophys
Res Commun. 240:832838.[CrossRef][Medline]
-
Schreck R, Schnieders F, Schmutzler C, Kohrle J. 1994 Retinoids stimulate type I iodothyronine 5'-deiodinase activity in
human follicular thyroid carcinoma cell lines. J Clin Endocrinol
Metab. 79:791798.[Abstract]
-
Braiden V, Nagayama Y, Iitaka M, Namba H, Niwa M,
Yamashita S. 1998 Retrovirus-mediated suicide gene/prodrug therapy
targeting thyroid carcinoma using a thyroid-specific promoter. Endocrinology. 139:39963999.[Abstract/Free Full Text]
-
Gazdar AF, Oie HK, Shackleton CH, et al. 1990 Establishment and characterization of a human adrenocortical carcinoma
cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res. 50:54885496.[Abstract/Free Full Text]
-
Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE. 1990 Use of the polymerase chain reaction in the quantitation of mdr-1
gene expression. Biochemistry. 29:1035110356.[CrossRef][Medline]
-
Berg V, Vassart G, Christophe D. 1996 Identification of a thyroid-specific and cAMP-responsive enhancer in
the upstream sequences of the human thyroglobulin promoter. Biochim
Biophys Acta. 1307:3538.[Medline]
-
Sellitti DF, Akamizu T, Doi SQ, Kim GH, Kariyil JT,
Kopchik JJ, Koshiyama. 2000 Renal expression of two
Thyroid-Specific genes: thyrotropin receptor and thyroglobulin. Exp
Nephrol. 8:235243.
-
Brabant G, Maenhaut C, Kohrle J, et al. 1991 Human
thyrotropin receptor gene: expression in thyroid tumors and correlation
to markers of thyroid differentiation and dedifferentiation. Mol Cell
Endocrinol. 82:R7R12.
-
Elshami AA, Cook JW, Amin KM, et al. 1997 The
effect of promoter strength in adenoviral vectors containing herpes
simplex virus thymidine kinase on cancer gene therapy in vitro and in
vivo. Cancer Gene Ther. 4:213221.[Medline]
-
Vandier D, Rixe O, Brenner M, Gouyette A, Besnard
F. 1998 Selective killing of glioma cell lines using an
astrocyte-specific expression of the herpes simplex virus-thymidine
kinase gene. Cancer Res. 58:45774580.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
C. Puppin, F. D'Aurizio, A. V. D'Elia, L. Cesaratto, G. Tell, D. Russo, S. Filetti, E. Ferretti, E. Tosi, T. Mattei, et al.
Effects of Histone Acetylation on Sodium Iodide Symporter Promoter and Expression of Thyroid-Specific Transcription Factors
Endocrinology,
September 1, 2005;
146(9):
3967 - 3974.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Furuya, H. Shimura, H. Suzuki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi
Histone Deacetylase Inhibitors Restore Radioiodide Uptake and Retention in Poorly Differentiated and Anaplastic Thyroid Cancer Cells by Expression of the Sodium/Iodide Symporter Thyroperoxidase and Thyroglobulin
Endocrinology,
June 1, 2004;
145(6):
2865 - 2875.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Barzon, M. Boscaro, and G. Palu
Endocrine Aspects of Cancer Gene Therapy
Endocr. Rev.,
February 1, 2004;
25(1):
1 - 44.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takeda, H. Inaba, M. Yamazaki, S. Kyo, T. Miyamoto, S. Suzuki, T. Ehara, T. Kakizawa, M. Hara, L. J. DeGroot, et al.
Tumor-Specific Gene Therapy for Undifferentiated Thyroid Carcinoma Utilizing the Telomerase Reverse Transcriptase Promoter
J. Clin. Endocrinol. Metab.,
August 1, 2003;
88(8):
3531 - 3538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Barzon, R. Bonaguro, I. Castagliuolo, M. Chilosi, E. Gnatta, C. Parolin, M. Boscaro, and G. Palu
Transcriptionally Targeted Retroviral Vector for Combined Suicide and Immunomodulating Gene Therapy of Thyroid Cancer
J. Clin. Endocrinol. Metab.,
November 1, 2002;
87(11):
5304 - 5311.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kitazono, M. E. Goldsmith, T. Aikou, S. Bates, and T. Fojo
Enhanced Adenovirus Transgene Expression in Malignant Cells Treated with the Histone Deacetylase Inhibitor FR901228
Cancer Res.,
September 1, 2001;
61(17):
6328 - 6330.
[Abstract]
[Full Text]
[PDF]
|
 |
|