| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Medicine Branch, DCS, National Cancer Institute, National Institutes of Health (M.K., T.F.), Bethesda, Maryland 20892; and First Department of Surgery, Faculty of Medicine, Kagoshima University (Y.C., T.A.), Sakuragaoka 8-35-1, Kagoshima 890-8520, Japan
Address all correspondence and requests for reprints to: Dr. Masaki Kitazono, First Department of Surgery, Faculty of Medicine, Kagoshima University, Sakuragaoka 8-35-1, Kagoshima 890-8520, Japan. E-mail: kita{at}box-k.nih.gov
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Suicide gene therapy strategies exploit genes that are expressed preferentially or exclusively in tumors to target therapy. Endocrine cancers as a group and thyroid cancers in particular possess numerous genes whose expression is very restricted or specific. For thyrocytes and well differentiated thyroid cancers, specific genes include thyroglobulin (Tg), the Na+/I- symporter (NIS), thyroid peroxidase, iodothyronine 5'-deiodinase, and the TSH receptor. Braiden et al. showed the usefulness of Tg promoters as a transcriptionally targeted gene therapy (17). The present studies were designed to enhance the activity of a thyroid-specific Tg promoter in transcriptionally targeted gene therapy.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We used a total of nine cell lines: two follicular thyroid carcinomas (FTC 133 and FTC 236), two anaplastic thyroid carcinomas (KAT-4 and SW-1736), an adrenocortical carcinoma (H295) (18), a colon carcinoma (SW620), a renal cell carcinoma (A498), a breast carcinoma (MCF7), and a hepatocarcinoma (HepG2). FTC 133 and FTC 236 were derived from cultures obtained from the primary tumor (FTC 133) and a nodal metastasis (FTC 236) of a follicular thyroid carcinoma. The anaplastic thyroid carcinoma cell lines were derived from primary cultures of human anaplastic thyroid carcinoma tumors. SW-1736 was developed by Drs. Leibowitz and McCombs III at the Scott and White Memorial Hospital (Temple, TX) in 1977 and was provided by Nils-Erik Heldin (Uppsala University, Uppsala, Sweden). KAT-4 was developed and maintained in the laboratory of Kenneth Ain (University of Kentucky). FTC236, FTC133, KAT-4, SW-1736, and SW620 were maintained in RPMI 1640 with glutamine medium supplemented with 10% FCS at 37 C in a 5% CO2 incubator. H295 cells were maintained in RPMI, with the addition of HEPES, ITS (insulin, transferrin, selenium), and 2% serum. A498, MCF7, and HepG2 cells were maintained in Iscove’s MEM supplemented with 10% serum. Although the serum used may contain TSH or TSH-like activity, we observed that adding supplemental TSH had no effect on the growth rate or plating efficiency of these cell lines.
RT-PCR
Total ribonucleic acid (RNA) was extracted using RNA STAT-60 (Tel-Test, Friendswood, TX). RT-PCR was performed as previously described (19). The primers used for amplification of endogenous Tg gene were: Tg 5' (sense), 5354GAAATCGTCGTCTTCTCCAC5374; and Tg 3' (antisense), 5565CTGTCAGCACAGTGGCAATA5584. RNA from a normal thyroid was amplified in every experiment and included in every gel. Thus, in every experiment the reaction conditions were internally controlled, and in every gel a reference standard was included.
Construction of reporter plasmids
The promoter of the Tg gene was isolated using the PCR and DNA from FTC 236 cells. Primers used were: 5' (sense), -500GAGCTCTAAGAGGTTGTTAGAG-479; and 3' (antisense), +40TTTCCTGGCCCTTCCTGGGAGGAA+17. The amplified fragment was subcloned into the pCRII TA vector (Invitrogen, San Diego, CA), and its sequence was confirmed. After digestion with KpnI and XhoI, the 540-bp promoter fragment was ligated to the pGL3-B luciferase vector (Promega Corp., Madison, WI). This construct was designated Tg promoter-Luc. In addition, the herpes simplex virus thymidine kinase (HSV-TK) minimum promoter was excised by digesting pRL-TK (Promega Corp.) with HindIII and BglII; this was subcloned into pGL3-B and designated TK-Luc. TK-Luc was used as the positive control.
The enhancer element of the Tg gene was amplified using the PCR and the following primers: 5' (sense), CGGGGTACC-2698GTTCTCACGAGCTCAGTGGAG-2677; and 3' (antisense), CGGACTAGT-2172CCCATTGCCCTAAAATGCATGC-2193. KpnI (sense) and SpeI (antisense) restriction sites flanked the Tg enhancer sequence. The amplified fragment was inserted into the Tg promoter-Luc plasmid-digested with KpnI and SpeI. This construct was designated Tg enhancer/promoter-Luc.
To construct Tg enhancer/promoter-TK, we isolated the TK gene by
digesting pGL3-TK containing the coding region of the HSV-TK gene with
XhoI and XbaI. The TK-coding region was then
inserted into Tg enhancer/promoter-Luc that had been digested
with XhoI and XbaI to release the luciferase
gene. This construct was designated Tg enhancer/promoter-TK. In
addition, to generate a construct that could be used to establish
stable transfectants, the Tg enhancer/promoter-TK-coding region was
subcloned into pcDNA3.1 The total sequence of the cytomegalovirus
promoter was removed by using MluI and
HindIII. This construct was designated Tg
enhancer/promoter-TK-Neo. Finally, the HSV-TK minimum promoter was
excised by digesting pRL-TK (Promega Corp.) with
HindIII and BglII; this was subcloned into pGL3-B
and designated TK-TK. The vectors used in this study are shown in Fig. 1
.
|
Transient transfections used a liposome-mediated method. Because of their slow growth rate, 2 x 105 H295 cells were plated in each well of a 24-well plate 2 days before transfection; for all other cell lines, 3–4 x 104 cells were plated 24 h before transfection. Plasmid DNA (0.5 µg) and 4.5 µL TransFast (Promega Corp.) mixed with 200 µL medium were added to each well. After incubating for 1 h in the above mixtures, cells were cultured in the presence or absence of various agents for 2 days. The agents used and their concentrations were as follows: 1) 0.3 mmol/L 8-bromo-cAMP (8-Br-cAMP), 2) 20 µmol/L forskolin, 3) 1.2 mmol/L phenylbutyrate, 4) 2 mmol/L sodium butyrate, and 5) 1 ng/mL depsipeptide (FR901228). After harvesting, the total protein concentration was measured by protein assay (Bio-Rad Laboratories, Inc., Richmond, CA). Firefly luciferase activity was assessed using the Luciferase Assay System (Promega Corp.) and was normalized to protein. All transfections were performed in triplicate. In all experiments TK-Luc and pGL3-B were used as positive and negative controls, respectively. The result with the TK-Luc vector was assigned a value of 100%, and all other values were expressed relative to this as relative luciferase units.
Stable transfection of thyroid cancer cells with the Tg enhancer/promoter-TK-Neo vector employed TransFast. After 3 weeks in medium containing 300 µg/mL G418, stable transfectants were isolated.
Immunoblot analysis
Stable transfectants were scraped into cell lysis buffer containing 10 mmol/L Tris (pH 7.4), 150 mmol/L NaCl, 1% Nonidet P-40, 1 mmol/L ethylenediamine tetraacetate, 20 µg/mL aprotinin, and 100 µg protein was separated on a 10% SDS-PAGE gel. Electroblotting to Immobilon P transfer membrane (Millipore Corp., Bedford, MA) was performed, and nonspecific protein binding was blocked using 10% milk in TNE buffer [2 mmol/L Tris (pH 7.4), 2 mmol/L NaCl, 1 mmol/L ethylenediamine tetraacetate, and 0.15% Tween-20] for 1 h. The membrane was incubated for 1 h with a rabbit polyclonal antibody for HSV-TK (provided by Dr. William C. Summers, Yale University, New Haven, CT), diluted 1:1000 in 5% milk, and 0.02% sodium azide in TNE. After washing, antirabbit Ig horseradish peroxidase-linked secondary antibody (Amersham Pharmacia Biotech, Arlington Heights, IL) was added for 1 h. After washing, the membrane was developed in ECL Western blotting detection reagents (Amersham Pharmacia Biotech).
Cell killing assay
The 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay was performed to determine sensitivity to ganciclovir (GCV). Cells maintained in a 25-cm2 flask with or without the various agents for 2 days, seeded in 96-well plates (6000 cells/well), and incubated in various concentrations of GCV for 5 days. Cell survival was calculated as the percentage of untreated cells.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, the endogenous levels of Tg were very
low or undetectable in all four cell lines (PCR products detected in
FTC 133 and FTC 236 are not clearly visualized in the photograph).
However, the knowledge that expression of Tg is a property of
differentiated thyrocytes provided the rationale for including a
variety of differentiating agents in the experimental design. The goal
was to improve the specificity and activity of the constructs. As a
first step, we examined the effects of five different agents on the
expression of the endogenous Tg gene. Two cell lines were used: FTC 236
and SW-1736. As shown in Fig. 2, 8-Br-cAMP, forskolin, and
phenylbutyrate had no effect on the endogenous levels of Tg messenger
RNA. However, treatment with either depsipeptide or sodium butyrate,
two histone deacetylase inhibitors, resulted in a marked increase
in Tg expression.
|
shows the luciferase activity in
the four thyroid carcinoma cell lines after transient transfection with
either control TK-Luc or the Tg promoter-Luc construct. Luciferase
activity in untreated cells was compared with that in cells treated
with the five agents evaluated in Fig. 2
. For all cell lines, the
luciferase activity of TK-Luc in untreated cells was assigned a value
of 100%, and all luciferase activities are expressed relative to this.
The induction of luciferase activity correlates well with the effects
on the endogenous gene. In agreement with their lack of effect on the
expression of the endogenous gene, neither 8-Br-cAMP, forskolin, nor
phenylbutyrate had any substantial effect on luciferase activity.
In contrast, both depsipeptide and sodium butyrate significantly
augmented luciferase activity in all four cell lines, just as they had
increased the expression of the endogenous Tg gene. The augmentation
achieved with either depsipeptide or sodium butyrate was somewhat more
pronounced in the two anaplastic cell lines (SW-1736 and KAT-4), in
part because their basal level of expression was lower, possibly
reflecting their more undifferentiated phenotype.
|
shows the results obtained after
transient transfection of nine different cell lines. The cell lines
used in this experiment include the four thyroid carcinoma cell lines
and five cell lines not of thyroid origin. As with the experiments
described above, luciferase activity was measured after transient
transfections. As in Fig. 3, for all cell lines the luciferase activity
of TK-Luc in untreated cells was assigned a value of 100%, and all
luciferase activities are expressed relative to this. The basal
activity of this construct was somewhat higher than that of the Tg
promoter-Luc construct, a fact obscured by the marked differences in
the y-axis between Figs. 4 and 3. For the four thyroid cell
lines, the basal activity for the Tg promoter-Luc vs. the Tg
enhancer/promoter-Luc construct (with TK-Luc = 100%) were as
follows: SW-1736, 14.8% vs. 28.6%; KAT-4, 15.1%
vs. 32.4%; FTC 133, 32.6% vs. 58.5%; and FTC
236, 34.8% vs. 84.5%. The more striking differences were
observed when luciferase activities were measured after treatment with
depsipeptide, sodium butyrate, or either of these agents in combination
with 8-Br-cAMP. Both depsipeptide and sodium butyrate significantly
enhanced the basal activity, and this enhancement was further augmented
by the addition of 8-Br-cAMP. This augmentation was not unexpected, as
the putative enhancer element alone has been previously shown to be
modulated by forskolin and to contain cAMP-like elements
(20). As with the Tg promoter-Luc construct, higher levels
were achieved in the more differentiated cell lines (FTC 133 and FTC
236) than the anaplastic cells (SW-1736 and KAT-4). Furthermore, the
increases were not explained by differences among the vectors in
transfection efficiencies. In FTC133 and SW-1736, cotransfection of the
lacZ gene with the Tg promoter-Luc or Tg
enhancer/promoter-Luc did not demonstrate significant differences in
transfection efficiency (FTC133, 17.0% vs. 13.3%; SW-1736,
25.3% vs. 26.7%) Finally, these studies demonstrated the
specificity of the Tg enhancer/promoter-Luc construct, as evidenced by
the low to undetectable activity seen in the five cell lines that were
not of thyroid origin. Thus, addition of the putative Tg enhancer
increased the activity and specificity. The enhanced basal activity and
the augmentation by depsipeptide, sodium butyrate, and 8-Br-cAMP in the
thyroid carcinoma cells compared with the other cell lines indicated
that this construct had a relatively high thyroid cell specificity.
|
shows the results of GCV
sensitivity after transient transfections. In the nine cell lines
examined, previous studies have found transfection efficiencies of
10–20%, so that cell killing was probably achieved via a bystander
effect (transfection efficiency data not shown). In the four thyroid
carcinoma cell lines, no significant cytotoxicity was observed with the
pGL-3 negative control. IC50 values of more than
1000 ng/mL were observed with pGL-3, similar to those with GCV alone
(GCV alone data not shown). Some sensitization was observed when cells
were transfected with the TK-TK construct. Greater sensitization was
observed with the Tg enhancer/promoter-TK vector. In agreement with the
results obtained with the luciferase construct, treatment with either
depsipeptide or sodium butyrate with 8-Br-cAMP resulted in even greater
cytotoxicity. As with the luciferase studies the greatest effect was
observed with depsipeptide plus 8-Br-cAMP in combination. With this
latter combination, sensitization of as much as 100,000-fold could be
achieved, and the maximum effect was most pronounced in the follicular
carcinoma cell lines. For comparison, in the four thyroid carcinoma
cell lines, cytotoxicity in stable transfectants is shown. The
construct used to establish the stable transfectants contains a
neomycin resistance gene. The stable transfectants were obtained by
exposing cells to increasing concentrations of G418. As all or nearly
all stably transfected cells contain the TK gene under the control of
the Tg enhancer/promoter, somewhat greater cytotoxicity is observed
compared with transiently transfected cells. Finally, in contrast to
the results obtained with the thyroid carcinoma cell lines, no
enhancement of GCV toxicity was observed with the Tg enhancer/promoter
construct in the cell lines not of thyroid origin. Enhanced toxicity
was not even observed after treatment with depsipeptide and 8-Br-cAMP.
Only with the TK-TK construct was enhanced toxicity found. The similar
degrees of enhancement observed with the TK-TK construct in the nine
cell lines is indirect evidence of comparable, albeit not identical,
transfection efficiencies.
|
. In this experiment stable
transfectants were isolated from four thyroid cancer cell lines after
transfection with the Tg enhancer/promoter-TK-Neo construct. As
expected, expression of HSV-TK protein could not be detected in
untransfected parental cells. In contrast, expression could be detected
in the Tg enhancer/promoter-TK-Neo stable transfectants. Furthermore,
expression of HSV-TK protein could be induced by the agents shown to
mediate luciferase expression and GCV cytotoxicity (see Figs. 4 and 5).
Thus, the Tg enhancer/promoter fragment was able to induce expression
of HSV-TK (Fig. 6), and this, in turn, could be used to modulate GCV
sensitivity (Fig. 5).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To successfully develop a cancer-specific gene therapy, two requirements must be satisfied: 1) tissue specificity, and 2) sufficient activity to allow therapeutic benefit. The first requirement, specificity, can be achieved if the promoter used restricts expression of the therapeutic gene to tumor cells. To achieve specificity, the Tg promoter appears to be an ideal candidate for thyroid cancer. With the exception of a recent study demonstrating very low levels of expression in the normal kidney (21), previous studies have demonstrated Tg expression exclusively in normal thyroid tissue and in a majority of thyroid cancers (22). Furthermore, as demonstrated in the present study, Tg expression can be modulated in cells of thyroid origin, including anaplastic thyroid cells, with depsipeptide or sodium butyrate, two histone deacetylase inhibitors. Luciferase activity and GCV sensitivity were demonstrated in four thyroid carcinoma cells, without significant luciferase activity or GCV sensitivity in five carcinoma cell lines derived from tissues other than the thyroid, including the renal carcinoma cell line, A498. Taken together, these results suggest that the Tg enhancer/promoter may be valuable as a thyroid-specific construct in a suicide gene therapy strategy. The second requirement, the need for sufficient expression, is essential for successful therapy and impacts the issue of specificity. The level of expression of the Tg promoter in thyroid carcinoma cells was about 20–35% that of the HSV-TK promoter in the absence of other agents and was 60–85% after treatment with either sodium butyrate or depsipeptide. Some reports indicate that HSV-TK activity and GCV sensitivity may not be directly correlated to the activity of the promoter driving the HSV-TK gene (23, 24). However, we believe that the activity of the Tg promoter alone would not be sufficient. To augment the activity of this construct we introduced a putative Tg enhancer proximal to the Tg promoter. With this construct, higher levels of activity were achieved without sacrificing specificity. The augmentation achieved by introducing the putative enhancer was most pronounced after depsipeptide or sodium butyrate treatment, alone or in combination with 8-Br-cAMP, as shown by luciferase activity. This drug-mediated enhancement was not found in the nonthyroid cell lines. Consistent with the results of the luciferase assay, transient transfection of the four thyroid cell lines resulted in much higher sensitivity to GCV, and this sensitivity was augmented further by treatment with depsipeptide or sodium butyrate alone or in combination with 8-Br-cAMP. Enhancement in sensitivity of as much as 100,000-fold was achieved despite low transfection efficiencies, emphasizing the magnitude of this effect. Even greater sensitization may be possible under optional conditions, as shown by the results with the stable transfectants. As with all gene therapy strategies, in vivo toxicities will need to be assessed in preclinical models. Although low levels of expression in normal kidney cells, which do not divide, will probably not result in significant toxicity, attention will be directed to this tissue.
Unlike other tumor-targeted strategies that exploit the expression of genes acquired during malignant transformation, Tg expression is a differentiated function. Tumor dedifferentiation is expected to result in lower expression of Tg and other thyroid markers such as 5'-deiodinase, thyroid peroxidase, the TSH receptor, and NIS. Indeed, the inability of poorly differentiated and anaplastic thyroid cancers to trap iodine is thought to be a consequence of a loss of NIS expression. Differentiating agents might up-regulate their transcription. To be sure, the choice of differentiating agent will be important. Our results suggest that histone deacetylase inhibitors may be effective. Histone deacetylase inhibitors have emerged as interesting chemotherapeutic agents, because they affect histone acetylation and, in turn, gene transcription. Numerous studies have demonstrated that histone deacetylases are components of many transcription complexes. The two histone deacetylase inhibitors used in the present study have been tried in patients. Although sodium butyrate is difficult to administer, phase I trials with depsipeptide have found it to be well tolerated, and the levels achieved greatly exceed those used in the present study (our unpublished observations).
In conclusion, we report the construction of a suicide vector with preferential toxicity in thyroid cells. Using the promoter of the Tg gene and a putative enhancer, a construct with high activity and specificity for thyroid cells was constructed. Luciferase and TK expression as well as GCV sensitivity were enhanced by treatment with the histone deacetylase inhibitors, depsipeptide and sodium butyrate, alone or in combination with 8-Br-cAMP. Current efforts are directed at generating a recombinant adenovirus containing the HSV-TK gene under the control of the Tg enhancer/promoter sequences.
Received July 19, 2000.
Revised October 24, 2000.
Accepted October 27, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  C. Puppin, F. D'Aurizio, A. V. D'Elia, L. Cesaratto, G. Tell, D. Russo, S. Filetti, E. Ferretti, E. Tosi, T. Mattei, et al. Effects of Histone Acetylation on Sodium Iodide Symporter Promoter and Expression of Thyroid-Specific Transcription Factors Endocrinology, September 1, 2005; 146(9): 3967 - 3974. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Furuya, H. Shimura, H. Suzuki, K. Taki, K. Ohta, K. Haraguchi, T. Onaya, T. Endo, and T. Kobayashi Histone Deacetylase Inhibitors Restore Radioiodide Uptake and Retention in Poorly Differentiated and Anaplastic Thyroid Cancer Cells by Expression of the Sodium/Iodide Symporter Thyroperoxidase and Thyroglobulin Endocrinology, June 1, 2004; 145(6): 2865 - 2875. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Barzon, M. Boscaro, and G. Palu Endocrine Aspects of Cancer Gene Therapy Endocr. Rev., February 1, 2004; 25(1): 1 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Takeda, H. Inaba, M. Yamazaki, S. Kyo, T. Miyamoto, S. Suzuki, T. Ehara, T. Kakizawa, M. Hara, L. J. DeGroot, et al. Tumor-Specific Gene Therapy for Undifferentiated Thyroid Carcinoma Utilizing the Telomerase Reverse Transcriptase Promoter J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3531 - 3538. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Barzon, R. Bonaguro, I. Castagliuolo, M. Chilosi, E. Gnatta, C. Parolin, M. Boscaro, and G. Palu Transcriptionally Targeted Retroviral Vector for Combined Suicide and Immunomodulating Gene Therapy of Thyroid Cancer J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5304 - 5311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kitazono, M. E. Goldsmith, T. Aikou, S. Bates, and T. Fojo Enhanced Adenovirus Transgene Expression in Malignant Cells Treated with the Histone Deacetylase Inhibitor FR901228 Cancer Res., September 1, 2001; 61(17): 6328 - 6330. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
