help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsagarakis, S.
Right arrow Articles by Thalassinos, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsagarakis, S.
Right arrow Articles by Thalassinos, N.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 2 583-589
Copyright © 2001 by The Endocrine Society


Original Studies

Food-Dependent Androgen and Cortisol Secretion by a Gastric Inhibitory Polypeptide-Receptor Expressive Adrenocortical Adenoma Leading to Hirsutism and Subclinical Cushing’s Syndrome: In Vivo and in Vitro Studies

S. Tsagarakis, C. Tsigos, V. Vassiliou, P. Tsiotra, H. Pratsinis, D. Kletsas, P. Trivizas, A. Nikou, T. Mavromatis, F. Sotsiou, S. Raptis and N. Thalassinos

Department of Endocrinology, Diabetes and Metabolism (S.T., V.V., P.Tr., A.N., N.T.), Department of Surgery (T.M.) and Department of Pathology (F.S.), Evangelismos Hospital; 2nd Department of Internal Medicine, Research Institute and Diabetes Center, Athens University and Hellenic National Diabetes Center (C.T., P.Ts., S.R.); and Institute of Biology National Center for Scientific Research Democritos (H.P., D.K.), 106 76 Athens, Greece

Address all correspondence and requests for reprints to: S. Tsagarakis, M.D., Ph.D., Department of Endocrinology, Evangelismos Hospital, 106 76 Athens, Greece.


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Aberrant gastric inhibitory polypeptide (GIP) receptor expression in bilaterally hyperplastic adrenals or unilateral adrenal adenomas is a rare form of adrenal hyperfunction. So far, only few cases have been described. In all these cases, cortisol was the predominant steroid released in a food-dependent manner, leading to the development of non-ACTH-dependent Cushing’s syndrome. In the present study, we describe a novel case of a GIP receptor-expressive adrenocortical adenomatous nodule, detected incidentally by computed tomography scanning in a 41-yr-old lady with hirsutism but no clinical signs of Cushing’s syndrome, on physical examination. Hormonal investigations in morning fasting samples showed slightly elevated androgen levels, low-normal baseline cortisol, normal suppression of cortisol after dexamethasone administration, and ACTH levels that were not suppressed and did stimulate after CRH administration. The elevated urinary free cortisol excretion, in conjunction with an atypical cortisol diurnal rhythm, raised the possibility of an aberrant stimulation of cortisol production by the adrenal tumor. Further studies demonstrated food-dependent secretion of cortisol, which was abolished by prior octreotide administration. Notably, substantial amounts of adrenal androgens were also secreted after food consumption. Removal of the tumor resulted in undetectable cortisol and androgen levels that did not respond to food consumption. Histological examination of the excised tumor revealed an adrenocortical adenomatous nodule originating from the inner zona reticularis, consisting mainly of compact cells. A steroidogenic secretory pattern, indicating the concomitant release of adrenal androgens and cortisol, was also observed in vitro from tumor cells cultured in the presence of GIP. The in vitro secretory response to GIP was higher for the adrenal androgen DHEA, compared with cortisol. The expression of the GIP receptor in tumor cells, but not in the adjacent normal adrenal, was demonstrated by RT-PCR), using specific oligonucleotide probes for this receptor.

In summary, we describe a patient with a GIP-expressive cortisol and androgen oversecreting adrenocortical nodule with the unusual presentation of hirsutism and not the typical clinical signs of Cushing’s syndrome. It is of note that food intake in this patient provoked a substantial increase in both adrenal androgen and cortisol levels that, together with the histological appearance of this nodule, was compatible with a zona reticularis-derived tumor. Thus, aberrant expression of the GIP receptor does not exclusively involve cells of a zona fasciculata phenotype, as previously reported, but may also occur in other types of differentiated adrenocortical cells.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
FOOD-DEPENDENT STEROID HORMONE production represents a rare form of adrenal hyperfunction that results from an abnormal response to gastric inhibitory polypeptide (GIP) (1, 2) via the aberrant expression of GIP receptors in either bilaterally enlarged adrenals or single adrenocortical adenomas (3, 4, 5, 6). So far, only few cases demonstrating in vivo and in vitro responsivity to GIP have been described. In all these cases, cortisol was the predominant steroid released in a food-dependent manner, leading to the development of clinically detectable signs of Cushing’s syndrome (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). In the majority of previously reported cases, GIP-mediated cortisol production led to suppressed ACTH levels and, with the exception of a recently described case (10), blunted cortisol responses to CRH stimulation. Thus, it has been suggested that aberrant expression of GIP receptors should be suspected in patients with primary non-ACTH-dependent forms of Cushing’s syndrome demonstrating an unusual diurnal cortisol rhythm pattern (11, 12).

In this study, we present an atypical case of a GIP-responsive adrenocortical tumor and food-dependent steroid hormone production in a patient with clinical signs of hyperandrogenism but no signs of overt Cushing’s syndrome, on physical examination, despite an increased cortisol secretion. Moreover, atypical hormonal responses for an ACTH-independent form of cortisol excess were observed in this case. In vivo studies demonstrated food-dependent secretion of both androgens and cortisol, which was abolished by prior octreotide administration. A similar steroidogenic pattern was observed in vitro after incubation of cultured tumor cells in the presence of GIP. Concurrently, the expression of the GIP receptor was demonstrated by RT-PCR, using specific oligonucleotide probes for this receptor. To our knowledge, this is the first case demonstrating a substantial production of both adrenal androgens and cortisol by a GIP-responsive adrenocortical tumor, leading to a clinical presentation of hirsutism but no overt clinical signs of Cushing’s syndrome.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Case report

A 41-yr-old lady was admitted for the investigation of a 4.5-cm right adrenal mass that was initially discovered during a computed tomography scan of the thorax, performed by her general practitioner, to investigate a sternum deformity, and subsequently confirmed by formal adrenal computed tomography imaging. On questioning, her major complaints were the appearance, over the last 3 yr, of episodes of facial flushing associated with nervousness, palpitations, frontal headache, and elevations of systolic blood pressure of 10-min duration, which occurred particularly in the early afternoon and were followed by a feeling of tiredness and sleepiness. Over the last 2 yr, she noticed the progressive appearance of excessive hair growth in the face, anterior thorax, abdomen, and thighs. During the same period, she also noticed, for the first time, menstrual irregularities, with menstruation occurring every 10–35 days. She had no weight gain, and there was no easy bruising. On examination, her body weight was 68 kg, with a body mass index of 25.1 kg/m2 and waist-to-hip ratio of 0.74. She had moderate hirsutism, with terminal hair in the face, the anterior thorax, the abdomen, and the thighs (Ferimman score, 15). She was not Cushingoid (skin was not atrophic and there was no buffalo hump or cervicodorsal fat pads, no striae, and no muscle weakness). Palpation of the thyroid revealed the presence of a left-sided lump of 2.5-cm diameter. She was clinically euthyroid.

Urinary VMA, metanephrines, and 5-HIAA were normal on 2 separate days (VMA, 20 and 18.5 µmol/24 h; normal range, less than 35; Metanephrines, 1.33 and 1,32 µmol/24 h; normal range, less than 4.6; and 5-HIAA, 20 and 22 µmol/24 h; normal range, less than 75). Her plasma supine aldosterone concentration was 518 pmol/L (normal range, 135–400), active renin was 21 µU/mL (normal range, 5–47), and a normal response to 42 µU/mL (normal range, 7–76) was observed on rising. Her plasma potassium concentration was 4.4 mmol/L. Androgen levels were slightly elevated in morning fasting samples; DHEA, 46 nmol/L (normal range, 2.8–36); dehydroepiandrosterone sulfate, 13.3 µmol/L (normal range, 3–12); testosterone, 4.6 nmol/L (normal range, less than 3); androstenedione, 14.9 nmol/L (normal range, 3–8). Her SHBG was 33 nmol/L (normal range, 20–100). Urinary free cortisol was elevated, 416 nmol/24 h (normal range, 27.6–250). The ACTH level was 10 pmol/L at 0800 h (normal range, 2–18). The plasma cortisol concentration was 110 nmol/L at 0800 while fasting (normal range, 330–830), 582 nmol/L at 1800 h, and 185 nmol/L at midnight during a day with regular food consumption. This latter finding of an unusual cortisol diurnal rhythm raised the possibility of an aberrant-type of stimulation of cortisol production by the adrenal tumor. The rest of her laboratory examination was within normal limits, except for a suppressed TSH level, with total T3 of 2.73 nmol/L (normal range, 1–3) and total T4 level of 117 nmol/L (normal range, 58–160), associated with the presence of a scintigraphically warm thyroid nodule. The Z-scores for spinal and femoral bone mass densities, measured by dual x-ray absorptiometry, were -1.4 and -1.6, respectively.

The patient underwent further testing, with an oral glucose tolerance test (OGTT), upright-posture, and lys-vasopressin administration after dexamethasone pretreatment (Fig. 1Go). An aberrant cortisol response to OGTT was observed, which raised the possibility of a GIP-induced steroid hormone-producing mass, and further testing was performed to confirm this hypothesis. Furthermore, in view of the lack of signs of hypercortisolemia and the presence of signs of hyperandrogenism, the possibility of food-induced androgen production was also investigated.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 1. Cortisol levels after the administration of oral glucose (75 g), lys-vasopressin (LVP; 10I U, im), and upright posture. In view of the detectable ACTH levels, LVP administration followed dexamethasone (dex) pretreatment (8 mg given orally at 2300 h); ACTH levels were undetectable after dex and did not change after LVP administration.

 
A right adrenalectomy, under hydrocortisone cover, was performed. Macroscopic and histological examinations were typical of an adrenocortical adenomatous tumor, with cells resembling those of the zona reticularis (Fig. 2Go). Postoperatively, cortisol and androgen levels were undetectable and did not show any rise after meals or during the OGTT. In view of the appearance of hypocortisolemic symptoms, the patient was put on hydrocortisone replacement. At her latest follow-up, 6 months post operation, the patient experienced marked improvement in her hirsutism but still required hydrocortisone replacement. There was no meal-induced androgen or cortisol production.



View larger version (154K):
[in this window]
[in a new window]
 
Figure 2. Histological appearance of the excised adrenocortical nodule (paraffin sections, hematoxylin and eosin stain): (1) T, Tumor; F, zona fasciculata; G, zona glomerulosa (x20) and (2 ) compact tumor cells showing nuclear hyperchromatism and polyploidity (x40).

 
Methods

Hormone assays. Plasma cortisol was measured by RIA (Coat-A-Count, Diagnostic Products, Los Angeles, CA). Urinary free cortisol was measured by RIA after dichloromethane extraction. Plasma ACTH was measured by immunoradiometric assay (Nichols Institute Diagnostics, San Juan Capistrano, CA). Androgen levels were measured by RIAs: DHEA (Diagnostic Systems Laboratories, Inc., Webster, TX), androstenedione (Diagnostic Systems Laboratories, Inc.), testosterone (CIS-Bio International, Yvette Cedex, France), and DHEA-S (Coat-A-Count, Diagnostic Products). Plasma 17-OH progesterone was measured by RIA (Biosource Technologies, Inc., Nivelles, Belgium).

Cell isolation and culture. A fragment of the tumor was transferred to the laboratory within 1 h after removal. The tissue was minced into small pieces, and the adrenal cells were dispersed after digestion with 3 mg/mL collagenase (CLS, 148 U/mg, Biochrom KG, Berlin, Germany) at 37 C for 30 min. Subsequently, the cells were cultured in DMEM at a density of 5 x 105 cells/mL in a humidified chamber, at 37 C, in a 5% CO2-95% air atmosphere. Incubations without or with the test substances were performed in triplicate. After a 2-h incubation period, the supernatants were collected and stored at -20 C until assayed. The following substances were added: ACTH-(1–24) (Synacthen, Ciba-Geigy, Basel, Switzerland) and human GIP (Sigma, St. Louis, MO) in final concentrations of 10-11–10-8 mol/L. Measurements of cortisol in the supernatant were performed by a sensitive immunofluorometric assay (Chiron Corp., East Walpole, MA). DHEA was measured by RIA (Diagnostic Systems Laboratories, Inc.).

RNA preparation and RT-PCR. Total RNA was isolated separately from the excised tumor and adjacent normal adrenocortical tissue, using the TriPure Isolation reagent (Roche Molecular Biochemicals, Mannheim, Germany). The integrity of RNA samples was determined on agarose gels (1.2%) and spectophotometrically, using the absorption ratio at 260/280nm. The RNA quantification was done by measuring the absorption at 260 nm. For the removal of any residual DNA contamination, RNA samples were preincubated with deoxyribonuclease (Promega Corp.) at 37 C for 25 min and then at 65 C for 5 min, before the RT and PCR method. Four micrograms of total RNA from the tumor and the normal cortex were reverse transcribed, using random hexanucleotide (200 pmol, Biolabs, Hertfordshire, UK), M-MLV reverse transcriptase (400 U, Promega Corp., Madison, WI), Rnasin inhibitor (20 U, Promega Corp.), and deoxynucleotide triphosphates (0.4 mmol/L) at 37 C for 90 min. This was followed by the addition of 400 U of M-MLV to the reaction, and the incubation was continued for another 90 min. The RT reaction was terminated with the addition of 3 U of Rnase H (Life Technologies, Inc., Paisley, UK) for 30 min at 37 C. The PCR reaction (35 cycles) was subsequently performed in a final vol of 25 µL, using 20 pmol of each primer, and 5 U of Taq polymerase (Promega Corp.) at 94 C for 30 sec, 60 C for 30 sec, and 68 C for 55 sec. PCR reactions were also performed in RNA samples before RT, to exclude DNA contamination.

Primer design A set of specific primers [5'-oligonucleotide ATCCGCATTCTTGGCATTCTCCTG (1037–1060) and 3'-oligonucleotide ATGCTAACTGAACAGACACGGGGA (1527–1504)] were used to amplify a 491-bp PCR product from the GIP receptor messenger RNA (mRNA) transcript (GenBank accession no. S79852). A second set of primers [5'-oligonucleotide GTCCAAGTAACATCCCCGCCTTAACCA (657–684) and 3'oligonucleotide GAGTCGATGATGTCATCGGC (1018–999)] that recognized and amplified a PCR product of 361 bp in the human ACTH receptor mRNA (GenBank accession no. X65633) were also used, as previously described (13).

Enzyme restriction The RT-PCR product was digested at 37 C with XbaI for 1-h, and the product was run on 1.3% agarose gel and stained with ethidium bromide. XbaI was predicted to cut the GIP receptor PCR product, at positions 1188 and 1402, into 3 fragments (215, 152, and 124 bp).


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Diurnal rhythm

Endocrine testing demonstrated meal-induced hypercortisolemia and hyperandrogenemia, with lower levels of these hormones being observed during fasting. Figure 3Go shows the plasma cortisol and ACTH profiles (measured at 1- to 2-h intervals) during a day when the patient took regular meals and during a day of fasting, up to 1800 h, when a meal was allowed. Figure 4Go shows the corresponding androgen (DHEA, androstenedione, testosterone) and 17-hydroxyprogesterone levels. Persistently decreased cortisol and androgen levels were found during fasting, followed by a cortisol and androgen rise when the patient was allowed to eat at 1800 h. In contrast, during the day of a regular food intake, a rise of both cortisol and androgen levels was observed after each meal. Levels of 17-hydroxyprogesterone also increased after each meal, but there was not a preferential increase suggestive of 21-hydroxylase deficiency. There was no change of aldosterone levels after meals (basal, 517; highest value following meal, 332 nmol/L). ACTH levels were detectable in the early morning samples and showed a decrease, during the rest of the day, that was unrelated to food intake (Fig. 3Go).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Plasma cortisol (left) and ACTH (right) profiles on a control day with normal food intake at 0800, 1400, and, 2000 h and during a day of fasting with food intake at 1800 h.

 


View larger version (22K):
[in this window]
[in a new window]
 
Figure 4. Plasma DHEA, androstenedione, testosterone and 17-hydroxyprogesterone (17-OHP) profiles on a control day with normal food intake at 0800, 1400, and 2000 h and during a day of fasting with food intake at 1800 h.

 
Dexamethasone suppression and ACTH and CRH stimulation tests

Plasma cortisol was suppressed after the low-dose dexamethasone suppression test (postdexamethasone 0900 h cortisol, 36 nmol/L). Administration of ACTH was associated with a 16-fold cortisol, a 16-fold androstenedione, and a 3-fold testosterone rise, compared with basal levels. The peak 17-OH-progesterone response after ACTH administration was 18.8 nmol/L. She had a normal ACTH response after administration of 100 µg iv bolus human CRH (basal, 7; to a peak, 19.8 pmol/L) associated with a cortisol rise from 174 to 350 nmol/L.

Effect of octreotide

The meal-induced rise of cortisol and androgens was blocked by the prior administration of octreotide. Figure 5Go shows the effect on cortisol and DHEA of 200 µg octreotide (Novartis Pharmaceuticals, Basel, Switzerland), given sc, 1 h before a standard meal. The administration of octreotide completely abolished the cortisol and DHEA rise produced by food intake. Similar results were obtained with the other androgens measured (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 5. Plasma cortisol (a) and DHEA (b) levels after a meal test without or with prior treatment with octreotide.

 
In vitro studies

Adenoma cells in culture produced measurable amounts of DHEA but only barely detectable amounts of cortisol under basal conditions. After incubation with incremental concentrations of GIP, a sharp rise in both cortisol and DHEA release was observed at a concentration of GIP of 10-8 mol/L, which was more pronounced for the latter. After ACTH stimulation, a gradual increment in the production of both cortisol and DHEA was observed, which was again higher in the case of DHEA (Fig. 6Go).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. In vitro response of dispersed adrenal adenoma cells to GIP and ACTH. Histograms represent the mean cortisol (a) and DHEA(b) levels of triplicate incubations.

 
Detection of GIP receptor

Using specific primers for the GIP receptor, a single band of the expected size (~500) was observed after RT-PCR in the adenoma but not in the adjacent normal adrenal tissue (Fig. 7Go). By contrast, using specific primers for the ACTH receptor, a single band of the expected size (~360) was observed in both the adenoma and normal adrenal tissue (12). PCR, without prior RT, detected no message of GIP receptor in the adenoma. The specificity of the PCR signal was confirmed by enzyme restriction with XbaI, which cleaved, as predicted, the PCR product at two sites, giving three smaller fragments of approximately 215, 152, and 124 bp.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 7. RT-PCR of GIP receptor and ACTH receptor mRNA in the adenoma and adjacent normal adrenal tissue. In the adenoma, we also performed PCR without prior RT to exclude DNA contamination.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Our investigation of this unusual case clearly indicated a GIP-responsive adrenocortical tumor, because of the aberrant expression of GIP receptor. The contribution of GIP in the secretory regulation of this tumor was demonstrated both in vivo and in vitro. In vivo, steroid hormone production by the tumor was induced after a mixed meal and oral glucose administration. Octreotide administration completely abolished the meal-induced increase in steroid hormone production. Although we were unable to investigate the effect of a GIP infusion on steroid hormone production in vivo, incubation of adenoma cells from this tumor in vitro, in the presence of GIP, demonstrated a clear-cut increase of steroid hormone production (both cortisol and androgens). The presence of aberrant GIP receptor expression was confirmed by the finding of GIP receptor mRNA in the tumor but not in the adjacent normal adrenocortical tissue. Upright posture and vasopressin administration had no effect on steroid secretion excluding the coexistence of aberrant catecholamine and vasopressin receptor expression (14). The possibility of aberrant coexpression of LH/HCG receptor or other hormonal and cytokine receptors by this tumor was not examined.

Despite the typical characteristics for a GIP-expressive adrenocortical tumor, the clinical presentation, the hormonal investigation findings, and the steroidogenic secretory pattern of this patient rendered the case of particular interest. It is of note that she was initially referred because of an otherwise incidentally discovered right adrenal mass. Physical examination revealed only moderate hirsutism but no overt clinical signs of Cushing’s syndrome. In particular, there was no central obesity, no buffalo hump, and no facial plethora. Also, signs related to the protein-wasting effects of cortisol (skin thinning, striae, and muscle wasting) were absent. Thus, from a clinical standpoint, this case indicates that suspicion of a GIP-responsive adrenocortical tumor should not be restricted only to patients with overt clinical signs of Cushing’s syndrome. It should be noted, however, that in retrospect, several of the patient’s symptoms could have been ascribed to cortisol excess. Thus, the episodic elevations of blood pressure in the early afternoon, followed by a feeling of tiredness, could have been attributed to the lunch-induced elevations of cortisol levels. Also, despite the lack of clinical stigmata of Cushing’s syndrome, the patient presented with relatively low bone mass density. Indeed, it has now been increasingly recognized that even mild cortisol excess, in the absence of full-blown florid appearance of Cushing’s syndrome, may have detrimental actions.

The laboratory findings obtained in this patient were atypical for an ACTH-independent cortisol-secreting adrenal adenoma (15, 16). Unlike previous case reports (1, 2, 3, 4, 5, 6, 7, 8, 9), our patient had unsuppressed morning ACTH levels and suppressed fasting cortisol levels after dexamethasone suppression. Moreover, bolus CRH administration resulted in an almost-normal ACTH and cortisol response. Interestingly, a similar ACTH and cortisol response to CRH administration was recently reported by Croughs et al. (10) in a patient with GIP-dependent bilateral adrenal hyperplasia and typical clinical signs of Cushing’s syndrome. It might, therefore, be suggested that the intermittent nature of food-induced cortisol secretion does not always result in complete suppression of the HPA axis; and, depending on the degree of nonsuppression, atypical laboratory findings can be obtained that may render the correct identification of food-induced hypercortisolemia extremely difficult. In our case, suspicion of aberrant receptor expression was only provided by the finding of an unusual diurnal rhythm pattern of cortisol levels and was subsequently confirmed by a meal test. However, these tests are not routinely involved in the work-up of suspected hypercortisolism.

A novel finding in this case was the substantial increase in both androgen and cortisol levels associated with food-consumption. The elevations of the major adrenal androgens DHEA and androstenedione paralleled those of cortisol after food ingestion, indicating cosecretion of these steroids by the tumor. Testosterone, which originates mainly from peripheral conversion of the above androgens, was also significantly elevated in the postmeal period and underlined the development of hirsutism, which was the predominant clinical manifestation in our patient. Glucocorticoids and androgens originate from common precursors. Enzymatic blocks in the glucocorticoid synthetic pathway, in particular of CYP21, have been associated with androgen overproduction from adrenal adenomas (17). However, based on the degree of 17-hydroxyprogesterone rise after ACTH stimulation in our patient, it is unlikely that an enzymatic block was responsible for the androgen overproduction by the tumor. Instead, it is most likely that the production of DHEA and androstenedione in this tumor was mediated through a preferential 17,20-lyase activity of CYP17 enzyme complex, which occurs only in the zona reticularis (18). The ability, therefore, of the tumor studied to release substantial amounts of adrenal androgens is compatible with a zona reticularis phenotype, and this was also suggested by the histological findings. It is of note that, in all previous cases of GIP-responsive adrenal adenomas or bilaterally enlarged adrenals, cortisol was the predominant steroid released, indicating that aberrant expression of GIP receptor involves mainly adrenocortical cells with a zona fasciculata phenotype (8). However, our findings in this case indicate that adrenocortical tumors overexpressing the GIP receptor are not exclusively of a zona fasciculata phenotype and may occur in reticularis and possibly other types of differentiated adrenocortical cells. It should be noted that comparable variations in the steroidogenic secretory pattern have also been observed in some cases of adrenal hyperfunction caused by ectopic adrenal expression of receptors other than GIP. Thus, testosterone secretion was reported by an ectopic LH/HCG receptor expressive adenoma (17); whereas, in the case of ectopic LH/HCG and serotonin 5-HT4 receptor expressive adenoma [reported by Lacroix et al. (19)], free testosterone levels were stimulated by both LH and serotonin, estradiol was stimulated by LH, and aldosterone was stimulated by serotonin agonists. Also, in a patient with ß-adrenergic receptor-aberrant expression, isoproterenol stimulated both cortisol and aldosterone production (20). It is thus probable that the pattern of steroid production depends more on the cell of origin, rather than on the nature of the ectopic receptor.

In conclusion, this is the first report of a GIP receptor-expressive adrenocortical tumor with a steroidogenic secretory pattern and histological appearance of a zona reticularis-derived tumor. This finding indicates that aberrant expression of GIP receptor does not exclusively involve adrenocortical cells of a zona fasciculata phenotype but may occur in other types of differentiated adrenocortical cells. It is therefore suggested that a search for GIP receptor-expressive adenomas should not be restricted only in patients with clinical features of Cushing’s syndrome, because (depending on the tumor cell-type) androgen or other adrenal steroids may be predominantly released after food consumption. So far, no case of pure androgen or mineralocorticoid food-induced hypersecretion has been described, but a search by specific testing may lead to the description of such entities in the future.

Received February 21, 2000.

Revised August 2, 2000.

Revised October 6, 2000.

Accepted October 19, 2000.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Lacroix A, Bolte E, Tremblay J et al. 1992 Gastric inhibitory polypeptide-dependent cortisol hypersecretion—a new cause of Cushing’s syndrome. N Engl J Med. 327:974–980.[Abstract]
  2. Reznek Y, Allali-Zerah V, Chayvialle JA, et al. 1992 Food-dependent Cushing’s syndrome mediated by aberrant adrenal sensitivity to gastric inhibitory polypeptide. N Engl J Med. 327:981–986.[Abstract]
  3. Chabre O, Liakos P, Vivier J, et al. 1998 Cushing’s syndrome due to gastric inhibitory polypeptide-dependent adrenal adenoma: insight into hormonal control of adrenocortical tumorigenesis. J Clin Endocrinol Metab. 83–3134-3143.
  4. Lebrethon MC, Avallet O, Reznik Y, et al. 1998 Food-dependent Cushing’s syndrome: characterization and functional role of gastric inhibitory polypeptide receptor in the adrenals of three patients. J Clin Endocrinol Metab. 83:4514–4519.[Abstract/Free Full Text]
  5. Luton JP, Berherat J, Kuhn JM, Bertagna X. 1998 Aberrant expression of the GIP (gastric inhibitory polypeptide) receptor in an adrenal cortical adenoma responsible for a case of food-dependent Cushing’s syndrome. Bull Acad Natl Med. 182:1839–1850.[Medline]
  6. N'Diaye N, Tremblay J, Hamet P, De Herder WW, Lacroix A. 1998 Adrenocortical overexpression of gastric inhibitory polypeptide receptor underlies food-dependent Cushing’s syndrome. J Clin Endocrinol Metab. 83:2781–2785.[Abstract/Free Full Text]
  7. De Herder WW, Hofland LJ, Usdin TB, et al. 1996 Food-dependent Cushing’s syndrome resulting from abundant expression of gastric inhibitory polypeptide receptors in adrenal adenoma cells. J Clin Endocrinol Metab. 81:3168–3172.[Abstract]
  8. N'Diaye N, Hamet P, Tremblay J, Boutin J-M, Gaboury L, Lacroix A. 1999 Asynchronous development of bilateral nodular adrenal hyperplasia in gastric inhibitory polypeptide-dependent Cushing’s syndrome. J Clin Endocrinol Metab. 84:2616–2622.[Abstract/Free Full Text]
  9. Pralong FP, Gomez F, Guillou L, Mosimann F, Franscella S, Gaillard RG. 1999 Food-dependent Cushing’s syndrome: possible involvement of leptin in cortisol hypersecretion. J Clin Endocrinol Metab. 84:3817–3822.[Abstract/Free Full Text]
  10. Croughs RJM, Zelissen PMJ, Van Vroonhove TJMV, et al. 2000 GIP-dependent adrenal Cushing’s syndrome with incomplete suppression of ACTH. Clin Endocrinol (Oxf). 52:235–240.[CrossRef][Medline]
  11. N'Diaye N, Tremblay J, Hamet P, Lacroix A. 1998 Hormone receptor abnormalities in adrenal Cushing’s syndrome. Horm Metab Res. 30:440–446.[Medline]
  12. Bertherat J, Bertagna X. 1999 Aberrant receptor expression as a cause of Cushing’s syndrome. Topical Endocrinol. 12:6–9.
  13. Tsigos C, Arai K, Hung W, Chrousos GP. 1993 Hereditary isolated glucocorticoid deficiency is associated with abnormalities of the adrenocorticotrophin receptor gene. J Clin Invest. 92:2458–2491.
  14. Lacroix A, Mircescu H, Hamet P. 1999 Clinical evaluation of the presence of abnormal receptors in adrenal Cushing’s syndrome. Endocrinologist. 9:9–15.
  15. Tsigos C, Chrousos GP. 1996 Diagnosis and management of Cushing’s syndrome. Annu Rev Med. 47:443–446.[CrossRef][Medline]
  16. Tsagarakis S, Kokkoris P, Roboti C, et al. 1998 The low dose dexamethasone suppression test in patients with adrenal incidentalomas: comparison with clinically euadrenal subjects and patients with Cushing’s syndrome. Clin Endocrinol (Oxf). 48:627–633.[CrossRef][Medline]
  17. Leinonen P, Ranta T, Siegberg R, Pelkonen R, Heikilla P, Kahri A. 1991 Testosterone-secreting virilizing adrenal adenoma with human chorionic gonadotrophin receptors and 21-hydroxylase deficiency. Clin Endocrinol (Oxf). 34:31–35.[Medline]
  18. Mapes S, Corbin CJ, Tarantal A, Conley A. 1999 The primate adrenal zona reticularis is defined by expression of cytochrome b5, 17{alpha}-hydroxylase/17,20-lyase cytochrome P450 (P450) and NADPH-cytochrome P450 reductase (reductase) but not 3ß-hydroxysteroid dehydrogenase/{Delta}5–4 isomerase (3ß-HSD). J Clin Endocrinol Metab. 84:3382–3385.[Abstract/Free Full Text]
  19. Lacroix A, Hamet P, Boutin J-M. 1999 Leuprolide acetate treatment in luteinizing hormone-dependent Cushing’s syndrome. N Engl J Med. 341:1577–1581.[Free Full Text]
  20. Lacroix A, Tremblay J, Rousseau G, Bouvier M, Hamet P. 1997 Propranolol therapy for ectopic ß-adrenergic receptors in adrenal Cushing’s syndrome. N Engl J Med. 337:1429–1434.[Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
A. Lampron, I. Bourdeau, S. Oble, A. Godbout, W. Schurch, P. Arjane, P. Hamet, and A. Lacroix
Regulation of Aldosterone Secretion by Several Aberrant Receptors Including for Glucose-Dependent Insulinotropic Peptide in a Patient with an Aldosteronoma
J. Clin. Endocrinol. Metab., March 1, 2009; 94(3): 750 - 756.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
M. H. S. Costa, A. C. Latronico, R. M. Martin, A. S Barbosa, M. Q Almeida, C. F. P. Lotfi, H. P Lima Valassi, M. Y. Nishi, A. M. Lucon, S. A. Siqueira, et al.
Expression profiles of the glucose-dependent insulinotropic peptide receptor and LHCGR in sporadic adrenocortical tumors
J. Endocrinol., February 1, 2009; 200(2): 167 - 175.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
N M Albiger, G Occhi, B Mariniello, M Iacobone, G Favia, A Fassina, D Faggian, F Mantero, and C Scaroni
Food-dependent Cushing's syndrome: from molecular characterization to therapeutical results
Eur. J. Endocrinol., December 1, 2007; 157(6): 771 - 778.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. L. Mazzuco, O. Chabre, N. Sturm, J.-J. Feige, and M. Thomas
Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Gene Is a Sufficient Genetic Event to Induce Benign Adrenocortical Tumor in a Xenotransplantation Model
Endocrinology, February 1, 2006; 147(2): 782 - 790.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
V. Baldacchino, S. Oble, P.-O. Decarie, I. Bourdeau, P. Hamet, J. Tremblay, and A. Lacroix
The Sp transcription factors are involved in the cellular expression of the human glucose-dependent insulinotropic polypeptide receptor gene and overexpressed in adrenals of patients with Cushing's syndrome
J. Mol. Endocrinol., August 1, 2005; 35(1): 61 - 71.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
F. M. Swords, S. Aylwin, L. Perry, J. Arola, A. B. Grossman, J. P. Monson, and A. J. L. Clark
The Aberrant Expression of the Gastric Inhibitory Polypeptide (GIP) Receptor in Adrenal Hyperplasia: Does Chronic Adrenocorticotropin Exposure Stimulate Up-Regulation of GIP Receptors in Cushing's Disease?
J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3009 - 3016.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. O. Goodarzi, D. W. Dawson, X. Li, Z. Lei, P. Shintaku, C. V. Rao, and A. J. Van Herle
Virilization in Bilateral Macronodular Adrenal Hyperplasia Controlled by Luteinizing Hormone
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 73 - 77.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Groussin, K. Perlemoine, V. Contesse, H. Lefebvre, A. Tabarin, P. Thieblot, J. L. Schlienger, J. P. Luton, X. Bertagna, and J. Bertherat
The Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Is Frequent in Adrenocorticotropin-Independent Bilateral Macronodular Adrenal Hyperplasia, but Rare in Unilateral Tumors
J. Clin. Endocrinol. Metab., May 1, 2002; 87(5): 1980 - 1985.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
A. Lacroix, N. N'Diaye, J. Tremblay, and P. Hamet
Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome
Endocr. Rev., February 1, 2001; 22(1): 75 - 110.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tsagarakis, S.
Right arrow Articles by Thalassinos, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsagarakis, S.
Right arrow Articles by Thalassinos, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals