| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Endocrinology, Diabetes and Metabolism (S.T., V.V., P.Tr., A.N., N.T.), Department of Surgery (T.M.) and Department of Pathology (F.S.), Evangelismos Hospital; 2nd Department of Internal Medicine, Research Institute and Diabetes Center, Athens University and Hellenic National Diabetes Center (C.T., P.Ts., S.R.); and Institute of Biology National Center for Scientific Research Democritos (H.P., D.K.), 106 76 Athens, Greece
Address all correspondence and requests for reprints to: S. Tsagarakis, M.D., Ph.D., Department of Endocrinology, Evangelismos Hospital, 106 76 Athens, Greece.
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
In summary, we describe a patient with a GIP-expressive cortisol and androgen oversecreting adrenocortical nodule with the unusual presentation of hirsutism and not the typical clinical signs of Cushing’s syndrome. It is of note that food intake in this patient provoked a substantial increase in both adrenal androgen and cortisol levels that, together with the histological appearance of this nodule, was compatible with a zona reticularis-derived tumor. Thus, aberrant expression of the GIP receptor does not exclusively involve cells of a zona fasciculata phenotype, as previously reported, but may also occur in other types of differentiated adrenocortical cells.
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
In this study, we present an atypical case of a GIP-responsive adrenocortical tumor and food-dependent steroid hormone production in a patient with clinical signs of hyperandrogenism but no signs of overt Cushing’s syndrome, on physical examination, despite an increased cortisol secretion. Moreover, atypical hormonal responses for an ACTH-independent form of cortisol excess were observed in this case. In vivo studies demonstrated food-dependent secretion of both androgens and cortisol, which was abolished by prior octreotide administration. A similar steroidogenic pattern was observed in vitro after incubation of cultured tumor cells in the presence of GIP. Concurrently, the expression of the GIP receptor was demonstrated by RT-PCR, using specific oligonucleotide probes for this receptor. To our knowledge, this is the first case demonstrating a substantial production of both adrenal androgens and cortisol by a GIP-responsive adrenocortical tumor, leading to a clinical presentation of hirsutism but no overt clinical signs of Cushing’s syndrome.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
A 41-yr-old lady was admitted for the investigation of a 4.5-cm right adrenal mass that was initially discovered during a computed tomography scan of the thorax, performed by her general practitioner, to investigate a sternum deformity, and subsequently confirmed by formal adrenal computed tomography imaging. On questioning, her major complaints were the appearance, over the last 3 yr, of episodes of facial flushing associated with nervousness, palpitations, frontal headache, and elevations of systolic blood pressure of 10-min duration, which occurred particularly in the early afternoon and were followed by a feeling of tiredness and sleepiness. Over the last 2 yr, she noticed the progressive appearance of excessive hair growth in the face, anterior thorax, abdomen, and thighs. During the same period, she also noticed, for the first time, menstrual irregularities, with menstruation occurring every 10–35 days. She had no weight gain, and there was no easy bruising. On examination, her body weight was 68 kg, with a body mass index of 25.1 kg/m2 and waist-to-hip ratio of 0.74. She had moderate hirsutism, with terminal hair in the face, the anterior thorax, the abdomen, and the thighs (Ferimman score, 15). She was not Cushingoid (skin was not atrophic and there was no buffalo hump or cervicodorsal fat pads, no striae, and no muscle weakness). Palpation of the thyroid revealed the presence of a left-sided lump of 2.5-cm diameter. She was clinically euthyroid.
Urinary VMA, metanephrines, and 5-HIAA were normal on 2 separate days (VMA, 20 and 18.5 µmol/24 h; normal range, less than 35; Metanephrines, 1.33 and 1,32 µmol/24 h; normal range, less than 4.6; and 5-HIAA, 20 and 22 µmol/24 h; normal range, less than 75). Her plasma supine aldosterone concentration was 518 pmol/L (normal range, 135–400), active renin was 21 µU/mL (normal range, 5–47), and a normal response to 42 µU/mL (normal range, 7–76) was observed on rising. Her plasma potassium concentration was 4.4 mmol/L. Androgen levels were slightly elevated in morning fasting samples; DHEA, 46 nmol/L (normal range, 2.8–36); dehydroepiandrosterone sulfate, 13.3 µmol/L (normal range, 3–12); testosterone, 4.6 nmol/L (normal range, less than 3); androstenedione, 14.9 nmol/L (normal range, 3–8). Her SHBG was 33 nmol/L (normal range, 20–100). Urinary free cortisol was elevated, 416 nmol/24 h (normal range, 27.6–250). The ACTH level was 10 pmol/L at 0800 h (normal range, 2–18). The plasma cortisol concentration was 110 nmol/L at 0800 while fasting (normal range, 330–830), 582 nmol/L at 1800 h, and 185 nmol/L at midnight during a day with regular food consumption. This latter finding of an unusual cortisol diurnal rhythm raised the possibility of an aberrant-type of stimulation of cortisol production by the adrenal tumor. The rest of her laboratory examination was within normal limits, except for a suppressed TSH level, with total T3 of 2.73 nmol/L (normal range, 1–3) and total T4 level of 117 nmol/L (normal range, 58–160), associated with the presence of a scintigraphically warm thyroid nodule. The Z-scores for spinal and femoral bone mass densities, measured by dual x-ray absorptiometry, were -1.4 and -1.6, respectively.
The patient underwent further testing, with an oral glucose tolerance
test (OGTT), upright-posture, and lys-vasopressin administration after
dexamethasone pretreatment (Fig. 1
). An
aberrant cortisol response to OGTT was observed, which raised the
possibility of a GIP-induced steroid hormone-producing mass, and
further testing was performed to confirm this hypothesis. Furthermore,
in view of the lack of signs of hypercortisolemia and the presence of
signs of hyperandrogenism, the possibility of food-induced androgen
production was also investigated.
|
).
Postoperatively, cortisol and androgen levels were undetectable and did
not show any rise after meals or during the OGTT. In view of the
appearance of hypocortisolemic symptoms, the patient was put on
hydrocortisone replacement. At her latest follow-up, 6 months post
operation, the patient experienced marked improvement in her hirsutism
but still required hydrocortisone replacement. There was no
meal-induced androgen or cortisol production.
|
Hormone assays. Plasma cortisol was measured by RIA (Coat-A-Count, Diagnostic Products, Los Angeles, CA). Urinary free cortisol was measured by RIA after dichloromethane extraction. Plasma ACTH was measured by immunoradiometric assay (Nichols Institute Diagnostics, San Juan Capistrano, CA). Androgen levels were measured by RIAs: DHEA (Diagnostic Systems Laboratories, Inc., Webster, TX), androstenedione (Diagnostic Systems Laboratories, Inc.), testosterone (CIS-Bio International, Yvette Cedex, France), and DHEA-S (Coat-A-Count, Diagnostic Products). Plasma 17-OH progesterone was measured by RIA (Biosource Technologies, Inc., Nivelles, Belgium).
Cell isolation and culture. A fragment of the tumor was transferred to the laboratory within 1 h after removal. The tissue was minced into small pieces, and the adrenal cells were dispersed after digestion with 3 mg/mL collagenase (CLS, 148 U/mg, Biochrom KG, Berlin, Germany) at 37 C for 30 min. Subsequently, the cells were cultured in DMEM at a density of 5 x 105 cells/mL in a humidified chamber, at 37 C, in a 5% CO2-95% air atmosphere. Incubations without or with the test substances were performed in triplicate. After a 2-h incubation period, the supernatants were collected and stored at -20 C until assayed. The following substances were added: ACTH-(1–24) (Synacthen, Ciba-Geigy, Basel, Switzerland) and human GIP (Sigma, St. Louis, MO) in final concentrations of 10-11–10-8 mol/L. Measurements of cortisol in the supernatant were performed by a sensitive immunofluorometric assay (Chiron Corp., East Walpole, MA). DHEA was measured by RIA (Diagnostic Systems Laboratories, Inc.).
RNA preparation and RT-PCR. Total RNA was isolated separately from the excised tumor and adjacent normal adrenocortical tissue, using the TriPure Isolation reagent (Roche Molecular Biochemicals, Mannheim, Germany). The integrity of RNA samples was determined on agarose gels (1.2%) and spectophotometrically, using the absorption ratio at 260/280nm. The RNA quantification was done by measuring the absorption at 260 nm. For the removal of any residual DNA contamination, RNA samples were preincubated with deoxyribonuclease (Promega Corp.) at 37 C for 25 min and then at 65 C for 5 min, before the RT and PCR method. Four micrograms of total RNA from the tumor and the normal cortex were reverse transcribed, using random hexanucleotide (200 pmol, Biolabs, Hertfordshire, UK), M-MLV reverse transcriptase (400 U, Promega Corp., Madison, WI), Rnasin inhibitor (20 U, Promega Corp.), and deoxynucleotide triphosphates (0.4 mmol/L) at 37 C for 90 min. This was followed by the addition of 400 U of M-MLV to the reaction, and the incubation was continued for another 90 min. The RT reaction was terminated with the addition of 3 U of Rnase H (Life Technologies, Inc., Paisley, UK) for 30 min at 37 C. The PCR reaction (35 cycles) was subsequently performed in a final vol of 25 µL, using 20 pmol of each primer, and 5 U of Taq polymerase (Promega Corp.) at 94 C for 30 sec, 60 C for 30 sec, and 68 C for 55 sec. PCR reactions were also performed in RNA samples before RT, to exclude DNA contamination.
Primer design A set of specific primers [5'-oligonucleotide ATCCGCATTCTTGGCATTCTCCTG (1037–1060) and 3'-oligonucleotide ATGCTAACTGAACAGACACGGGGA (1527–1504)] were used to amplify a 491-bp PCR product from the GIP receptor messenger RNA (mRNA) transcript (GenBank accession no. S79852). A second set of primers [5'-oligonucleotide GTCCAAGTAACATCCCCGCCTTAACCA (657–684) and 3'oligonucleotide GAGTCGATGATGTCATCGGC (1018–999)] that recognized and amplified a PCR product of 361 bp in the human ACTH receptor mRNA (GenBank accession no. X65633) were also used, as previously described (13).
Enzyme restriction The RT-PCR product was digested at 37 C with XbaI for 1-h, and the product was run on 1.3% agarose gel and stained with ethidium bromide. XbaI was predicted to cut the GIP receptor PCR product, at positions 1188 and 1402, into 3 fragments (215, 152, and 124 bp).
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Endocrine testing demonstrated meal-induced hypercortisolemia and
hyperandrogenemia, with lower levels of these hormones being observed
during fasting. Figure 3 shows the plasma
cortisol and ACTH profiles (measured at 1- to 2-h intervals) during a
day when the patient took regular meals and during a day of fasting, up
to 1800 h, when a meal was allowed. Figure 4 shows the corresponding androgen
(DHEA, androstenedione, testosterone) and
17-hydroxyprogesterone levels. Persistently decreased cortisol and
androgen levels were found during fasting, followed by a cortisol and
androgen rise when the patient was allowed to eat at 1800 h. In
contrast, during the day of a regular food intake, a rise of both
cortisol and androgen levels was observed after each meal. Levels of
17-hydroxyprogesterone also increased after each meal, but there was
not a preferential increase suggestive of 21-hydroxylase deficiency.
There was no change of aldosterone levels after meals (basal, 517;
highest value following meal, 332 nmol/L). ACTH levels were detectable
in the early morning samples and showed a decrease, during the rest of
the day, that was unrelated to food intake (Fig. 3).
|
|
Plasma cortisol was suppressed after the low-dose dexamethasone suppression test (postdexamethasone 0900 h cortisol, 36 nmol/L). Administration of ACTH was associated with a 16-fold cortisol, a 16-fold androstenedione, and a 3-fold testosterone rise, compared with basal levels. The peak 17-OH-progesterone response after ACTH administration was 18.8 nmol/L. She had a normal ACTH response after administration of 100 µg iv bolus human CRH (basal, 7; to a peak, 19.8 pmol/L) associated with a cortisol rise from 174 to 350 nmol/L.
Effect of octreotide
The meal-induced rise of cortisol and androgens was blocked by the
prior administration of octreotide. Figure 5 shows the effect on cortisol and
DHEA of 200 µg octreotide (Novartis Pharmaceuticals, Basel, Switzerland), given sc, 1 h before
a standard meal. The administration of octreotide completely abolished
the cortisol and DHEA rise produced by food intake.
Similar results were obtained with the other androgens measured (data
not shown).
|
Adenoma cells in culture produced measurable amounts of
DHEA but only barely detectable amounts of cortisol under
basal conditions. After incubation with incremental concentrations of
GIP, a sharp rise in both cortisol and DHEA release was
observed at a concentration of GIP of
10-8 mol/L, which was more
pronounced for the latter. After ACTH stimulation, a gradual increment
in the production of both cortisol and DHEA was observed,
which was again higher in the case of DHEA (Fig. 6).
|
Using specific primers for the GIP receptor, a single band of the
expected size (
500) was observed after RT-PCR in the adenoma but not
in the adjacent normal adrenal tissue (Fig. 7). By contrast, using specific primers
for the ACTH receptor, a single band of the expected size (360) was
observed in both the adenoma and normal adrenal tissue
(12). PCR, without prior RT, detected no message of GIP
receptor in the adenoma. The specificity of the PCR signal was
confirmed by enzyme restriction with XbaI, which cleaved, as
predicted, the PCR product at two sites, giving three smaller fragments
of approximately 215, 152, and 124 bp.
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Despite the typical characteristics for a GIP-expressive adrenocortical tumor, the clinical presentation, the hormonal investigation findings, and the steroidogenic secretory pattern of this patient rendered the case of particular interest. It is of note that she was initially referred because of an otherwise incidentally discovered right adrenal mass. Physical examination revealed only moderate hirsutism but no overt clinical signs of Cushing’s syndrome. In particular, there was no central obesity, no buffalo hump, and no facial plethora. Also, signs related to the protein-wasting effects of cortisol (skin thinning, striae, and muscle wasting) were absent. Thus, from a clinical standpoint, this case indicates that suspicion of a GIP-responsive adrenocortical tumor should not be restricted only to patients with overt clinical signs of Cushing’s syndrome. It should be noted, however, that in retrospect, several of the patient’s symptoms could have been ascribed to cortisol excess. Thus, the episodic elevations of blood pressure in the early afternoon, followed by a feeling of tiredness, could have been attributed to the lunch-induced elevations of cortisol levels. Also, despite the lack of clinical stigmata of Cushing’s syndrome, the patient presented with relatively low bone mass density. Indeed, it has now been increasingly recognized that even mild cortisol excess, in the absence of full-blown florid appearance of Cushing’s syndrome, may have detrimental actions.
The laboratory findings obtained in this patient were atypical for an ACTH-independent cortisol-secreting adrenal adenoma (15, 16). Unlike previous case reports (1, 2, 3, 4, 5, 6, 7, 8, 9), our patient had unsuppressed morning ACTH levels and suppressed fasting cortisol levels after dexamethasone suppression. Moreover, bolus CRH administration resulted in an almost-normal ACTH and cortisol response. Interestingly, a similar ACTH and cortisol response to CRH administration was recently reported by Croughs et al. (10) in a patient with GIP-dependent bilateral adrenal hyperplasia and typical clinical signs of Cushing’s syndrome. It might, therefore, be suggested that the intermittent nature of food-induced cortisol secretion does not always result in complete suppression of the HPA axis; and, depending on the degree of nonsuppression, atypical laboratory findings can be obtained that may render the correct identification of food-induced hypercortisolemia extremely difficult. In our case, suspicion of aberrant receptor expression was only provided by the finding of an unusual diurnal rhythm pattern of cortisol levels and was subsequently confirmed by a meal test. However, these tests are not routinely involved in the work-up of suspected hypercortisolism.
A novel finding in this case was the substantial increase in both androgen and cortisol levels associated with food-consumption. The elevations of the major adrenal androgens DHEA and androstenedione paralleled those of cortisol after food ingestion, indicating cosecretion of these steroids by the tumor. Testosterone, which originates mainly from peripheral conversion of the above androgens, was also significantly elevated in the postmeal period and underlined the development of hirsutism, which was the predominant clinical manifestation in our patient. Glucocorticoids and androgens originate from common precursors. Enzymatic blocks in the glucocorticoid synthetic pathway, in particular of CYP21, have been associated with androgen overproduction from adrenal adenomas (17). However, based on the degree of 17-hydroxyprogesterone rise after ACTH stimulation in our patient, it is unlikely that an enzymatic block was responsible for the androgen overproduction by the tumor. Instead, it is most likely that the production of DHEA and androstenedione in this tumor was mediated through a preferential 17,20-lyase activity of CYP17 enzyme complex, which occurs only in the zona reticularis (18). The ability, therefore, of the tumor studied to release substantial amounts of adrenal androgens is compatible with a zona reticularis phenotype, and this was also suggested by the histological findings. It is of note that, in all previous cases of GIP-responsive adrenal adenomas or bilaterally enlarged adrenals, cortisol was the predominant steroid released, indicating that aberrant expression of GIP receptor involves mainly adrenocortical cells with a zona fasciculata phenotype (8). However, our findings in this case indicate that adrenocortical tumors overexpressing the GIP receptor are not exclusively of a zona fasciculata phenotype and may occur in reticularis and possibly other types of differentiated adrenocortical cells. It should be noted that comparable variations in the steroidogenic secretory pattern have also been observed in some cases of adrenal hyperfunction caused by ectopic adrenal expression of receptors other than GIP. Thus, testosterone secretion was reported by an ectopic LH/HCG receptor expressive adenoma (17); whereas, in the case of ectopic LH/HCG and serotonin 5-HT4 receptor expressive adenoma [reported by Lacroix et al. (19)], free testosterone levels were stimulated by both LH and serotonin, estradiol was stimulated by LH, and aldosterone was stimulated by serotonin agonists. Also, in a patient with ß-adrenergic receptor-aberrant expression, isoproterenol stimulated both cortisol and aldosterone production (20). It is thus probable that the pattern of steroid production depends more on the cell of origin, rather than on the nature of the ectopic receptor.
In conclusion, this is the first report of a GIP receptor-expressive adrenocortical tumor with a steroidogenic secretory pattern and histological appearance of a zona reticularis-derived tumor. This finding indicates that aberrant expression of GIP receptor does not exclusively involve adrenocortical cells of a zona fasciculata phenotype but may occur in other types of differentiated adrenocortical cells. It is therefore suggested that a search for GIP receptor-expressive adenomas should not be restricted only in patients with clinical features of Cushing’s syndrome, because (depending on the tumor cell-type) androgen or other adrenal steroids may be predominantly released after food consumption. So far, no case of pure androgen or mineralocorticoid food-induced hypersecretion has been described, but a search by specific testing may lead to the description of such entities in the future.
Received February 21, 2000.
Revised August 2, 2000.
Revised October 6, 2000.
Accepted October 19, 2000.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
-hydroxylase/17,20-lyase cytochrome P450 (P450) and
NADPH-cytochrome P450 reductase (reductase) but not 3ß-hydroxysteroid
dehydrogenase/
5–4 isomerase (3ß-HSD). J Clin Endocrinol
Metab. 84:3382–3385.This article has been cited by other articles:
 |
|
 |
|
  A. Lampron, I. Bourdeau, S. Oble, A. Godbout, W. Schurch, P. Arjane, P. Hamet, and A. Lacroix Regulation of Aldosterone Secretion by Several Aberrant Receptors Including for Glucose-Dependent Insulinotropic Peptide in a Patient with an Aldosteronoma J. Clin. Endocrinol. Metab., March 1, 2009; 94(3): 750 - 756. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. H. S. Costa, A. C. Latronico, R. M. Martin, A. S Barbosa, M. Q Almeida, C. F. P. Lotfi, H. P Lima Valassi, M. Y. Nishi, A. M. Lucon, S. A. Siqueira, et al. Expression profiles of the glucose-dependent insulinotropic peptide receptor and LHCGR in sporadic adrenocortical tumors J. Endocrinol., February 1, 2009; 200(2): 167 - 175. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N M Albiger, G Occhi, B Mariniello, M Iacobone, G Favia, A Fassina, D Faggian, F Mantero, and C Scaroni Food-dependent Cushing's syndrome: from molecular characterization to therapeutical results Eur. J. Endocrinol., December 1, 2007; 157(6): 771 - 778. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. L. Mazzuco, O. Chabre, N. Sturm, J.-J. Feige, and M. Thomas Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Gene Is a Sufficient Genetic Event to Induce Benign Adrenocortical Tumor in a Xenotransplantation Model Endocrinology, February 1, 2006; 147(2): 782 - 790. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Baldacchino, S. Oble, P.-O. Decarie, I. Bourdeau, P. Hamet, J. Tremblay, and A. Lacroix The Sp transcription factors are involved in the cellular expression of the human glucose-dependent insulinotropic polypeptide receptor gene and overexpressed in adrenals of patients with Cushing's syndrome J. Mol. Endocrinol., August 1, 2005; 35(1): 61 - 71. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. M. Swords, S. Aylwin, L. Perry, J. Arola, A. B. Grossman, J. P. Monson, and A. J. L. Clark The Aberrant Expression of the Gastric Inhibitory Polypeptide (GIP) Receptor in Adrenal Hyperplasia: Does Chronic Adrenocorticotropin Exposure Stimulate Up-Regulation of GIP Receptors in Cushing's Disease? J. Clin. Endocrinol. Metab., May 1, 2005; 90(5): 3009 - 3016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. O. Goodarzi, D. W. Dawson, X. Li, Z. Lei, P. Shintaku, C. V. Rao, and A. J. Van Herle Virilization in Bilateral Macronodular Adrenal Hyperplasia Controlled by Luteinizing Hormone J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 73 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Groussin, K. Perlemoine, V. Contesse, H. Lefebvre, A. Tabarin, P. Thieblot, J. L. Schlienger, J. P. Luton, X. Bertagna, and J. Bertherat The Ectopic Expression of the Gastric Inhibitory Polypeptide Receptor Is Frequent in Adrenocorticotropin-Independent Bilateral Macronodular Adrenal Hyperplasia, but Rare in Unilateral Tumors J. Clin. Endocrinol. Metab., May 1, 2002; 87(5): 1980 - 1985. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lacroix, N. N'Diaye, J. Tremblay, and P. Hamet Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome Endocr. Rev., February 1, 2001; 22(1): 75 - 110. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
