| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
From the Clinical Research Centers |
2 Pro12Ala Variant on Obesity, Glucose Homeostasis, and Blood Pressure in Members of Familial Type 2 Diabetic Kindreds1
Department of Human Genetics, University of Utah (S.J.H.), Salt Lake City, Utah 84112-5330; and Division of Endocrinology, Department of Medicine, Central Arkansas Veterans Healthcare System and University of Arkansas for Medical Sciences (Q.-F.R., K.T., S.C.E.), Little Rock, Arkansas 72205
Address all correspondence and requests for reprints to: Steven C. Elbein, M.D., Endocrinology 111J/LR, 4300 West 7th Street, Little Rock, Arkansas 72205. E-mail: elbeinstevenc{at}exchange.uams.edu
| Abstract |
|---|
|
|
|---|
2 (PPAR
) been
variably associated with obesity, insulin sensitivity, diabetes, and
dyslipidemia, but its role in insulin resistance-associated traits
remains uncertain. We tested the hypothesis that this variant is
associated with the insulin resistance syndrome by genotyping 619
members of 52 familial type 2 diabetes kindreds. A subset of 124 family
members underwent iv glucose tolerance tests and minimal model
determination of insulin sensitivity. We estimated the frequency of the
A12 allele as 0.12, within the range observed in random Caucasian
samples. We were unable to demonstrate any effect on direct measures of
insulin sensitivity, and no trait was linked to markers near PPAR
on
chromosome 3q. However, body mass index, serum total cholesterol
levels, triglyceride levels, systolic and diastolic blood pressures,
and glucose concentration showed at least a trend to association
(P < 0.1) when tested separately for a
family-based association. When these 6 traits were included in a
multivariate analysis, body mass index, systolic and diastolic blood
pressures, triglyceride levels, and glucose concentration remained
significantly associated with the P12A variant (P
< 0.05), whereas the effect of P12A on liability for diabetes was not
significant. The predicted means for each trait and each genotype
suggested that the P12A variant acted most like a recessive mutation,
with the major effect among homozygous individuals who comprise only
12% of the population. We confirm an association of the P12A variant
in traits commonly ascribed to the insulin resistance syndrome, but not
with direct measures of insulin sensitivity. The tendency for this
variant to act in a recessive manner with effects on multiple traits
may explain the inconsistent associations noted in previous studies. | Introduction |
|---|
|
|
|---|
The peroxisome proliferator-activated receptors (PPARs) are members of
the nuclear hormone receptor subfamily of transcription factors. The
PPAR
subtype is involved in adipocyte differentiation and is the
target for the thiazolidinedione class of antidiabetic drugs
(7), which appears to act primarily by increasing
peripheral insulin sensitivity. PPAR
comprises two isoforms,
PPAR
1 and PPAR
2,
which differ by 84 nucleotides and 28 amino acids at the 5'-end of the
gene. Both isoforms are expressed in adipocytes, but
PPAR
2 expression is largely limited to
adipocytes, appears to have 5- to 10-fold increased ligand-independent
activation compared with PPAR
1, and may be the
more important regulator of adipocyte differentiation and energy
storage (7).
In recent studies mice heterozygous for inactivation of the PPAR
gene showed improved insulin sensitivity of both liver and peripheral
tissues compared with wild-type mice, suggesting that reduced PPAR
expression improved insulin sensitivity (8). In contrast,
recently described naturally occurring human substitutions P467L and
V290M, which inhibit PPAR
trans-activation in a dominant
negative fashion, cause insulin resistance, hypertension,
hypertriglyceridemia, and early-onset diabetes (9). Other
mutations of PPAR
(Pro115Gln) appear to cause
severe obesity, consistent with the key role proposed for PPAR
in
adipocyte differentiation (10). Thus, rare human variants
and experimental models support a key role for PPAR
in the
modulation of insulin sensitivity, obesity, hypertension, and
triglyceride (TG) levels.
In contrast to rare PPAR
variants, Yen et al.
(11) described a common variant,
Pro12Ala (P12A), in an alternatively spliced exon
B of the PPAR
2 isoform. This variant is
present in most populations. In population-based studies, Beamer
(12) subsequently reported an association of the P12A
allele with higher body mass index (BMI), higher waist to hip ratio,
higher waist circumference, and possibly altered lipid profile. Deeb
et al. (13), on the other hand, reported that
the same allele was associated with improved insulin sensitivity, lower
insulin levels, and lower BMI in middle-aged Finnish men and women and
found a similar trend in elderly Finns and Japanese Americans. The P12A
variant appears to have reduced trans-activation capacity
(14). Meirhaeghe et al. (15)
suggested that P12A altered the relationship between leptin and
adiposity. Subsequent studies of the P12A variant have found variable
effects on obesity, lipids, and glucose homeostasis. Several studies
were unable to replicate the association with these traits
(16). Valve et al. (17) found no
association with obesity, but a higher BMI among obese women with the
variant. Ek et al. (18) found a variable effect
on BMI depending on the subjects level of obesity. Knoblauch et
al. (19) found both linkage to and association with
high density lipoprotein cholesterol levels, low density lipoprotein
cholesterol concentration, and BMI in healthy, nonobese dizygotic
twins. Koch et al. (20) found no effect in
offspring of diabetic subjects, but reported an association of the P12A
allele with improved insulin sensitivity in obese subjects. Thus, the
role of this variant is unclear and controversial. We are unaware of
published studies that have used a family-based association strategy in
familial T2DM to address these questions.
We used a multivariate, family-based likelihood approach to test the
role of the PPAR
2 P12A variant on quantitative
traits related to obesity, glucose homeostasis, lipids, and blood
pressure. In the present study we examined 619 nondiabetic members of
52 families that were ascertained for at least 2 siblings with T2DM.
Using this approach, we confirm that the common P12A variant of
PPAR
2 impacts traits commonly associated with
the insulin resistance syndrome in members of families with a strong
history of T2DM.
| Experimental Subjects |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
All nondiabetic family members underwent a standard 75-g oral glucose tolerance test after an overnight fast. Both insulin and glucose were measured at baseline, 30, 60, 90, and 120 min using a protocol previously described (22). Weight was measured on a digital scale, and height was measured by a wall-mounted stadiometer. Waist circumference was determined as the mean of 3 measurements at the umbilicus, and hip as the mean of 3 measurements at the greatest diameter (22). Systolic and diastolic blood pressure were determined as the mean of three measures at 30-s intervals with the subject sitting quietly and the cuff deflated between measures (22). All subjects had fasting levels of total cholesterol (TC) and TG determined. Insulin and glucose levels at 30 min and waist and hip measures were not available for many subjects tested early in the study. A subset of 124 individuals underwent frequently sampled iv glucose tolerance testing as described previously (23), with determination of insulin sensitivity, acute insulin response to glucose, and disposition index.
Quantitative indices
Insulin was measured by RIA in one of two laboratories, as described previously (22, 24). Glucose was measured by the glucose oxidase method. Lipids were measured by standard methods. Leptin was measured in a subset of families by RIA (Amgen, Inc. Thousand Oaks, CA). BMI was calculated as weight (kilograms)/height (meters)2; the waist/hip ratio was calculated as the mean waist circumference divided by the mean hip circumference (22). Insulin sensitivity was determined by minimal model calculation of the insulin sensitivity index (SI) from iv glucose tolerance test data (22). For all other nondiabetic individuals, insulin sensitivity was determined from the homeostatic model assessment (HOMA) as the product of baseline (fasting) insulin and glucose (25).
Genotypic analysis
Genotype at position 12 in exon B of the
PPAR
2 isoform was determined in 580 members of
52 families. Genotypes were unambiguously inferred for an additional 39
family members. Enzymatic amplification was performed using
Taq polymerase and primers GCCAATTCAAGCCCAGTC (forward) and
GATATGTTGCAGACAGTGTATCAGTGAAGGAATCGCTTTCCG (reverse), with annealing
temperature of 66 C for 10 cycles and 62 C for 20 cycles. The
amplification product was digested with 10 U BstUI
(New England Biolabs, Inc., Gaithersburg, MD) for 4 h
at 60 C, separated on 2% agarose (1:2, NuSieve-Seakem, FMC
Bioproducts, Rockland, ME), and detected with ethidium bromide staining
(11, 26).
Statistical analysis
The areas under the insulin and glucose curves were estimated
using the trapezoidal rule, including only individuals for whom
measurements were available at 0, 30, 60, 90, and 120 min. Homeostatic
model of insulin resistance (HOMA-IR) was computed as the
product of fasting insulin and fasting glucose. A surrogate measure of
insulin secretion was computed as (60 min insulin - fasting
insulin)/60 min glucose, because this measure was available for all
individuals and showed the best correlation of available measures with
both the widely used
30 min insulin/
30 min glucose and the acute
insulin response to iv glucose (unpublished data; r = 0.70 and
0.42, respectively). Values for insulin area, HOMA-IR, insulin
secretion, leptin, TG, and cholesterol were natural logarithm
transformed to normality. Each quantitative variable or transformed
variable was adjusted for gender and age; insulin area, HOMA-IR, and
insulin secretion were also adjusted for the laboratories in which the
insulin measurements were made.
The effect of the P12A variant on each trait of interest was evaluated
using likelihood analysis (27). We used this likelihood
analysis to estimate the allele frequency and to test for an effect of
the P12A variant on each of the quantitative variables related to
obesity, glucose homeostasis, or the insulin resistance syndrome and on
liability to T2DM. We first performed a bivariate analysis of T2DM and
each quantitative variable (trait) individually (Table 1
). Then we performed a multivariate
analysis including T2DM and the six quantitative traits for which the
initial bivariate analysis supported an effect of the P12A variant. By
including T2DM in the model, we could account for age of onset and
gender while evaluating PPAR
genotype effects on T2DM liability. For
each bivariate and multivariate model, we tested the null hypothesis of
no genetic effect of the P12A variant by comparing the likelihood of a
submodel in which parameters were set to remove a genetic effect to a
general model in which all parameters were maximized.
|
ij), where i and j designate traits that
include both the adjusted quantitative variables under study and the
liability to T2DM. The displacement is the difference between the trait
means for the two homozygous genotypes, expressed as within-genotype
SD. The dominance is the ratio of the difference in trait means between
the heterozygous individuals and individuals homozygous for the P12/P12
genotype to the difference in trait means between the two homozygous
genotypes. The heritability is the proportion of the within-genotype
variance due to polygenes. The correlation is between the
within-genotype variation for two variables (traits). This model is
similar to one that we described previously (23).
For each trait, we tested the hypothesis of no genetic effect of
PPAR
by setting both dominance (di) and
displacement (ti) to 0 for that trait. We then
compared the maximized likelihood with these constraints to the
likelihood of the general model in which no constraints were imposed.
When no P12A homozygotes were available for a trait, the dominance was
fixed at 1, and only the displacement was tested; thus, if no P12A
homozygotes were observed for a trait, the test had only 1 df.
Otherwise, both di and ti
were estimated, and the test had 2 df. For traits in which diabetic
pedigree members were excluded from the analysis, these individuals
were considered to be unknown (missing values) for that quantitative
trait. For the multivariate analysis, we sequentially tested each of
the six traits included in the model by setting dominance and
displacement to 0 for that trait while allowing these parameters to
vary for all other traits. As in the bivariate analysis, each of the
six submodels was then compared with the most general model in which
all trait parameters were maximized.
We used the Pedigree Analysis Package (28) to calculate
the likelihood; likelihoods were maximized using the GEMINI program
(29). We estimated each parameter as the value that
maximized the likelihood. Hypotheses were tested for each trait by
computing
2 statistics as twice the natural
logarithm of the ratio of the maximized likelihood of the general model
(all parameters estimated) to the maximized likelihood of the submodel
for that trait (displacement and dominance fixed at 0 for that trait).
Because we tested families ascertained for two diabetic siblings, we
corrected our calculated likelihood estimate for this ascertainment by
dividing it by the probability that we would observe a sibling pair
diagnosed with T2DM in the general population under that analytical
model.
We incorporated T2DM into our multivariate model by assuming that an
unmeasurable quantitative liability variable underlies T2DM
susceptibility (30). That liability was distributed as a
mixture of three multivariate normal densities (31). The
area for each of these three curves was determined by the PPAR
genotype, and genotype frequencies were determined from allele
frequencies under the assumption of Hardy-Weinberg equilibrium. The
total liability for each age bracket was taken from the age-, gender-,
and obesity-specific figures of Melton et al.
(32). The population incidence of T2DM at any age was thus
determined by the sum of the areas of each of the three
genotype-determined curves at that age. Individuals at younger ages had
correspondingly higher liabilities.
| Results |
|---|
|
|
|---|
We tested each of the quantitative variables related to glucose
tolerance, insulin sensitivity, obesity (BMI, waist circumference,
waist/hip ratio, leptin), and the insulin resistance syndrome
(cholesterol, TG, blood pressure) for linkage to marker D3S1263, which
is located only 1.5 Mb from PPAR
(33). No trait
showed significant linkage using the variance component approach
implemented in the SOLAR algorithm (34) (data not shown).
The highest LOD score obtained was 0.88 for TG levels. The
absence of support for linkage is consistent with a small effect size
for the PPAR
gene.
Direct measures of insulin secretion as acute insulin response to glucose (AIRg), insulin sensitivity as insulin sensitivity index (SI), and ß-cell compensation to insulin resistance (disposition index = SI x AIRg) were available for 124 family members who underwent iv glucose tolerance testing (23). No significant effect of the P12A variant was found for any of these variables using either the multivariate model described above (Materials and Methods) or a mixed effect model that included family membership as a random factor (35).
Each trait in Table 1
was then tested in a bivariate analysis.
Variables that attained significance at P < 0.1 were
subsequently included in the multivariate analysis (Table 2
). BMI, systolic blood pressure,
diastolic blood pressure, TG, and glucose area under the curve retained
significance in the multivariate model, whereas TC was no longer
significant when all variables were included in the model. These
results suggested that P12A may act indirectly on TC through correlated
variables, thus explaining the weak effect noted in the bivariate
analysis. In support of this possibility we found a correlation between
TC and TG in the full sample of 0.34 (P < 0.001).
|
2(4) = 2.40;
P > 0.05). Our inability to detect a significant
effect on diabetes liability may have resulted from the small number of
A12 homozygous individuals. | Discussion |
|---|
|
|
|---|
activity suggest that reduced
PPAR
function results in glucose intolerance, hypertension, insulin
resistance, and hypertriglyceridemia (9). On the other
hand, the Pro115Gln mutation appears to inhibit
phosphorylation at Ser114, increases PPAR
activity, leads to fat accumulation in vitro, and is
associated with obesity in carriers of the mutation. Furthermore, mice
heterozygous for a null allele of PPAR
show increased, rather than
reduced, insulin sensitivity (8). Thus, even in rare human
mutations, in vitro experiments, and experimental mouse
models, the phenotypic effects of PPAR
variants are difficult to
predict. Complex interactions may explain these variable results,
including the apparently variable effects of the more common P12A
variant despite in vitro evidence for reduced activity of
the P12A allele.
Like others, we found no evidence that the P12A variant plays a role in
susceptibility to T2DM. First, we observed no evidence of linkage in
this region to T2DM (23). Second, we observed no increase
in the frequency of the P12A allele above randomly selected Caucasian
individuals. Finally, we observed no significant effect on diabetes
liability in our multivariate model. Nonetheless, the prevalence of
diabetes was increased among P12A homozygous individuals, and P12A was
associated with a significant effect on glucose area. A larger study
with more P12A homozygous individuals might detect a significant
effect, but other large studies likewise found no association of P12A
with diabetes (16, 36). We were also unable to demonstrate
an effect on insulin sensitivity, measured directly using the minimal
model or using the surrogate measures fasting insulin and HOMA-IR. We
may have lacked the power to detect an effect in the subset of
individuals who underwent iv glucose tolerance testing, and surrogate
measures show a correlation of only r = 0.6 with direct measures
of insulin sensitivity (37). Deeb (13)
suggested improved insulin sensitivity with this variant, and Koch
et al. (20) suggested improved insulin
sensitivity among obese subjects. However, both results appear
inconsistent with the observation that the P12A allele has reduced
trans-activation in vitro. In contrast, PPAR
agonists improve insulin sensitivity by activating PPAR
(7). This paradox may result from an interaction of the
PPAR
variant and obesity (18). Alternatively, P12A
could be in linkage disequilibrium with an undiscovered variant
elsewhere in the gene, and both the strength and the direction of that
association might vary among populations.
Although we could not demonstrate an effect of the P12A variant on insulin sensitivity, we found an effect of the P12A variant on several traits that are associated with the insulin resistance syndrome: BMI, blood pressure, TG levels, and glucose tolerance as manifest by an increased glucose area. In this study the P12A variant acted more like a recessive than a dominant mutation; mean values for P12/A12 heterozygous individuals were closer to those for P12 homozygous individuals than to A12/A12 homozygous individuals. Unfortunately, our sample contained only 10 A12 homozygous individuals, and of these 10 the 7 diagnosed with T2DM were excluded from many analyses. A primary effect in these rare A12 homozygous individuals might explain our failure to find significant effects in other variables as well as the failure of other studies (16) to find an effect of the P12A allele or to find an effect in a different direction (13). Nevertheless, the effect of P12A was not completely recessive, as heterozygous individuals had trait values elevated over those of P12 homozygous individuals in our population. Indeed, the impact of P12A on glucose area was apparent without inclusion of any homozygous A12 individuals.
Of all the variables tested, the P12A genotype had the greatest effect
on TG levels. Correspondingly, significance was also highest for TG
despite the reduced sample size that resulted from excluding pedigree
members diagnosed with T2DM from this analysis. TC exhibited a similar
trend, but did not achieve significance. This effect may have resulted
from a correlation with TG (
= 0.35), rather than any direct
effect of P12A on TC. Other investigators also reported an effect of
P12A on TG. Knoblauch et al. (19) found both
linkage of TG to the PPAR
gene and an association of TG with the
specific P12A allele in healthy, nonobese siblings. Beamer et
al. (12) found increased TG among P12A carriers, but
only in obese men. TG levels were also elevated by severe dominant
negative mutations in PPAR
(9). However, others were
unable to find any effect on TG (26). The P12A allele also
significantly increased both systolic and diastolic blood pressure.
Hypertension is part of the insulin resistance syndrome in Caucasians
(38) and was reported by Barroso et al.
(9) among carriers of dominant negative PPAR
mutations.
Furthermore, thiazolidinediones lower blood pressure in Japanese T2DM
subjects (39). However, others found no significant
association of P12A with blood pressure (26).
We found an effect of P12A on BMI that was of similar magnitude to the effect on blood pressure. The P12A allele has been reported previously to increase BMI (12) and to increase BMI among obese Caucasian subjects (17). However, others reported either decreased BMI (13, 18) or no effect on obesity (19, 26, 36). In contrast with some studies (12), we found no effect of the P12A allele on either waist circumference or waist to hip ratio. However, this measure was not available in all family members, and our power was thus more limited than for BMI.
We previously reported (40) evidence of two recessive
obesity loci in a subset of these pedigrees that increased the mean BMI
in homozygous individuals to 32 kg/m2 and 39
kg/m2, respectively. PPAR
does not appear to
represent either of these loci. In contrast to the predicted recessive
obesity loci, the P12A allele increased the mean BMI to only 27.5
kg/m2 for heterozygous individuals and 30
kg/m2 for A12 homozygous individuals.
Furthermore, using the two locus recessive model, we rejected linkage
to microsatellite marker D3S1263 at 1% recombination fraction, with
LOD scores of -1.37 for the moderate obesity locus and -6.67
for the extreme obesity locus. D3S1263 is only 1.5 Mb from
PPAR
(33). We also rejected linkage of BMI to this
region using the relatively model-independent variance components
method. In contrast, Knoblauch et al. (19) did
find linkage of the PPAR
gene to BMI in normal siblings.
Another PPAR
variant, a C to T substitution in exon 6, showed
similar frequency and effects on BMI as P12A in some studies
(17). Because this variant is in strong linkage
disequilibrium with P12A (17), is synonymous
(i.e. does not alter an amino acid), and thus is probably
silent, we tested only the putative functional variant.
Deeb et al. (13) found that the association of
P12A with insulin sensitivity disappeared when corrected for BMI. We
similarly found that some apparent effects disappeared when viewed in a
multivariate analysis. Thus, despite well demonstrated PPAR
effects
on insulin sensitivity, the primary effect of this variant indeed may
be on body weight.
To our knowledge, the current study is the first to examine the effect
of PPAR
in family members at high risk for T2DM. The study of a
large number of members of only 52 families required us to account for
both nonindependence of the observations and the ascertainment bias of
the families. The likelihood analysis used here provides for these
corrections, whereas an ANOVA (data not shown), which cannot correct
for these biases, provided much lower levels of significance. In this
analysis the greatest effect was among the relatively few A12
homozygous individuals. Because of the small number of such
individuals, we chose not to subdivide the population further according
to obesity or gender to test for differences. Nonetheless, we show that
among individuals in whom the insulin resistance syndrome is prevalent
and who are at considerably increased risk for T2DM, the P12A allele
contributes to the genetic susceptibility to increased BMI, TG, blood
pressure, and glucose. One would expect a similar finding in families
at lower risk for T2DM, because we were unable to demonstrate a
significant impact of P12A on T2DM liability. However, P12A might be
interacting with an as yet unidentified risk factor for diabetes that
segregates in high risk families, and such interactions may help
explain the inconsistent strength and direction of the associations of
this variant with the traits of the insulin resistance syndrome.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Formerly at Division of Endocrinology, Metabolism and Diabetes,
University of Utah. ![]()
Received April 27, 2000.
Revised September 13, 2000.
Accepted October 26, 2000.
| References |
|---|
|
|
|---|
: adipogenic regulator
and thiazolidinedione receptor. Diabetes. 47:507514.[Abstract]
associated with severe
insulin resistance, diabetes mellitus and hypertension. Nature. 402:880883.[Medline]
(hPPAR
) gene in diabetic Caucasians: identification of a
Pro12Ala PPAR
2 missense mutation. Biochem
Biophys Res Commun. 241:270274.[CrossRef][Medline]
2 gene with obesity in
two Caucasian populations. Diabetes. 47:18061808.[Medline]
2 associated with
decreased receptor activity, lower body mass index and improved insulin
sensitivity. Nat Genet. 20:284287.[CrossRef][Medline]
2 on
thiazolidinedione-induced adipogenesis. Biochem Biophys Res Commun. 268:178182.[CrossRef][Medline]
gene influences plasma leptin levels in obese humans. Hum Mol
Genet. 7:435440.
gene are associated with severe overweight among obese women. J
Clin Endocrinol Metab. 84:37083712.
2 (PPAR-
2): divergent modulating
effects on body mass index in obese and lean Caucasian men. Diabetologia. 42:892895.[CrossRef][Medline]
gene locus is
related to body mass index and lipid values in healthy nonobese
subjects. Arterioscler Thromb Vasc Biol. 19:29402944.
2
amino acid polymorphism Pro 12 Ala is prevalent in offspring of type II
diabetic patients and is associated to increased insulin sensitivity in
a subgroup of obese subjects. Diabetologia. 42:758762.[CrossRef][Medline]
2 gene on adiposity, fat
distribution, and insulin sensitivity in Japanese men. Biochem Biophys
Res Commun. 251:195198.[CrossRef][Medline]
(hPPAR
) gene. Biochem Biophys
Res Commun. 233:756759.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
Y.-S. Tsai, L. Xu, O. Smithies, and N. Maeda Genetic variations in peroxisome proliferator-activated receptor {gamma} expression affect blood pressure PNAS, November 10, 2009; 106(45): 19084 - 19089. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Orio Jr., S. Palomba, T. Cascella, S. Di Biase, D. Labella, T. Russo, S. Savastano, F. Zullo, A. Colao, R. Vettor, et al. Lack of an Association between Peroxisome Proliferator-Activated Receptor-{gamma} Gene Pro12Ala Polymorphism and Adiponectin Levels in the Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5110 - 5115. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Temelkova-Kurktschiev, M. Hanefeld, G. Chinetti, C. Zawadzki, S. Haulon, A. Kubaszek, C. Koehler, W. Leonhardt, B. Staels, and M. Laakso Ala12Ala Genotype of the Peroxisome Proliferator-Activated Receptor {gamma}2 Protects against Atherosclerosis J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4238 - 4242. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Colca, W. G. McDonald, D. J. Waldon, J. W. Leone, J. M. Lull, C. A. Bannow, E. T. Lund, and W. R. Mathews Identification of a novel mitochondrial protein ("mitoNEET") cross-linked specifically by a thiazolidinedione photoprobe Am J Physiol Endocrinol Metab, February 1, 2004; 286(2): E252 - E260. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Orio Jr., G. Matarese, S. Di Biase, S. Palomba, D. Labella, V. Sanna, S. Savastano, F. Zullo, A. Colao, and G. Lombardi Exon 6 and 2 Peroxisome Proliferator-Activated Receptor-{gamma} Polymorphisms in Polycystic Ovary Syndrome J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 5887 - 5892. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Poulsen, G. Andersen, M. Fenger, T. Hansen, S. M. Echwald, A. Volund, H. Beck-Nielsen, O. Pedersen, and A. Vaag Impact of Two Common Polymorphisms in the PPAR{gamma} Gene on Glucose Tolerance and Plasma Insulin Profiles in Monozygotic and Dizygotic Twins: Thrifty Genotype, Thrifty Phenotype, or Both? Diabetes, January 1, 2003; 52(1): 194 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. I. Lindi, M. I.J. Uusitupa, J. Lindstrom, A. Louheranta, J. G. Eriksson, T. T. Valle, H. Hamalainen, P. Ilanne-Parikka, S. Keinanen-Kiukaanniemi, M. Laakso, et al. Association of the Pro12Ala Polymorphism in the PPAR-{gamma}2 Gene With 3-Year Incidence of Type 2 Diabetes and Body Weight Change in the Finnish Diabetes Prevention Study Diabetes, August 1, 2002; 51(8): 2581 - 2586. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Elbein Perspective: The Search for Genes for Type 2 Diabetes in the Post-Genome Era Endocrinology, June 1, 2002; 143(6): 2012 - 2018. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |