| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Department of Reproductive Science and Medicine (A.Mak., A.Man., G.T., R.M., R.W., J.W.), Imperial College School of Medicine, Hammersmith Hospital, W12 ONN OHS, London, United Kingdom; Medical School of Crete (A.Mak., P.P.), Iraclion, Crete, Greece 7110; and Department of Obstetrics and Gynecology (G.C.), UPENN Medical Center, Philadelphia, Pennsylvania 19104
Address all correspondence and requests for reprints to: Antonis Makrigiannakis, M.D., Ph.D., Department of Pharmacology, University of Crete Medical School, Stavrakia, Iraklion 71110, Greece. E-mail: makrigia{at}med.uoc.gr
Abstract
The Wilms’ tumor suppressor gene (WT1) encodes a zinc-finger containing transcription factor that is selectively expressed in the developing urogenital tract and functions as a tissue-specific developmental regulator. In addition to its gene-regulatory function through DNA binding properties, WT-1 also regulates transcription by formation of protein-protein complexes. These properties place WT-1 as a major regulator of cell growth and differentiation. In view of these observations, we studied WT1 mRNA and protein in human endometrial extracts and in endometrial stromal cells (ESCs) differentiating into decidual cells in vitro, by RT-PCR and Western blotting, respectively. WT1 protein expression was also studied in situ in the proliferative and the secretory phase of the menstrual cycle in the early pregnant state. Analysis by PCR of total RNA prepared from human ESCs demonstrated the presence of WT1 mRNA and four WT1 mRNA splice variants. Western blot analysis of nuclear protein extracts from ESCs yielded one immunoreactive protein of the expected size (approximately 52–54 kDa) recognized by the WT1 antibody. Immunohistochemical staining showed that WT1 protein is localized only to nuclei of human endometrial stromal cells. It remains constant in the proliferative and the secretory phase of the menstrual cycle and is increased remarkably during decidualization in early pregnancy. ESCs decidualized in vitro were investigated for WT-1 expression, which confirmed that decidualizing stimuli (E2, medroxy-progesterone-acetate, and relaxin for 12 d or cAMP and progesterone for 1–4 d) induced WT-1 mRNA (P < 0.05) and increased protein levels (P < 0.05). These data indicate that in humans the WT1 gene is expressed in ESCs and its mRNA and protein levels remain constant in the proliferative and the secretory phase of the menstrual cycle and that WT1 mRNA and protein expression increases significantly in ESCs when these cells differentiate into decidual cells.
DURING GESTATION, THE uterus undergoes morphological and physiological changes that accommodate and protect the developing conceptus. Endometrial stromal cells (ESCs) proliferate and differentiate to form decidual cells (1, 2). Decidualization is characterized by the transformation of the elongated fibroblast-like phenotype of the ESC to the larger, rounder phenotype of the decidual cell. Such endometrial cells play an important role in establishing and supporting pregnancy. In particular, decidual cells are believed to fulfill paracrine, nutritional, immunoregulatory, and embryoregulatory roles (3). Functionally, decidualization has been characterized by the onset of PRL (4, 5) and IGF-binding protein-1 (IGFBP-1) secretion (6, 7). This process of differentiation can be induced by progesterone in E2-treated cultures (8) by ligands that are coupled to the cAMP pathway such as PGE2 and the gonadotrophins LH and FSH (9) as well as by relaxin (RLX) (8, 10), which is produced in vivo by the corpus luteum and locally by stromal cells of the late luteal phase (11). Additionally, locally produced cytokines such as CRH (12) can interact with inflammatory prostaglandins and ILs and affect decidualization (13). Although it has been postulated that steroidal modulation is required for uterine stromal cell transformation into decidual cells (14), the molecular mechanisms underlying the decidualization process are not clearly understood.
Wilms’ tumor suppressor gene (WT1) is a gene that was first identified in the urogenital system. It encodes a transcription-regulating protein of 52–54 kDa with homology to the prototypic transcription factor family of early growth response genes (15, 16, 17, 18). WT1 encodes a zinc finger transcription factor that is inactivated in the germline of children with genetic predisposition to Wilms’ tumor and in a subset of sporadic cancers (16). In addition to its function in genitourinary development, a role for WT1 in hematopoiesis is suggested by its aberrant expression and/or mutation in a subset of acute human leukemias (16). At least four isoforms of the WT1 protein have been identified in cells expressing the gene. On the basis of the expression pattern of the gene, it has been hypothesized that WT1 plays an important role in the development of the kidney (15), gonads, and mesothelium (8, 19). The tissues expressing WT1 during the development of these organs have a common mesodermal origin, and they undergo a change from mesenchymal to epithelial differentiation. WT1 protein binds to the same sequences as early growth response proteins and represses the promoter activity of IGFs and their receptor genes (20, 21). IGFs, in turn, have been implicated as important regulators of decidualization (22, 23, 24). In addition to its expression in the developing kidney and gonad, WT1 mRNA is developmentally regulated during trophoblast differentiation, and WT1 transcripts have recently been demonstrated in the term placenta (25). Furthermore, WT1 has been detected in the uteri of the rat (26) and 17-d-old mouse (19) and in the human uterus at 18-wk gestation (27).
In view of these observations, we have examined WT1 expression in the human endometrium throughout the menstrual cycle and early pregnancy. These studies have been undertaken in biopsied material in situ and in human ESCs undergoing steroid-induced decidualization in vitro.
Materials and Methods
Reagents, antibodies, and cDNA clones
All reagents were of analytical grade and were purchased from Sigma (St. Louis, MO), unless otherwise stated. The monoclonal anti-WT1 (H2) antibody was purchased from DAKO Corp. (Carpenteria, CA). The pWT33 plasmid was a kind gift from Frank Rauscher (Wistar Institute, Philadelphia, PA) (18).
Isolation of epithelial and stromal endometrial cells
Epithelial and stromal endometrial cells were isolated as previously described (12, 13). Endometrial tissue was obtained from cycling women undergoing hysterectomy for leiomyomas (n = 7). A portion of each specimen was fixed in formalin and dated according to the method of Noyes et al. (28); only histologically normal proliferative endometrium was used. All patients consented to this study.
Cell cultures and in vitro decidualization of ESCs
ESCs were cultured in 25-cm2 culture flasks in DMEM FCS 10% until they reached confluence. To induce decidualization, ESCs were further cultured in DMEM FCS 2% for 12 d with E2 (36 nM), medroxyprogesterone acetate (MPA) (100 nM), and RLX (100 ng/ml) added to half of the dishes. Treatment and control medium was replenished every 2 d. Under these conditions, morphological differentiation and expression of PRL by ESCs is characteristic of decidual transformation (5, 29). In subsequent experiments designed to establish whether WT-1 expression was regulated during rapid induction of decidualization, ESCs were treated with 8-bromocAMP (0.5 mM) plus MPA (1 µM) (9, 30). WT-1 protein was analyzed in Western blots of nuclear extracts obtained from cells treated for 1, 2, and 3 d, and WT-1 mRNA was determined by RT-PCR analysis of total cellular RNA obtained after 1 and 2 d of treatment. To evaluate the occurrence of decidualization, medium was collected on day 12 of incubation, and PRL levels were measured in duplicated aliquots. Media not exposed to cells and culture medium from cells not exposed to hormones and kept under the same incubation conditions did not show measurable PRL levels.
PRL chemiluminescence assay
The culture medium was centrifuged at 800x g for 10 min and the supernatant was dried under vacuum and stored at -20 C. The content of PRL was determined using a chemiluminescence assay (Nichols Institute Diagnostics). The sensitivity of the assay was 0.1 ng/ml; the intraassay coefficient of variation was 3.4% and the interassay coefficient was 7.1%. Results were expressed in nanograms of PRL per milligram of total cellular protein determined on whole cellular homogenates by the Bradford method (31) using BSA as standard.
RNA isolation
Total cellular RNA was extracted from human total endometrium and epithelial and stromal cells as previously described (32).
RT-PCR
Five micrograms total RNA from each sample were denatured at 65 C for 5 min and chilled rapidly on ice. The RNA was then reverse transcribed in 50 ml 1x RT buffer [50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT] containing 40 pmol random hexamer primers, 0.5 mM each dATP, dCTP, dGTP, and dTTP, 80 U of RNasin (Promega Corp., Madison, WI) and 500 U of Moloney murine leukemia virus RT (Life Technologies, Inc.) for 1 h at 37 C. Afterward, 50 µl water were added, and the mixture was heated to 94 C. To check the integrity of the RT reaction, a 10-µl aliquot of the reverse transcribed product was cycled by PCR to amplify ß-actin cDNA. The reaction was carried out for 35 cycles (90 C for 50 sec, 56 C for 60 sec, 72 C for 8 min) in 50 µl 1x PCR buffer [20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2) containing 0.25 mM each dATP, dCTP, dGTP, and dTTP, 1.5U of Taq DNA polymerase (Life Technologies, Inc.) and 100 ng each of the following human ß-actin amplimers (forward: either 5'ATGGATGATGATATCGCCGC3' or 5'CATGGGTCAGAAGGATTCAT3'; reverse: 5'TTAATGTCACGCACGATTTC3'). As expected (33), two products of 637 bp or 500 bp were generated following PCR amplification using the reverse primer coupled with the first or second forward primer, respectively.
For WT1 analysis, the primers employed were derived from that reported
by Gessler et al. (17) as follows (Fig. 1
):
|
B: 5'TGACAATTTATACCAAATGA3' (forward).
C: 5'TGAATGCCACTGAAGACAACC3' (reverse).
D: 5'AGACATACAGGTGTGAAA3' (forward).
E: 5'GACTAATTCATCTGACCGGGCAAA3' (reverse).
F: 5'GCCCAATACAGAATACACA3' (forward).
G: 5'TCACACACTGTGCTGCCT3' (reverse).
The PCR conditions consisted of an initial denaturing step of 94 C for 3 min, followed by 28 cycles of 94 C for 35 sec, 47 C for 1 min, and 72 C for 5 min. Negative controls included RNA without RT and substitution of reverse-transcribed cDNA with water. One-tenth of each resultant PCR mixture following amplification was electrophoresed through a 2.0% agarose gel, stained with ethidium bromide, and photographed under UV transillumination. In preliminary experiments the PCR products were sequenced to verify their identity and homology with that reported by Gessler et al. (17).
Southern blot analysis
Following RT, PCR, and electrophoresis, cDNA was transferred to Nytranì N nylon membrane (Schleicher & Schuell, Inc., Dassel, Germany) and cross-linked. Prehybridization for 2 h at 42 C using Ultrahyb solution (Ambion, Inc., Austin, TX) was followed by hybridization using Ultrahyb solution at 42 C overnight in the presence of labeled probe. A 32P-labeled probe complementary to the WT1 endometrial stromal cell PCR product was generated by random priming using Ready-To-Go DNA labeling beads (dCTP) (Amersham Pharmacia Biotech, Buckinghamshire, UK), followed by ProbeQuantTM G-50 microcolumn purification according to the manufacturers’ protocol. The authenticity of cDNA used to generate the radioactive WT1 probe was verified by sequencing. NorthernMax low and high stringency wash solutions (Ambion, Inc.), each for 20 min at 42 C, were used to wash the membrane following hybridization before exposure to BioMaxTM MS (Anachem, Luton, UK)Kodak film, with the Kodak BioMax TranScreen intensifying system (Anachem). Hybridization with a labeled actin probe, using the same methodology, acted as an internal control for the relative abundance of PCR products in each treatment.
Immunoblot analysis
Nuclear extracts were prepared from human endometrial epithelial and stromal cells by the methods of Zumbansen et al. (34). The nuclear protein extract was processed for protein quantitation by the Bradford method (31). Fifty micrograms protein from each sample was mixed with Laemmli sample buffer containing b-mercaptoethanol (5%) and boiled for 5 min. Proteins were then separated by SDS-PAGE (10% gels) and electrophoretically transferred onto PVDF membranes (NEN Life Science Products-Dupont, Boston, MA). The membranes were rinsed in PBS and then blocked for 30 min in 4% nonfat milk prepared in TBST buffer [50 mM Tris-HCl (pH 7.5), 171 mM NaCl, 0.05% Tween-20]. The blots were incubated with the WT1-H2 antibody (at a concentration of 1 µg/ml) in TBST for 1 h, and then washed three times (5 min each) in TBST with vigorous shaking. The blots were incubated with horseradish peroxidase-labeled antimouse secondary antibody (diluted 1:6000 in TBST) for 30 min, washed three times (5 min each) in TBST and visualized using enhanced chemiluminescence according to manufacturer’s instructions (NEN Life Science Products-Dupont).
Immunohistochemistry
Paraffin-embedded archival human endometrial tissue sections (5 µm thick) were deparaffinized, blocked with 5% goat serum, and then incubated with the primary antibody (WT1-H2, 10 µg/ml) for 1 h at room temperature. Localization of the primary antibody was performed by incubation of the sections with a biotinylated antimouse IgG antibody, and the biotin was detected using an avidin-biotin-peroxidase kit (Vector Laboratories, Inc., Burlingame, CA) with diaminobenzidine as the chromogenic substrate. Control sections were processed in an identical manner by substitution of the primary antibody with a purified mouse IgG fraction.
Statistical analysis
All experiments were conducted in duplicates and repeated at least three times. The (percentage) data were analyzed by either one-way ANOVA followed by t-Newman-Keuls multiple range test or t test. P < 0.05 was considered significant.
Results
Human endometrial stromal cells express WT1 mRNA transcripts
Complementary DNAs corresponding to human WT1 (17)
were amplified by RT-PCR of total RNA extracted from human total
endometrium and epithelial and stromal cells. Nucleotide sequence
analysis of these products revealed that the human WT1 (540 bp; derived
using primers F/G shown in Fig. 1
) cDNAs amplified were 100%
homologous to their respective sequences reported by other
investigators (17). The integrity of cDNA in each sample
was confirmed by amplifying the ß-actin cDNA, and in all samples
tested an expected product of either 637 bp or 500 bp was identified
(Fig. 2B). As a positive control, PCR
amplification of WT1 cDNA from the pWT33 plasmid (18, 34)
yielded the 540-bp product (Fig. 2A). In addition, the absence of
nonspecific amplification from genomic DNA was confirmed by including
DNase-free RNase in the RT reaction (data not shown). The selection of
primers within different exons of the WT1 gene showed that genomic DNA
was not amplified. As in Fig. 2A, WT1 mRNA was expressed in the total
endometrial tissue as well as in endometrial stromal cells but not in
epithelial cells and a single 540-bp product was detected by RT-PCR,
with primer pairs F/G (Fig. 2A).
|
). WT1 mRNA was expressed in the
total endometrial tissue as well as in ESCs (Fig. 3) but not in epithelial cells. Splice
site 1 primers (B/C) generated two products of 224 and 173 bp,
reflecting the presence of the 51-bp insertion (Fig. 3A). Similarly,
splice site 2 primers (D/E) produced two products of 170 and 161 bp,
reflecting the presence of the 9-bp insertion (Fig. 3B). All the other
bands shown in Fig. 3 are nonspecific bands because Southern blot
analysis with the WT1 radiolabeled cDNA has shown that only the WT1
isoform bands hybridized to the probe (data not shown).
|
To determine whether WT1 protein is expressed in human
endometrium, immunoblots of nuclear extracts from epithelial and
stromal cells were made. We used a monoclonal antibody to WT1 (H2)
specific for the human WT1 protein. Nuclear extracts from human
endometrial stromal cells yielded an appropriately sized (52–54 kDa)
protein identified by the WT1 monoclonal antibody H2. Nuclear extracts
from endometrial epithelial cells did not express the WT1 protein (Fig. 4).
|
WT1 protein was evaluated by immunohistochemistry in endometrium
throughout the cycle. WT1 protein was absent in the epithelial cells
lining the uterine lumen (Fig. 5, A and
B, arrowheads). Low levels of WT1 protein were found to be
concentrated in the nucleus of ESCs in proliferative and secretory
phase (Fig. 5, A and B, arrows). Uterine stroma undergoes a
decidual reaction in response to hormones of pregnancy leading to
formation of decidua even in extrauterine pregnancies. To assess the
presence of WT1 in decidual stromal cells, we evaluated endometrial
curettings from women (n = 4) carrying early extrauterine
(cornual) pregnancies. WT1 immunoreactivity expression was apparent in
the majority of decidual cells and was concentrated in the nucleus
(Fig. 4, C and D, arrows). No immunostaining was detected in
vascular elements infiltrating the decidua and metrial gland cells
(Fig. 4, double arrows).
|
To confirm the above results, we examined the expression of WT1 at
the mRNA and protein level in human endometrial stromal cells
undergoing hormone-induced decidualization in vitro.
Isolated stromal cells from women in the follicular phase were exposed
to a mixture of E2, MPA, and RLX for 12 d. Decidualization was
confirmed by the induction of PRL secretion (Fig. 6). Total RNA prepared from unchallenged
and decidualized stromal cells was subjected to semiquantitative
RT-PCR. A significant increase (P < 0.05) in WT1 mRNA
was noted after decidualization of endometrial stromal cells in
vitro (Fig. 7). Moreover, WT1
protein expression levels in ESCs undergoing decidualization in
vitro were also significantly increased (Fig. 8, P < 0.05). Therefore,
increased expression of WT1 is a feature of ESC decidualization
in vitro confirming the in situ staining of
decidua.
|
|
|
). Analysis of WT1
mRNA expression, by RT-PCR and Southern blot analysis, in response to
this accelerated induction of decidualization revealed an increase 24
and 48 h after stimulation with cAMP/MPA (Fig. 9, A and B).
|
WT1 is a transcription regulatory factor implicated in the development of the genitourinary system and possibly the placenta. We report that human endometrial stromal cells contain WT1 transcripts similar to those expressed in early (37) and term (25) placenta. Expression is significantly increased upon decidualization, which is consistent with evidence gained in rodents (26). Two alternative splice sites are used to produce at least four isoforms of WT1 mRNA. One splice introduces 17 amino acids into the protein just proximal to the first zinc finger. The second splicing alternative generates a protein with three amino acids (lysine, threonine, and serine, hence KTS) inserted between the third and fourth zinc fingers. Such alteration in splicing pattern suggests a molecular basis for modulation of biological function of WT-1 protein (38). Interestingly, we demonstrated the presence of four different messages, reflecting the absence or presence of two alternatively spliced insertions of 51 and 9 bp, respectively. This is consistent with the demonstration that the WT1 transcript is spliced differently in a variety of tissues (35), including rat (39) and human ovary (40). The existence of alternative isoforms of WT1 protein with potentially different tissue-specific activity probably confers a wide repertoire of modes of action. Moreover, these protein variants can be variably regulated in different stages of differentiation (41). However, it has been shown in the ovary that the ratio of the four WT1 splicing products does not vary during development (39), but this does not restrict the potential for modulation of the function of other proteins with which WT-1 isoforms may interact directly or indirectly.
The uterus is unique in undergoing cyclic growth and differentiation in response to hormonal and gestational stimuli, respectively. Although the histological features of the decidual reaction have been well studied, the molecular events that regulate the differentiation of stromal cells are poorly understood. In vitro models of decidualization have been developed and used to analyze the process, and some morphological and biochemical events have been characterized (5, 14, 41, 42). WT1 expression in the endometrium was found to be regulated in a differentiation-dependent manner. The protein was detectable at relatively moderate levels in uterine stroma cells during the normal cycle but increased significantly with decidualization in vivo. ESCs in vitro have been shown to respond to the combination of E, progestins, and RLX, which induce a decidual-like differentiation including alterations in enzymatic activity, modification of extracellular matrix protein synthesis, and the secretion of IGFBP-1 and PRL (43). Consistent with these observations, sex steroids and RLX significantly increased WT1 mRNA and protein expression levels in cultured stromal cells. Moreover, the accelerated induction of decidualization by combination of cAMP and MPA, previously shown to facilitate the synergistic activation of the decidual PRL promoter and PRL production by ESCs (30), also stimulated WT1 mRNA and protein expression. This relatively rapid induction of WT1 mRNA, within the first 24 h of treatment, is consistent with the kinetics of induction of this mRNA in cytotrophoblast cells in response to cAMP (25). Collectively, these observations demonstrate that WT1 is regulated during the hormone-mediated differentiation of ESCs and strengthens our hypothesis that this tumor suppressor gene may serve as an early effector transcription factor controlling decidualization in the human endometrium.
The highly selective association of WT1 expression with differentiated decidual cells in vivo provides further suggestive evidence of a key role in regulating the differentiation of stromal fibroblasts into decidual cells. Indeed, WT1 expression has been shown to be tightly regulated during the terminal differentiation of other cell types in the urogenital system. WT1 gene expression in the developing kidney appears to be correlated with the transition from a mesenchymal to an epithelial phenotype as mesenchymal nephrogenic elements are transformed into differentiated renal epithelial cells (19, 44). The well-documented target of WT1 gene products in various in vitro models is the IGF system (45, 46). WT1 gene products have been shown to repress the IGF-II gene and its receptor gene, namely the IGF-I receptor. It has been shown in turn that the IGF-II mRNA is expressed throughout human endometrial stroma and type I and type II IGF receptor mRNAs are both present in human endometrial stroma but are relatively more abundant in endometrial epithelium (47). Thus, WT1 may inhibit the production of receptors for both IGF-I and II and induce endometrial stromal arrest, directing them toward differentiation. Such restriction of IGF action is consistent with the proposed role of decidualization-induced IGFBP-1 during ESC differentiation (24). WT1 also suppresses growth factors encoding genes such as colony-stimulating factor-1, and TGFß 1 (48, 49). These factors, in turn, are expressed in ESCs and are regulated during decidualization (50, 51). In addition to these effects, WT1 protein is a powerful repressor of its own gene (52).
In summary, the results of this study demonstrate that WT1 mRNA and protein are expressed in human ESCs and that this expression is increased as stromal fibroblasts differentiate into decidual cells. The expression of the WT1 tumor suppressor transcription factor appears to be an early marker of decidual cell differentiation, thus implicating this specific factor in the differentiation process. The regulated expression of WT1 in endometrial cells undergoing decidualization suggests that this tumor suppressor gene may also fulfill an embryoregulatory role during human implantation. Furthermore, the regulated expression of WT1 in cultured endometrial stromal cells reflects the spatiotemporal expression of this endometrial tumor suppressor gene in vivo demonstrating that these cell cultures will provide an ideal model system in which to define the role(s) of WT1 in the complex processes of decidualization. These studies not only add to our understanding of the cyclic remodeling process that occurs in the human endometrium in preparation for the implanting embryo but also gives us useful insight into the molecular biology of the family of early growth response gene.
Acknowledgments
We are grateful for the kind gift of the PWT33 plasmid from Frank Rauscher (Wistar Institute, Philadelphia, PA).
Footnotes
This work was supported in part from funds made available from the Institute of Obstetrics and Gynecology Trust Fund and the Alexander Onassis Foundation (to A.M.).
Abbreviations: ESC, Endometrial stromal cell; IGFBP, IGF-binding protein; MPA, medroxyprogesterone acetate; RLX, relaxin; WT1, Wilms’ tumor suppressor gene.
Received January 24, 2001.
Accepted August 26, 2001.
References
activates NF-
B in acid sphingomyelinase-deficient mouse
embryonic fibroblasts. J Biol Chem 272:10904–10909 gene promoter. Mol Endocrinol 9:1356–1366[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  J. D. Graham, M. L. Yager, H. D. Hill, K. Byth, G. M. O'Neill, and C. L. Clarke Altered Progesterone Receptor Isoform Expression Remodels Progestin Responsiveness of Breast Cancer Cells Mol. Endocrinol., November 1, 2005; 19(11): 2713 - 2735. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. W. Anthony, D. D. Mukhtar, M. A. Pickett, and I. T. Cameron Progesterone Up-Regulates WT1 mRna and Protein, and Alters the Relsative Expression of WT1 Transcripts in Cultured Endometrial Stromal Cells Reproductive Sciences, December 1, 2003; 10(8): 509 - 516. [Abstract] [PDF]
|
|
|
|
 |
|
 B. Gurates, S. Sebastian, S. Yang, J. Zhou, M. Tamura, Z. Fang, T. Suzuki, H. Sasano, and S. E. Bulun WT1 and DAX-1 Inhibit Aromatase P450 Expression in Human Endometrial and Endometriotic Stromal Cells J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4369 - 4377. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
