help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Makrigiannakis, A.
Right arrow Articles by White, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Makrigiannakis, A.
Right arrow Articles by White, J.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 12 5964-5972
Copyright © 2001 by The Endocrine Society


Other Original Articles

Expression of Wilms’ Tumor Suppressor Gene (WT1) in Human Endometrium: Regulation through Decidual Differentiation

Antonis Makrigiannakis, George Coukos, Anastasia Mantani, Prokopis Prokopakis, Geoffrey Trew, Raul Margara, Robert Winston and John White

Department of Reproductive Science and Medicine (A.Mak., A.Man., G.T., R.M., R.W., J.W.), Imperial College School of Medicine, Hammersmith Hospital, W12 ONN OHS, London, United Kingdom; Medical School of Crete (A.Mak., P.P.), Iraclion, Crete, Greece 7110; and Department of Obstetrics and Gynecology (G.C.), UPENN Medical Center, Philadelphia, Pennsylvania 19104

Address all correspondence and requests for reprints to: Antonis Makrigiannakis, M.D., Ph.D., Department of Pharmacology, University of Crete Medical School, Stavrakia, Iraklion 71110, Greece. E-mail: makrigia{at}med.uoc.gr

Abstract

The Wilms’ tumor suppressor gene (WT1) encodes a zinc-finger containing transcription factor that is selectively expressed in the developing urogenital tract and functions as a tissue-specific developmental regulator. In addition to its gene-regulatory function through DNA binding properties, WT-1 also regulates transcription by formation of protein-protein complexes. These properties place WT-1 as a major regulator of cell growth and differentiation. In view of these observations, we studied WT1 mRNA and protein in human endometrial extracts and in endometrial stromal cells (ESCs) differentiating into decidual cells in vitro, by RT-PCR and Western blotting, respectively. WT1 protein expression was also studied in situ in the proliferative and the secretory phase of the menstrual cycle in the early pregnant state. Analysis by PCR of total RNA prepared from human ESCs demonstrated the presence of WT1 mRNA and four WT1 mRNA splice variants. Western blot analysis of nuclear protein extracts from ESCs yielded one immunoreactive protein of the expected size (approximately 52–54 kDa) recognized by the WT1 antibody. Immunohistochemical staining showed that WT1 protein is localized only to nuclei of human endometrial stromal cells. It remains constant in the proliferative and the secretory phase of the menstrual cycle and is increased remarkably during decidualization in early pregnancy. ESCs decidualized in vitro were investigated for WT-1 expression, which confirmed that decidualizing stimuli (E2, medroxy-progesterone-acetate, and relaxin for 12 d or cAMP and progesterone for 1–4 d) induced WT-1 mRNA (P < 0.05) and increased protein levels (P < 0.05). These data indicate that in humans the WT1 gene is expressed in ESCs and its mRNA and protein levels remain constant in the proliferative and the secretory phase of the menstrual cycle and that WT1 mRNA and protein expression increases significantly in ESCs when these cells differentiate into decidual cells.

DURING GESTATION, THE uterus undergoes morphological and physiological changes that accommodate and protect the developing conceptus. Endometrial stromal cells (ESCs) proliferate and differentiate to form decidual cells (1, 2). Decidualization is characterized by the transformation of the elongated fibroblast-like phenotype of the ESC to the larger, rounder phenotype of the decidual cell. Such endometrial cells play an important role in establishing and supporting pregnancy. In particular, decidual cells are believed to fulfill paracrine, nutritional, immunoregulatory, and embryoregulatory roles (3). Functionally, decidualization has been characterized by the onset of PRL (4, 5) and IGF-binding protein-1 (IGFBP-1) secretion (6, 7). This process of differentiation can be induced by progesterone in E2-treated cultures (8) by ligands that are coupled to the cAMP pathway such as PGE2 and the gonadotrophins LH and FSH (9) as well as by relaxin (RLX) (8, 10), which is produced in vivo by the corpus luteum and locally by stromal cells of the late luteal phase (11). Additionally, locally produced cytokines such as CRH (12) can interact with inflammatory prostaglandins and ILs and affect decidualization (13). Although it has been postulated that steroidal modulation is required for uterine stromal cell transformation into decidual cells (14), the molecular mechanisms underlying the decidualization process are not clearly understood.

Wilms’ tumor suppressor gene (WT1) is a gene that was first identified in the urogenital system. It encodes a transcription-regulating protein of 52–54 kDa with homology to the prototypic transcription factor family of early growth response genes (15, 16, 17, 18). WT1 encodes a zinc finger transcription factor that is inactivated in the germline of children with genetic predisposition to Wilms’ tumor and in a subset of sporadic cancers (16). In addition to its function in genitourinary development, a role for WT1 in hematopoiesis is suggested by its aberrant expression and/or mutation in a subset of acute human leukemias (16). At least four isoforms of the WT1 protein have been identified in cells expressing the gene. On the basis of the expression pattern of the gene, it has been hypothesized that WT1 plays an important role in the development of the kidney (15), gonads, and mesothelium (8, 19). The tissues expressing WT1 during the development of these organs have a common mesodermal origin, and they undergo a change from mesenchymal to epithelial differentiation. WT1 protein binds to the same sequences as early growth response proteins and represses the promoter activity of IGFs and their receptor genes (20, 21). IGFs, in turn, have been implicated as important regulators of decidualization (22, 23, 24). In addition to its expression in the developing kidney and gonad, WT1 mRNA is developmentally regulated during trophoblast differentiation, and WT1 transcripts have recently been demonstrated in the term placenta (25). Furthermore, WT1 has been detected in the uteri of the rat (26) and 17-d-old mouse (19) and in the human uterus at 18-wk gestation (27).

In view of these observations, we have examined WT1 expression in the human endometrium throughout the menstrual cycle and early pregnancy. These studies have been undertaken in biopsied material in situ and in human ESCs undergoing steroid-induced decidualization in vitro.

Materials and Methods

Reagents, antibodies, and cDNA clones

All reagents were of analytical grade and were purchased from Sigma (St. Louis, MO), unless otherwise stated. The monoclonal anti-WT1 (H2) antibody was purchased from DAKO Corp. (Carpenteria, CA). The pWT33 plasmid was a kind gift from Frank Rauscher (Wistar Institute, Philadelphia, PA) (18).

Isolation of epithelial and stromal endometrial cells

Epithelial and stromal endometrial cells were isolated as previously described (12, 13). Endometrial tissue was obtained from cycling women undergoing hysterectomy for leiomyomas (n = 7). A portion of each specimen was fixed in formalin and dated according to the method of Noyes et al. (28); only histologically normal proliferative endometrium was used. All patients consented to this study.

Cell cultures and in vitro decidualization of ESCs

ESCs were cultured in 25-cm2 culture flasks in DMEM FCS 10% until they reached confluence. To induce decidualization, ESCs were further cultured in DMEM FCS 2% for 12 d with E2 (36 nM), medroxyprogesterone acetate (MPA) (100 nM), and RLX (100 ng/ml) added to half of the dishes. Treatment and control medium was replenished every 2 d. Under these conditions, morphological differentiation and expression of PRL by ESCs is characteristic of decidual transformation (5, 29). In subsequent experiments designed to establish whether WT-1 expression was regulated during rapid induction of decidualization, ESCs were treated with 8-bromocAMP (0.5 mM) plus MPA (1 µM) (9, 30). WT-1 protein was analyzed in Western blots of nuclear extracts obtained from cells treated for 1, 2, and 3 d, and WT-1 mRNA was determined by RT-PCR analysis of total cellular RNA obtained after 1 and 2 d of treatment. To evaluate the occurrence of decidualization, medium was collected on day 12 of incubation, and PRL levels were measured in duplicated aliquots. Media not exposed to cells and culture medium from cells not exposed to hormones and kept under the same incubation conditions did not show measurable PRL levels.

PRL chemiluminescence assay

The culture medium was centrifuged at 800x g for 10 min and the supernatant was dried under vacuum and stored at -20 C. The content of PRL was determined using a chemiluminescence assay (Nichols Institute Diagnostics). The sensitivity of the assay was 0.1 ng/ml; the intraassay coefficient of variation was 3.4% and the interassay coefficient was 7.1%. Results were expressed in nanograms of PRL per milligram of total cellular protein determined on whole cellular homogenates by the Bradford method (31) using BSA as standard.

RNA isolation

Total cellular RNA was extracted from human total endometrium and epithelial and stromal cells as previously described (32).

RT-PCR

Five micrograms total RNA from each sample were denatured at 65 C for 5 min and chilled rapidly on ice. The RNA was then reverse transcribed in 50 ml 1x RT buffer [50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT] containing 40 pmol random hexamer primers, 0.5 mM each dATP, dCTP, dGTP, and dTTP, 80 U of RNasin (Promega Corp., Madison, WI) and 500 U of Moloney murine leukemia virus RT (Life Technologies, Inc.) for 1 h at 37 C. Afterward, 50 µl water were added, and the mixture was heated to 94 C. To check the integrity of the RT reaction, a 10-µl aliquot of the reverse transcribed product was cycled by PCR to amplify ß-actin cDNA. The reaction was carried out for 35 cycles (90 C for 50 sec, 56 C for 60 sec, 72 C for 8 min) in 50 µl 1x PCR buffer [20 mM Tris-HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2) containing 0.25 mM each dATP, dCTP, dGTP, and dTTP, 1.5U of Taq DNA polymerase (Life Technologies, Inc.) and 100 ng each of the following human ß-actin amplimers (forward: either 5'ATGGATGATGATATCGCCGC3' or 5'CATGGGTCAGAAGGATTCAT3'; reverse: 5'TTAATGTCACGCACGATTTC3'). As expected (33), two products of 637 bp or 500 bp were generated following PCR amplification using the reverse primer coupled with the first or second forward primer, respectively.

For WT1 analysis, the primers employed were derived from that reported by Gessler et al. (17) as follows (Fig. 1Go):



View larger version (8K):
[in this window]
[in a new window]
 
Figure 1. The exon intron structure of the WT1 is depicted diagrammatically, with the boxes representing the 10 exons. The stippled regions are alternatively spliced fragments that give rise to four isoforms. The start (ATG) and the stop (TGA) are indicated by the open vertical arrows. The four zinc fingers are shown by the numbered vertical arrows. The primers used to amplify the WT1 gene are shown by the horizontal half-arrows and labeled A through G.

 
A: 5'ATGGGCTCCGACGTGCGGGA3' (forward).

B: 5'TGACAATTTATACCAAATGA3' (forward).

C: 5'TGAATGCCACTGAAGACAACC3' (reverse).

D: 5'AGACATACAGGTGTGAAA3' (forward).

E: 5'GACTAATTCATCTGACCGGGCAAA3' (reverse).

F: 5'GCCCAATACAGAATACACA3' (forward).

G: 5'TCACACACTGTGCTGCCT3' (reverse).

The PCR conditions consisted of an initial denaturing step of 94 C for 3 min, followed by 28 cycles of 94 C for 35 sec, 47 C for 1 min, and 72 C for 5 min. Negative controls included RNA without RT and substitution of reverse-transcribed cDNA with water. One-tenth of each resultant PCR mixture following amplification was electrophoresed through a 2.0% agarose gel, stained with ethidium bromide, and photographed under UV transillumination. In preliminary experiments the PCR products were sequenced to verify their identity and homology with that reported by Gessler et al. (17).

Southern blot analysis

Following RT, PCR, and electrophoresis, cDNA was transferred to Nytranì N nylon membrane (Schleicher & Schuell, Inc., Dassel, Germany) and cross-linked. Prehybridization for 2 h at 42 C using Ultrahyb solution (Ambion, Inc., Austin, TX) was followed by hybridization using Ultrahyb solution at 42 C overnight in the presence of labeled probe. A 32P-labeled probe complementary to the WT1 endometrial stromal cell PCR product was generated by random priming using Ready-To-Go DNA labeling beads (dCTP) (Amersham Pharmacia Biotech, Buckinghamshire, UK), followed by ProbeQuantTM G-50 microcolumn purification according to the manufacturers’ protocol. The authenticity of cDNA used to generate the radioactive WT1 probe was verified by sequencing. NorthernMax low and high stringency wash solutions (Ambion, Inc.), each for 20 min at 42 C, were used to wash the membrane following hybridization before exposure to BioMaxTM MS (Anachem, Luton, UK)Kodak film, with the Kodak BioMax TranScreen intensifying system (Anachem). Hybridization with a labeled actin probe, using the same methodology, acted as an internal control for the relative abundance of PCR products in each treatment.

Immunoblot analysis

Nuclear extracts were prepared from human endometrial epithelial and stromal cells by the methods of Zumbansen et al. (34). The nuclear protein extract was processed for protein quantitation by the Bradford method (31). Fifty micrograms protein from each sample was mixed with Laemmli sample buffer containing b-mercaptoethanol (5%) and boiled for 5 min. Proteins were then separated by SDS-PAGE (10% gels) and electrophoretically transferred onto PVDF membranes (NEN Life Science Products-Dupont, Boston, MA). The membranes were rinsed in PBS and then blocked for 30 min in 4% nonfat milk prepared in TBST buffer [50 mM Tris-HCl (pH 7.5), 171 mM NaCl, 0.05% Tween-20]. The blots were incubated with the WT1-H2 antibody (at a concentration of 1 µg/ml) in TBST for 1 h, and then washed three times (5 min each) in TBST with vigorous shaking. The blots were incubated with horseradish peroxidase-labeled antimouse secondary antibody (diluted 1:6000 in TBST) for 30 min, washed three times (5 min each) in TBST and visualized using enhanced chemiluminescence according to manufacturer’s instructions (NEN Life Science Products-Dupont).

Immunohistochemistry

Paraffin-embedded archival human endometrial tissue sections (5 µm thick) were deparaffinized, blocked with 5% goat serum, and then incubated with the primary antibody (WT1-H2, 10 µg/ml) for 1 h at room temperature. Localization of the primary antibody was performed by incubation of the sections with a biotinylated antimouse IgG antibody, and the biotin was detected using an avidin-biotin-peroxidase kit (Vector Laboratories, Inc., Burlingame, CA) with diaminobenzidine as the chromogenic substrate. Control sections were processed in an identical manner by substitution of the primary antibody with a purified mouse IgG fraction.

Statistical analysis

All experiments were conducted in duplicates and repeated at least three times. The (percentage) data were analyzed by either one-way ANOVA followed by t-Newman-Keuls multiple range test or t test. P < 0.05 was considered significant.

Results

Human endometrial stromal cells express WT1 mRNA transcripts

Complementary DNAs corresponding to human WT1 (17) were amplified by RT-PCR of total RNA extracted from human total endometrium and epithelial and stromal cells. Nucleotide sequence analysis of these products revealed that the human WT1 (540 bp; derived using primers F/G shown in Fig. 1Go) cDNAs amplified were 100% homologous to their respective sequences reported by other investigators (17). The integrity of cDNA in each sample was confirmed by amplifying the ß-actin cDNA, and in all samples tested an expected product of either 637 bp or 500 bp was identified (Fig. 2BGo). As a positive control, PCR amplification of WT1 cDNA from the pWT33 plasmid (18, 34) yielded the 540-bp product (Fig. 2AGo). In addition, the absence of nonspecific amplification from genomic DNA was confirmed by including DNase-free RNase in the RT reaction (data not shown). The selection of primers within different exons of the WT1 gene showed that genomic DNA was not amplified. As in Fig. 2AGo, WT1 mRNA was expressed in the total endometrial tissue as well as in endometrial stromal cells but not in epithelial cells and a single 540-bp product was detected by RT-PCR, with primer pairs F/G (Fig. 2AGo).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. PCR amplification of WT1 from exons 6 to 10 (A) and that for ß-actin from exons 1 to 3 (B) was performed on reverse transcribed RNA derived from total endometrium and endometrial epithelial and stromal cells (T, E, S). Lane + is mesothelioma cells, a positive control. A, Ethidium bromide staining of a 540-bp PCR product of the WT1 cDNA. B, ß-Actin product. Lane (-) is negative control (H20) for the RT and PCR reactions. Lane M are DNA markers. Note that only endometrial stromal and total endometrium express the WT1 mRNA.

 
In the kidney, WT1 is alternatively spliced, giving rise to four different transcripts that reflect the absence or presence of two alternatively spliced insertions of 51 or 9 bp, respectively (35). We sought to analyze the possible existence of WT1 mRNA splicing variants in human endometrial cells by RT-PCR using primers pairs B/C and D/E, which span the two alternative splice sites (hatched boxes in Fig. 1Go). WT1 mRNA was expressed in the total endometrial tissue as well as in ESCs (Fig. 3Go) but not in epithelial cells. Splice site 1 primers (B/C) generated two products of 224 and 173 bp, reflecting the presence of the 51-bp insertion (Fig. 3AGo). Similarly, splice site 2 primers (D/E) produced two products of 170 and 161 bp, reflecting the presence of the 9-bp insertion (Fig. 3BGo). All the other bands shown in Fig. 3Go are nonspecific bands because Southern blot analysis with the WT1 radiolabeled cDNA has shown that only the WT1 isoform bands hybridized to the probe (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. RT-PCR analysis of the WT1 splice variants in human endometrial cells. (RT-PCR was performed on endometrial cell RNA from total endometrium (T) and ESCs (S) using primers pairs B/C (A) and D/E (B). These pairs of primers spanned two alternative splice sites. A, For splice site 1, primers B/C gave two products of sizes 224 and 173 bp, reflecting the presence of a 51-bp insertion. ß-Actin products are also shown. B, For splice site 2, primers D/E gave two products sized 170 and 161 bp indicating the presence of a 9-bp insertion. Molecular size markers are shown on the left (M).

 
WT1 gene expressed in human endometrial stromal cells at the protein level

To determine whether WT1 protein is expressed in human endometrium, immunoblots of nuclear extracts from epithelial and stromal cells were made. We used a monoclonal antibody to WT1 (H2) specific for the human WT1 protein. Nuclear extracts from human endometrial stromal cells yielded an appropriately sized (52–54 kDa) protein identified by the WT1 monoclonal antibody H2. Nuclear extracts from endometrial epithelial cells did not express the WT1 protein (Fig. 4Go).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 4. Immunoblot analysis of WT1 protein in human endometrial epithelial and stromal cells. Molecular weights are marked on the right. It is shown a band at approximately 52–54 kDa recognized by the anti-WT1 mAb in human ESCs. Note that only ESCs express the WT1 protein.

 
WT1 expressed in human endometrial stromal cells and regulated during decidualization in vivo

WT1 protein was evaluated by immunohistochemistry in endometrium throughout the cycle. WT1 protein was absent in the epithelial cells lining the uterine lumen (Fig. 5Go, A and B, arrowheads). Low levels of WT1 protein were found to be concentrated in the nucleus of ESCs in proliferative and secretory phase (Fig. 5Go, A and B, arrows). Uterine stroma undergoes a decidual reaction in response to hormones of pregnancy leading to formation of decidua even in extrauterine pregnancies. To assess the presence of WT1 in decidual stromal cells, we evaluated endometrial curettings from women (n = 4) carrying early extrauterine (cornual) pregnancies. WT1 immunoreactivity expression was apparent in the majority of decidual cells and was concentrated in the nucleus (Fig. 4Go, C and D, arrows). No immunostaining was detected in vascular elements infiltrating the decidua and metrial gland cells (Fig. 4Go, double arrows).



View larger version (122K):
[in this window]
[in a new window]
 
Figure 5. Expression of WT1 in the human endometrium, in situ. A–C, Note that the very strong staining of WT-1 in the nuclei of almost all decidual endometrial cells (C and D, arrows). Magnification, x400.

 
WT1 expression induced during decidualization of human endometrial stroma cells in vitro

To confirm the above results, we examined the expression of WT1 at the mRNA and protein level in human endometrial stromal cells undergoing hormone-induced decidualization in vitro. Isolated stromal cells from women in the follicular phase were exposed to a mixture of E2, MPA, and RLX for 12 d. Decidualization was confirmed by the induction of PRL secretion (Fig. 6Go). Total RNA prepared from unchallenged and decidualized stromal cells was subjected to semiquantitative RT-PCR. A significant increase (P < 0.05) in WT1 mRNA was noted after decidualization of endometrial stromal cells in vitro (Fig. 7Go). Moreover, WT1 protein expression levels in ESCs undergoing decidualization in vitro were also significantly increased (Fig. 8Go, P < 0.05). Therefore, increased expression of WT1 is a feature of ESC decidualization in vitro confirming the in situ staining of decidua.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 6. Kinetics of PRL secretion by ESCs after hormonal stimulation (decidualization induction: E2 + MPA + RLX).

 


View larger version (24K):
[in this window]
[in a new window]
 
Figure 7. Total RNA samples prepared from human ESCs after culture for 12 d in the presence or absence of MPA and E2 + RLX (decidualization induction) were analyzed for WT1 mRNA levels (B). Note the increase of WT1 mRNA (12.5-fold, P < 0.05) in ESCs cultured for 12 d in the presence of decidualization factors (lane D), compared with control ESCs (cultured without decidualization factors, lane C). The blots are representative of results obtained in three replicate experiments. Quantitation of data were analyzed with phase 3 image analysis software (Glenn Mills, PA). Lane + are mesothelioma cells as positive control; (-) is negative control (H20) for the RT-PCR reaction.

 


View larger version (17K):
[in this window]
[in a new window]
 
Figure 8. Total protein samples prepared from human ESCs after culture for 12 d in the presence (lane D) or absence (lane C) of decidualization induction were analyzed for WT1 protein levels. The immunoblots are representative of results obtained in three replicate experiments. Note the increase of WT1 protein (16-fold P < 0.05) in decidualized ESCs (lane D). Quantitation of data was analyzed with phase 3 image analysis software (Glenn Mills, PA).

 
The events leading to decidual transformation in response to E2, progesterone, and RLX are difficult to catalog because of the extended treatment period required in vitro. This can be circumvented, at least to some degree, by utilization of cAMP analogues because activation of PKA is central to and accelerates decidualization (30, 36). The induction of WT1 protein was apparent within 24 h of stimulation of ESCs with cAMP/MPA and was maximal at 48 and 72 h (Fig. 9CGo). Analysis of WT1 mRNA expression, by RT-PCR and Southern blot analysis, in response to this accelerated induction of decidualization revealed an increase 24 and 48 h after stimulation with cAMP/MPA (Fig. 9Go, A and B).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 9. Total RNA obtained from ESCs following treatment with cAMP/MPA for 1 and 2 d were analyzed for expression of WT1 by RT-PCR (A) and subsequent Southern blotting (B). The apparent abundance of WT1 mRNA was increased by the short-term decidualization protocol (1–2 d of treatment with cAMP/MPA) and preceded the increase in WT1 protein (observed by Western blotting [C]) in response to stimulation that was initially apparent at 2 d and most prominent after 3 d of treatment (C). The K562 and C1RA2 cells were used as positive and negative controls, respectively, in Western blotting. The authenticity of WT1 PCR products was also confirmed by DNA sequencing.

 
Discussion

WT1 is a transcription regulatory factor implicated in the development of the genitourinary system and possibly the placenta. We report that human endometrial stromal cells contain WT1 transcripts similar to those expressed in early (37) and term (25) placenta. Expression is significantly increased upon decidualization, which is consistent with evidence gained in rodents (26). Two alternative splice sites are used to produce at least four isoforms of WT1 mRNA. One splice introduces 17 amino acids into the protein just proximal to the first zinc finger. The second splicing alternative generates a protein with three amino acids (lysine, threonine, and serine, hence KTS) inserted between the third and fourth zinc fingers. Such alteration in splicing pattern suggests a molecular basis for modulation of biological function of WT-1 protein (38). Interestingly, we demonstrated the presence of four different messages, reflecting the absence or presence of two alternatively spliced insertions of 51 and 9 bp, respectively. This is consistent with the demonstration that the WT1 transcript is spliced differently in a variety of tissues (35), including rat (39) and human ovary (40). The existence of alternative isoforms of WT1 protein with potentially different tissue-specific activity probably confers a wide repertoire of modes of action. Moreover, these protein variants can be variably regulated in different stages of differentiation (41). However, it has been shown in the ovary that the ratio of the four WT1 splicing products does not vary during development (39), but this does not restrict the potential for modulation of the function of other proteins with which WT-1 isoforms may interact directly or indirectly.

The uterus is unique in undergoing cyclic growth and differentiation in response to hormonal and gestational stimuli, respectively. Although the histological features of the decidual reaction have been well studied, the molecular events that regulate the differentiation of stromal cells are poorly understood. In vitro models of decidualization have been developed and used to analyze the process, and some morphological and biochemical events have been characterized (5, 14, 41, 42). WT1 expression in the endometrium was found to be regulated in a differentiation-dependent manner. The protein was detectable at relatively moderate levels in uterine stroma cells during the normal cycle but increased significantly with decidualization in vivo. ESCs in vitro have been shown to respond to the combination of E, progestins, and RLX, which induce a decidual-like differentiation including alterations in enzymatic activity, modification of extracellular matrix protein synthesis, and the secretion of IGFBP-1 and PRL (43). Consistent with these observations, sex steroids and RLX significantly increased WT1 mRNA and protein expression levels in cultured stromal cells. Moreover, the accelerated induction of decidualization by combination of cAMP and MPA, previously shown to facilitate the synergistic activation of the decidual PRL promoter and PRL production by ESCs (30), also stimulated WT1 mRNA and protein expression. This relatively rapid induction of WT1 mRNA, within the first 24 h of treatment, is consistent with the kinetics of induction of this mRNA in cytotrophoblast cells in response to cAMP (25). Collectively, these observations demonstrate that WT1 is regulated during the hormone-mediated differentiation of ESCs and strengthens our hypothesis that this tumor suppressor gene may serve as an early effector transcription factor controlling decidualization in the human endometrium.

The highly selective association of WT1 expression with differentiated decidual cells in vivo provides further suggestive evidence of a key role in regulating the differentiation of stromal fibroblasts into decidual cells. Indeed, WT1 expression has been shown to be tightly regulated during the terminal differentiation of other cell types in the urogenital system. WT1 gene expression in the developing kidney appears to be correlated with the transition from a mesenchymal to an epithelial phenotype as mesenchymal nephrogenic elements are transformed into differentiated renal epithelial cells (19, 44). The well-documented target of WT1 gene products in various in vitro models is the IGF system (45, 46). WT1 gene products have been shown to repress the IGF-II gene and its receptor gene, namely the IGF-I receptor. It has been shown in turn that the IGF-II mRNA is expressed throughout human endometrial stroma and type I and type II IGF receptor mRNAs are both present in human endometrial stroma but are relatively more abundant in endometrial epithelium (47). Thus, WT1 may inhibit the production of receptors for both IGF-I and II and induce endometrial stromal arrest, directing them toward differentiation. Such restriction of IGF action is consistent with the proposed role of decidualization-induced IGFBP-1 during ESC differentiation (24). WT1 also suppresses growth factors encoding genes such as colony-stimulating factor-1, and TGFß 1 (48, 49). These factors, in turn, are expressed in ESCs and are regulated during decidualization (50, 51). In addition to these effects, WT1 protein is a powerful repressor of its own gene (52).

In summary, the results of this study demonstrate that WT1 mRNA and protein are expressed in human ESCs and that this expression is increased as stromal fibroblasts differentiate into decidual cells. The expression of the WT1 tumor suppressor transcription factor appears to be an early marker of decidual cell differentiation, thus implicating this specific factor in the differentiation process. The regulated expression of WT1 in endometrial cells undergoing decidualization suggests that this tumor suppressor gene may also fulfill an embryoregulatory role during human implantation. Furthermore, the regulated expression of WT1 in cultured endometrial stromal cells reflects the spatiotemporal expression of this endometrial tumor suppressor gene in vivo demonstrating that these cell cultures will provide an ideal model system in which to define the role(s) of WT1 in the complex processes of decidualization. These studies not only add to our understanding of the cyclic remodeling process that occurs in the human endometrium in preparation for the implanting embryo but also gives us useful insight into the molecular biology of the family of early growth response gene.

Acknowledgments

We are grateful for the kind gift of the PWT33 plasmid from Frank Rauscher (Wistar Institute, Philadelphia, PA).

Footnotes

This work was supported in part from funds made available from the Institute of Obstetrics and Gynecology Trust Fund and the Alexander Onassis Foundation (to A.M.).

Abbreviations: ESC, Endometrial stromal cell; IGFBP, IGF-binding protein; MPA, medroxyprogesterone acetate; RLX, relaxin; WT1, Wilms’ tumor suppressor gene.

Received January 24, 2001.

Accepted August 26, 2001.

References

  1. O’Shea JD, Kleinfeld RG, Morrow HA 1983 Ultrastructure of decidualization in the pseudopregnant rat. Am J Anat 166:271–298[CrossRef][Medline]
  2. Bell SC 1983 Decidualization: regional differentiation and associated function. Oxf Rev Reprod Biol 5:220–271
  3. Lala PK, Kearns M, Covavincenzo V 1984 Cells of the fetomaternal interface: their role in the maintenance of viviparous pregnancy. Am J Anat 170:501–517[CrossRef][Medline]
  4. Maslar IA, Riddick DH 1979 Prolactin production by human endometrium during the normal menstrual cycle. Am J Obstet Gynecol 118:652–670
  5. Telgmann R and Gellersen B 1998 Marker genes of decidualization: activation of the decidual prolactin gene. Hum Reprod Update 4:472–479[Abstract/Free Full Text]
  6. Waites GT, James RFL, Bell SC 1988 Immunohistological localization of the human endometrial secretory protein pregnancy associated endometrial a1-globulin, an insulin like growth factor-binding protein, during the menstrual cycle. J Clin Endocrinol Metab 67:1100–1104[Abstract/Free Full Text]
  7. Gao JG. Mazella J, Tseng L, et al. 1994 Activation of the human IGFBP-1 gene promoter by progestin and relaxin in primary culture of human endometrial stromal cells. Mol Cel Endocrinol 104:39–46[CrossRef][Medline]
  8. Huang A, Campbell CE, Bonetta L, et al. 1990 Tissue, developmental, and tumor-specific expression of divergent transcripts in Wilms’ tumor. Science 250:990–994
  9. Tang B, Gurpide E 1993 Direct effect of gonadotropins on decidualization of human endometrial stromal cells. J Steroid Biochem Mol Biol 47:115–121[CrossRef][Medline]
  10. Tabanelli S, Tang B, Gurpide E, et al. 1992 In vitro decidualization of human endometrial stromal cells. J Steroid Mol Biol 42:337–344
  11. Bogic LV, Mandel M, Bryant-Greenwood GD, et al. 1995 Relaxin gene expression in human reproductive tissues by in situ hybridization. J Clin Endocrinol Metab 80:130–137[Abstract]
  12. Makrigiannakis A, Zoumakis E, Margioris AN, Theodoropoulos P, Stournaras C, Gravanis A 1995 The corticotropin-releasing hormone (CRH) in normal and tumoral epithelial cells of human endometrium. J Clin Endocrinol Metab 80:185–189[Abstract]
  13. Zoumakis E, Margioris AN, Stournaras C, et al. 2000 Corticotropin-releasing hormone (CRH) interacts with inflammatory prostaglandins and interleukins and affects the decidualization of human endometrial stroma. Mol Hum Reprod 6:344–351[Abstract/Free Full Text]
  14. Giudice LC 1997 Multifaceted roles of IGFBP-1 in human endometrium during implantation and pregnancy. Ann N Y Acad Sci 828:146–156[Medline]
  15. Weinberg RA 1991 Tumor suppressor genes. Science 351:453–456
  16. Lee SB, Haber DA 2001 Wilms tumor and the WT1 gene. Exp Cell Res 264:74–99 (Review)[CrossRef][Medline]
  17. Gessler M, Poustka A, Cavenee W, Neve RL, Orkin SH, Bruns GA 1990 Homozygous deletion in Wilms tumors of a zinc-finger gene identified by chromosome jumping. Nature 343:774–778[CrossRef][Medline]
  18. Rauscher 3rd FJ 1993 The WT1 Wilms tumor gene product: a developmentally regulated transcription factor in the kidney that functions as a tumor suppressor. FASEB 7:896–903[Abstract]
  19. Pelletier J, Schalling M, Buckler AJ, Rogers A, Haber DA, Housman D 1991 Expression of the Wilms’ tumor gene WT1 in the murine urogenital system. Genes Dev 5:1345–1456[Abstract/Free Full Text]
  20. Drummond IA, Madden SL, Rohwer-Nutter P Bell GI, Sukhatme VP, Rauscher 3rd FJ 1992 Depression of insulin-like growth factor II gene by the Wilms’ tumor suppressor, WT1. Science 257:674–678[Abstract/Free Full Text]
  21. Werner H, Hernandez-Sanchez C, Karnieli E, Leroith D 1995 The regulation of IGF-I receptor gene expression. Int J Biochem Cell Biol 27:987–994[CrossRef][Medline]
  22. Tang XM, Rossi MJ, Masterson BJ, Chegini N 1994 Insulin-like growth factor I (IGF-I), IGF-I receptors, and IGF binding proteins 1–4 in human uterine tissue: tissue localization and IGF-I action in endometrial stromal and myometrial smooth muscle cells in vitro. Biol Reprod 50:1113–1125[Abstract]
  23. Clemmons DR, Thraikill KM, Handeverger S, Busby Jr WH 1990 Three distinct forms of insulin-like growth factor binding proteins are released by decidual cells in culture. Endocrinology 127:643–650[Abstract/Free Full Text]
  24. Giudice LC, Dsupin BA, Irwin JC 1992 Steroid and peptide regulation of insulin-like growth factor-binding proteins secreted by human endometrial stromal cells is dependent on stromal differentiation. J Clin Endocrinol Metab 75:1235–1241[Abstract]
  25. Feingold M, Zilberstein M, Srivastava RK, Seibel MM, Bar-Ami S, Hambartsoumian E 1998 Expression of Wilms’ tumor suppressor gene (WT1) in term human trophoblast: regulation by cyclic adenosine 3', 5'-monophosphate. J Clin Endocrinol Metab 83:2503–2508[Abstract/Free Full Text]
  26. Zhou J, Rauscher III FJ, Bondy C 1993 Wilms’ tumor (WT1) gene expression in rat decidual differentiation. Differentiation 54:109–114[CrossRef][Medline]
  27. Charles AK, Mall S, Watson J, Berry PJ 1997 Expression of the Wilms’ tumor suppressor gene WT1 in the developing human and in pediatric renal tumors: an immunohistochemical study. Mol Pathol 50:138–144[Abstract/Free Full Text]
  28. Noyes RW, Hertig AT, Rock J 1950 Dating the endometrial biopsy. Fertil Steril 1:3–25
  29. Huang R, Tseng L, Bischof P, Janne OA 1987 Regulation of prolactin production by progestin, estrogen and relaxin in human endometrial stromal cells. Endocrinology 121:2011–2017[Abstract/Free Full Text]
  30. Brosens JJ, Hayashi N, White JO 1999 Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology 140:4809–4820[Abstract/Free Full Text]
  31. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]
  32. Chomzynski P, Sacchi N 1987 Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159[Medline]
  33. Ueyama H, Inazawa J, Nishino H, Han-Xiang D, Ochiai Y, Ohkubo I 1995 Chromosomal mapping of the human smooth muscle actin gene (enteric type, ACTA3) to 2p13.1 and molecular nature of the hindIII polymorphism. Genomics 25:720–723[CrossRef][Medline]
  34. Zumbansen M, Stoffel W 1997 Tumor necrosis factor {alpha} activates NF-{kappa}B in acid sphingomyelinase-deficient mouse embryonic fibroblasts. J Biol Chem 272:10904–10909[Abstract/Free Full Text]
  35. Haber DA, Sohn RL, Buckler AJ, Pelletier J, Call KM, Housman DE 1991 Alternative splicing and genomic structure of the Wilm’s tumor gene WT1. Proc Natl Acad Sci USA 88:9618–9622[Abstract/Free Full Text]
  36. Telgmann R, Maronde E, Tasken K, Gellersen B 1997 Activated protein kinase A is required for differentiation-dependent transcription of the decidual prolactin gene in human endometrial stromal cells. Endocrinology 138:929–937[Abstract/Free Full Text]
  37. Jinno Y, Yun K, Nishiwaki, et al. 1994 Mosaic and polymorphic imprinting of the WT1 gene in humans. Nat Genet 6:305–309[CrossRef][Medline]
  38. Laity JH, Dyson HJ, Wright PE 2000 Molecular basis for modulation of biological function by alternate splicing of the Wilms’ tumor suppressor protein. Proc Natl Acad Sci USA 97:11932–11935[Abstract/Free Full Text]
  39. Hsu SY, Kubo M, Chun SY, Haluska FG, Housman DE, Hsueh AJ 1995 Wilms’ tumor protein WT1 as an ovarian transcription factor: decreases in expression during follicle development and repression of inhibin-{alpha} gene promoter. Mol Endocrinol 9:1356–1366[Abstract/Free Full Text]
  40. Makrigiannakis A, Amin K, Coukos G, Tilly JL, Coutifaris C 2000 Regulated expression and potential roles of p53 and Wilms’ tumor suppressor gene (WT1) during follicular development in the human ovary. J Clin Endocrinol Metab 85:449–59[Abstract/Free Full Text]
  41. Ye Y, Raychaudhuri B, Gurney A, Campbell CE, Williams BR 1996 Regulation of WT1 by phosphorylation: inhibition of DNA binding, alteration of transcriptional activity and cellular translocation. EMBO J 15:5606–5615[Medline]
  42. Petraglia F, Tabanelli S, Galassi MC, et al. 1992 Human decidua and in vitro decidualized endometrial stromal cells at term contain immunoreactive corticotropin-releasing factor (CRF) and CRF messenger ribonucleic acid. J Clin Endocrinol Metab 74:1427–1431[Abstract]
  43. Irwin JC, Kirk D, King RJB, Quigley MM, Gwatkin RBL 1989 Hormonal regulation of human endometrial stroma cells in culture: an in vitro model for decidualization. Fertil Steril 52:761–768[Medline]
  44. Van Hemminwey V, Haske ND 1992 Wilms’ tumor: reconciling genetics and biology. Trends Genet 8:16–21[CrossRef][Medline]
  45. Rodgers MB, Hasler BA, Gudas LJ 1991 Specific expression of retonic acid-regulated, zinc-finger gene, Rex-1, preimplantation embryo, trophoblast, and spermatocytes. Development 113:815–824[Abstract]
  46. Ng YK, George KM, Eugel JD, Linzer DI 1994 GATA factor activity is required for the trophoblast-specific transcription regulation of the mouse placental lactogen I gene. Development 120:3257–3266[Abstract]
  47. Zhou Z, Dsupin BA, Guidice LC, Bondy CA 1994 Insulin-like growth factor system gene expression in human endometrium during the menstrual cycle. J Clin Endocrinol Metab 79:1723–1734[Abstract]
  48. Harrington MA, Konicek B, Song A, et al. 1994 Inhibition of colony-stimulating factor-1 promoter activity by the product of the Wilms’ tumor locus. J Biol Chem 268:21271–21275[Abstract/Free Full Text]
  49. Kanzaki H, Hatayama H, Narakawa S, Kariya M, Fujita J, Mori T 1995 Hormonal regulation in the production of macrophage colony-stimulation factor and transforming growth factor-ß by human endometrial stromal cells in culture. Horm Res [Suppl 2] 44:30–35
  50. Kariya M, Kanzaki H, Hanamura T, et al. 1994 Progesterone-dependent secretion of macrophage colony-stimulating factor by human endometrial stromal cells of nonpregnant uterus in culture. J Clin Endocrinol Metab 79:86–90[Abstract]
  51. Loverro G, Perlino E, Maiorano E, et al. 1999 TGF-ß 1 and IGF-1 expression in atrophic post-menopausal endometrium. Maturitas 31:179–184[CrossRef][Medline]
  52. Rupprecht HD, Drummond IA, Madden SL, Rauscher 3rd FJ, Sukhatme VP 1994 The Wilms’ tumor suppressor gene WT1 is negatively autoregulated. J Biol Chem 269:6198–6206[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
J. D. Graham, M. L. Yager, H. D. Hill, K. Byth, G. M. O'Neill, and C. L. Clarke
Altered Progesterone Receptor Isoform Expression Remodels Progestin Responsiveness of Breast Cancer Cells
Mol. Endocrinol., November 1, 2005; 19(11): 2713 - 2735.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
F. W. Anthony, D. D. Mukhtar, M. A. Pickett, and I. T. Cameron
Progesterone Up-Regulates WT1 mRna and Protein, and Alters the Relsative Expression of WT1 Transcripts in Cultured Endometrial Stromal Cells
Reproductive Sciences, December 1, 2003; 10(8): 509 - 516.
[Abstract] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Gurates, S. Sebastian, S. Yang, J. Zhou, M. Tamura, Z. Fang, T. Suzuki, H. Sasano, and S. E. Bulun
WT1 and DAX-1 Inhibit Aromatase P450 Expression in Human Endometrial and Endometriotic Stromal Cells
J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4369 - 4377.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Makrigiannakis, A.
Right arrow Articles by White, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Makrigiannakis, A.
Right arrow Articles by White, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals