| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Instituto de Investigaciones Materno Infantil, IDIMI y Departamento de Obstetricia y Ginecología (L.D., P.K., R.R.G., O.C., M.V.), and Departamento de Patología (I.R.), Facultad de Medicina, Universidad de Chile; Hospital Clínico San Borja Arriarán, 6519100 Santiago, Chile; Facultad de Ciencias Biológicas, Pontificia Universidad Católica (P.C.), Santiago, Chile; and Center for Research on Reproduction and Women’s Health, University of Pennsylvania (L.K.C., J.F.S.), Philadelphia, Pennsylvania 19104
Address all correspondence and requests for reprints to: Dr. Luigi Devoto, Instituto de Investigaciones Materno-Infantil, Departamento de Obstetricia y Ginecología, Facultad de Medicina, Universidad de Chile, P.O. Box 226-3, 6519100 Santiago, Chile. E-mail: ldevoto{at}machi.med.uchile.cl
Abstract
The expression of the steroidogenic acute regulatory protein (StAR) in the human corpus luteum (CL) was examined throughout the luteal phase. The primary 1.6-kb StAR transcript was in greater abundance in early (3.1-fold) and mid (2.2-fold) luteal phase CL compared with late luteal phase CL. The larger StAR transcript (4.4 kb) was found in early and midluteal phase CL, but was not detected in late luteal phase specimens. Mature StAR protein (30 kDa) was present in lower amounts within late CL compared with early and midluteal phase CL. The StAR preprotein (37 kDa) was also detected in greater abundance in early and midluteal CL. Immunohistochemistry revealed that StAR staining was most prominent in thecal-lutein cells throughout the luteal phase. The intensity of the signal for StAR exhibited significant changes throughout the luteal phase, being most intense during the midluteal phase and least during the late luteal phase. Plasma progesterone concentrations were highly correlated (r = 0.73 and r = 0.79) with luteal expression of the preprotein and mature StAR isoforms, respectively, throughout the luteal phase. To examine the LH dependency of StAR expression, the GnRH antagonist, Cetrorelix, was administered during the midluteal phase. Cetrorelix caused a decline in serum LH levels within 2 h, which, in turn, caused a pronounced decline in plasma progesterone within 6 h. The StAR 4.4-kb transcript was not detectable, and the 1.6-kb transcript was reduced by approximately 50% within 24 h of Cetrorelix treatment. The mature 30-kDa StAR protein level declined approximately 30% after Cetrorelix treatment. We conclude that 1) StAR mRNA and protein are highly expressed in early and midluteal phase CL; 2) StAR protein is present in both thecal-lutein and granulosa-lutein cells throughout the luteal phase; 3) StAR protein levels in the CL are highly correlated with plasma progesterone levels; 4) declining StAR mRNA and protein levels are characteristic of late luteal phase CL; and 5) suppression of LH levels during the midluteal phase results in a marked decline in plasma progesterone and a diminished abundance of StAR transcripts in the CL without a corresponding significant decline in StAR protein. Collectively, these data are consistent with the idea that StAR gene expression is a key determinant of luteal progesterone during the normal menstrual cycle. However, the pharmacologically induced withdrawal in the midluteal phase of LH support diminishes luteal progesterone output by mechanisms others than reduced StAR protein levels.
PROGESTERONE DERIVED from the corpus
luteum (CL) is required for the development of a receptive endometrium
and for the maintenance of early gestation. During the menstrual cycle,
CL development and steroidogenesis are dependent on pituitary-derived
LH (1). During the cycle of conception, the CL is rescued
by trophoblastic production of hCG. LH and hCG bind to and activate a
specific glycoprotein LH/hCG membrane receptor on luteal cells that
regulates genes essential for steroid biosynthesis. The action of
LH/hCG on luteal cells is mediated predominantly by the cAMP second
messenger system (2). However, a variety of growth factors
and cytokines, including IL-1ß (3), TNF
(4), insulin, IGF-I (5, 6), and IGF-binding
proteins (7), modulate the action of LH on
steroidogenesis. The level of progesterone production is determined by
several factors, including the uptake of lipoprotein-carried
cholesterol, cholesterol translocation to the inner mitochondrial
membrane, and expression and activity of cytochrome P450 side-chain
cleavage and 3ß-hydroxysteroid dehydrogenase, the enzymes involved in
the conversion of cholesterol to progesterone (8). The
rate-limiting step in progesterone synthesis appears to be movement of
cholesterol from the outer to the inner mitochondrial membrane where
the cytochrome P450 side-chain cleavage system is located
(8). Steroidogenic acute regulatory protein (StAR), a
phosphoprotein expressed in steroidogenic cells, is essential for this
sterol translocation process (9). Human granulosa cells,
which contain low concentrations of StAR before the ovulatory surge of
LH, acquire large amounts of StAR during luteinization
(10). There is limited information regarding the
expression of StAR in human CL throughout the luteal phase (11, 12). In the present study we examined StAR mRNA expression,
protein levels, and the immunolocalization of StAR in granulosa-lutein
and thecal-lutein cells in CL of different ages. We hypothesized that
StAR mRNA expression and protein levels are regulated within the CL
throughout the luteal phase, playing a key role in controlling luteal
progesterone production during the development and demise of the
CL.
Subjects and Methods
Subjects
CL were enucleated at the time of minilaparotomy from 20 women undergoing tubal ligation. All subjects gave informed consent to participate in this study. The surgery was scheduled at varying times throughout the luteal phase at the Hospital Clinico San Borja Arriarán, National Health Service, University of Chile (Santiago, Chile). All women were healthy, aged 33–42 yr, with normal body mass index, and regular menstrual cycles, and they had not received any form of hormonal treatment for at least 3 months before participating in the study. Blood was collected before surgery for steroid determinations. Three women undergoing tubal ligation were administered Cetrorelix (2 mg, sc; ASTA Medica AWD GmnH, Frankfurt, Germany) during the midluteal phase 24 h before surgery. Plasma LH and progesterone were determined by specific RIA as previously reported (5). These studies were approved by the internal review board of the Hospital Clinico San Borja Arriarán.
Dating of the CL
The CL were dated on the basis of the presumptive day of ovulation (d 0), which was determined by serial urinary LH measurements or serial vaginal ultrasound images of the ovaries and was confirmed by the histological dating of an endometrial biopsy. Additionally, plasma progesterone levels and the histological features of each CL were used to confirm tissue dating. The principal light microscopic criteria used in determining the age of the CL included the sprouting of capillaries into the granulosa cells, the luteinization of granulosa cells, the prominent morphological difference between thecal-lutein and granulosa-lutein layers, the appearance of fibroblasts in the central cavity, and shrinkage and vacuolization of the granulosa cells (13). The CL were classified as early (4 d postovulation; n = 4), mid (5–10 d postovulation; n = 7), and late (>11 d of ovulation; n = 6).
The entire CL was enucleated from the ovary and immediately transported under sterile conditions to the laboratory. The CL was washed with cold NaCl (0.9%) solution to remove blood clots and immediately divided into radial blocks. Tissue for histology and immunohistochemistry was fixed in 4% buffered paraformaldehyde and embedded in paraffin wax. Other pieces were snap-frozen in liquid nitrogen and stored at -70 C for subsequent RNA and protein extraction.
Northern blot analysis
Total RNA was prepared as described by Chomczynski and Sacchi (14) and quantified by absorbance at 260 nm. Northern analysis was carried out using the StAR cDNA as a probe (10). Briefly, 10 µg total RNA were resolved on 1% agarose-formaldehyde gels, blotted onto a GeneScreen Plus nylon membrane (NEN Life Science Products, Boston, MA), and cross-linked by UV irradiation. The membranes were prehybridized for 30 min at 42 C in ULTRAhyb hybridization solution (Ambion, Inc., Austin, TX). Hybridization was carried out overnight at 42 C in the same solution after addition of the 32P-labeled probe (106 cpm/ml solution). Membranes were washed twice for 5 min each time at 42 C in 0.5 x SSC/0.1% SDS, followed by two washes in 0.1 x SSC/0.1% SDS for 15 min each time at 42 C. Blots were exposed to x-ray film for 24 h. StAR signals were normalized for loading differences with the densitometric values obtained for 28S rRNA ethidium staining. Intensities of autoradiographic signals/ethidium staining were estimated by densitometric scanning using a BioImage Scanner UMAX VistaScan T630 (BioImage, Ann Arbor, MI; software NIH 1.6).
Quantitative real-time RT-PCR
Total RNA (5 µg) from patients (n = 2) at each stage of the luteal phase was treated with RQ1-ribonculease-free deoxyribonuclease (Promega Corp., Madison, WI) for 30 min at 37 C before RT with Moloney murine leukemia virus reverse transcriptase (Promega Corp.) as described by the manufacturer. The resulting cDNA were subjected to quantitative real-time PCR. The forward (CCACCCCTAGCACGTGGAT) and reverse (TCCTGGTCACTGTAGAGAGTCTCTTC) primers and probe (CGGAGCTCTCTACTCGGTTCTCGGC) were designed to span an intronic splice site (intron 5) with the Primer Express software package that accompanies the PE Applied Biosystems 7700 sequence detector (Perkin-Elmer Corp., Foster City, CA). The real-time PCR used 900 nM of each primer, 200 nM probe, and the TaqMan Universal Master Mix (PE Applied Biosystems). Agarose gel electrophoresis indicated the presence of a single PCR product. To account for differences in starting material the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers and probe reagents from PE Applied Biosystems were used as described by the manufacturer. The experimental and GAPDH PCR reactions were performed in separate tubes in triplicate, and the average threshold cycle for the triplicate was used in all subsequent calculations. The coefficient of variation among the triplicates for the StAR and GAPDH PCR reactions were 0.52 ± 0.19% and 0.50 ± 0.20%, respectively.
Western blot analysis
Luteal tissues were homogenized in a buffer containing 20 mM HEPES, 100 mM KCl, 1 mM dithiothreitol, 2 mM EDTA, 0.2 mM phenylmethylsulfonylfluoride, and 50 mM benzamidine and centrifuged at 10,000 x g for 15 min. The supernatant was recovered and used for Western blotting. Protein concentrations were determined by the Bio-Rad Laboratories, Inc., dye-binding assay. Five micrograms of protein extract were loaded onto 10% SDS-PAGE gels for electrophoresis. After electrophoresis, proteins were transferred to polyvinylidene difluoride membranes (Hybridon, Millipore Corp., Bedford, MA). The membranes were incubated with a rabbit polyclonal antihuman StAR antibody as previously described (15). The antirabbit Vistra ECF Western blotting kit (Amersham Pharmacia Biotech, Arlington Heights, IL) was used to detect the primary antibody and generate a chemifluorescence signal that was quantified on a Storm Phosphor Imager (Molecular Dynamics, Sunnyvale, CA) using the blue fluorescence/chemifluorescence mode. ImageQuant 1.1 software (Molecular Dynamics, Inc.) was used to analyze the signals for both preprotein and mature StAR protein.
Immunohistochemical localization of StAR in human CL
Tissue sections (5 µm) of early (n = 4), mid (n = 4), and late CL (n = 4) luteal phases and placenta were mounted on ProbeOn Plus slides (Fisher Scientific, Pittsburgh, PA) and deparaffinized with a xylol substitute solvent (Poly/clear solvent, DAKO Corp., Carpinteria, CA) as previously reported (16). The sections were stained by the peroxidase conjugate technique (Calbiochem-Novabiochem Co., La Jolla, CA) using capillary technology (FisherBiotech MicroProbe Staining System). Briefly, these sections were incubated in 3% H2O2 to block endogenous peroxidase activity. Nonspecific binding was suppressed with normal goat serum diluted 1:10 in PBS containing 4% BSA. The sections were incubated with a rabbit polyclonal anti-StAR antibody at a dilution of 1:500. After three washes in PBS, the sections were incubated with a goat antirabbit IgG-peroxidase conjugate diluted 1:2000. Color was developed with 3,3'-diaminobenzidine tetrahydrochloride (DAKO Corp.). The sections were counterstained with Mayer’s hematoxylin solution (DAKO Corp.).
Incubation with normal rabbit serum in place of anti-StAR antibody served as a negative control, as did staining of placental tissue, which does not express StAR. Slides were evaluated by two observers using a subjective semiquantitative scale of 0 for no staining, + for minimal staining, 2+ for moderate staining, and 2++ for intense staining.
Statistical analysis
Northern and Western blotting experiments performed with CL
tissue included at least four subjects for each stage of the luteal
phase. All data were analyzed by ANOVA. Differences among individual
means were tested using t tests. P < 0.05
was considered statistically significant. The relationship between StAR
protein level and plasma progesterone concentrations was determined by
linear regression analysis ( = 0.05).
Results
Table 1
presents the clinical
characteristics of the subjects, including plasma progesterone and
17ß-E2 concentrations for the different stages of the luteal phase
and after GnRH antagonist treatment. There were no differences in mean
age and BMI of the subjects between the groups. The mean weight of the
CL was significantly greater during the early and midluteal phases
compared with the late luteal phase. Treatment of women with Cetrorelix
caused a pronounced decline in CL weight compared with the control
midluteal phase CL. Levels of progesterone and E2 at the time of
surgery were greater (P < 0.05) in the early and
midluteal phases than those measured during the late luteal phase or
after Cetrorelix treatment.
|
. The 1.6-kb transcript was most
abundant in CL throughout the luteal phase. The 4.4-kb StAR transcript
was most abundant in midluteal phase CL, with smaller amounts found in
early CL, whereas none was detected in late CL. Figure 1B illustrates
the densitometric analysis of StAR mRNA (1.6-kb transcript) levels in
human CL, which revealed that the relative abundance was 3.1-fold
greater in early phase CL and 2.2-fold greater in midluteal phase CL
compared with late CL (P < 0.05). Real-time
quantitative RT-PCR results were similar to the Northern data, with
early and midluteal phase CL exhibiting 2.87 ± 0.19- and
2.68 ± 0.13-fold more StAR mRNA than that observed in late
CL.
|
depicts a representative
Western blot for StAR proteins in luteal tissues of different ages. The
blot shows immunoreactive bands at 37 and 30 kDa that represent the
StAR preprotein and the mature StAR protein, respectively. The 30-kDa
StAR protein was most abundant in early and midluteal phase CL and was
diminished in late CL extracts. The StAR preprotein (37 kDa) was
visualized in early and midluteal CL and to a lesser extent in late CL.
The relative abundance of the 30-kDa species was 2.5-fold greater in
early CL and 3-fold greater in mid CL compared with late CL
(P < 0.05; Fig. 2B).
|
shows the light microscopic
features and the immunohistochemical identification of StAR within CL
collected throughout the luteal phase. The overall staining intensity
for tissues collected during each stage of the luteal phase was
consistent among the four patients at each stage. Thecal-lutein cells
and granulosa-lutein cells stained for StAR at all stages of the luteal
phase. StAR was localized in the cytoplasm of the steroidogenic luteal
cells, whereas nonsteroidogenic cells, such as endothelial and immune
cells, failed to stain for StAR as expected. Steroidogenic cells could
be further distinguished based on their morphology and distribution as
either thecal-lutein and granulosa-lutein cells within the tissue
sections. The smaller thecal-lutein cells exhibited the greatest
staining intensity (+++) during the midluteal phase, although staining
was detected in these cells in both early and late CL. The staining
intensity among cells in a given section was uniform. In contrast to
the thecal-lutein cells, granulosa-lutein cells displayed dramatic
changes in StAR staining, exhibiting moderate staining in the early CL
with a large increase in midluteal phase CL and diminished staining in
late luteal phase. Unlike the thecal-lutein cells, the staining of
granulosa-lutein cells was not homogeneous; granulosa-lutein cells
adjacent to the central cavity exhibited stronger staining for StAR
than those near the capsule. In control experiments, no immunostaining
was noted when the primary antibody was omitted or when placental
tissue was tested (data not shown).
|
. The high correlation coefficients
(r = 0.73 and r = 0.79) for the StAR preprotein and the
mature protein, respectively, suggest an association between the
abundance of StAR protein within the CL and its steroidogenic capacity
throughout the luteal phase.
|
).
|
The human CL is a remarkable steroidogenic gland that produces up to 40 mg progesterone daily, reflecting a highly efficient steroidogenic machinery. It is known that StAR plays a key role in the steroidogenic process (17). StAR mRNA and protein expressions have been detected in CL of several species, including the bovine (18), ovine (19), rabbit (20), and equine (21). Our laboratory previously demonstrated that StAR mRNA and protein are expressed in the human CL (10, 16). The present study extends our earlier observations to include the appraisal of StAR gene expression, protein levels, and immunohistochemical localization of StAR within the steroidogenic cells of the CL throughout the luteal phase. It is well accepted that StAR is responsible for translocation of cholesterol from the outer to the inner mitochondrial membrane, the rate-limiting step in steroid hormone production (22). Thus, to better understand the significant steroidogenic changes that occur during the human luteal phase, it was important to define StAR gene expression and protein levels within the CL.
Our data confirm the recent findings of Chung et al. (11) and Duncan et al. (12), which indicate that the 1.6-kb transcript is the dominant StAR mRNA expressed in the human CL throughout the luteal phase. However, the pattern for StAR gene expression determined in the present study differs from that reported by these investigators. Our Northern and quantitative RT-PCR results illustrate that the StAR mRNA is most abundant during the early and midluteal phases and declines significantly in late luteal phase CL. In contrast, Chung et al. (11) found that expression of the 1.6-kb transcript was more abundant in early luteal phase CL, followed by a significant decrease in the mid and late luteal phase CL. On the other hand, Duncan et al. (12) reported that StAR mRNA abundance did not change throughout the luteal phase. These discrepancies might be explained by lack of precision in dating the stage of the luteal phase or heterogeneity of the subjects studied, including the impact of gynecological disease.
We detected a less abundant 4.4-kb transcript in early and mid CL. The 1.6- and 4.4-kb StAR transcripts vary in the length of the 3'-untranslated region, and both increase in response to tropic stimulation with different kinetics (8). It is interesting to note that the 4.4-kb transcript exhibited a greater response to 8-bromo-cAMP in proliferating human thecal cells (10) than proliferating human granulosa cells (15). However, the biological significance of these two transcripts is not known at this time.
To our knowledge this is the first report of the simultaneous assessment of StAR mRNA expression and protein levels in human CL of different ages. Western blot analysis indicated that the mature StAR (30-kDa) mitochondrial protein was the most abundant species within the CL throughout the luteal phase. Mature StAR protein decreased significantly during the late luteal phase, following the pattern of StAR mRNA. The levels of the 37-kDa preprotein changed in a similar pattern. Thus, changes in StAR mRNA, presumably determined by rates of StAR gene transcription, appear to control StAR protein levels. Moreover, in the present investigation we found a high correlation coefficient between the 30-kDa StAR protein and the 37-kDa StAR preprotein within the CL and the plasma concentrations of progesterone. This correlation is consistent with the hypothesis that StAR protein plays a key role in regulating luteal progesterone output.
Administration of GnRH antagonist resulted in a marked decline in LH, and with the fall in LH there was the expected reduction in progesterone levels (23, 24). The reduction in LH resulted in the complete loss of the 4.4-kb StAR transcript and a substantial decline in the 1.6-kb transcript. This pattern of StAR mRNA expression is similar to that found in the late luteal phase CL. Mature StAR protein was also reduced in luteal tissue from women receiving Cetrorelix. Interestingly, the level of the 37-kDa StAR preprotein did not appear to be similarly affected. The latter unexpected finding contrasts with the declining StAR mRNA and mature StAR protein levels. The 37-kDa preprotein is thought to be the active form of StAR, so the maintenance of preprotein levels in the face of declining progesterone levels is enigmatic. One possible explanation is that the phosphorylation state of StAR preprotein may be a critical determinant of StAR activity. StAR is phosphorylated by PKA in a cAMP-dependent manner (25). Thus, the Cetrorelix-induced fall in LH may have prevented StAR preprotein phosphorylation, diminishing StAR’s functional activity, resulting in reduced steroid output from the CL without a dramatic change in preprotein levels. Another possibility is that the loss of LH may have caused a reduction in the movement of StAR protein into the mitochondria, thus preventing the processing of StAR and resulting in a build-up of the preprotein. Alternatively, the decline in luteal progesterone production resulting from the Cetrorelix-induced LH withdrawal may be due to additional factors, including a reduced activity of other LH-dependent processes required for steroidogenesis (e.g. cholesterol esterase activity, lipoprotein-mediated cholesterol uptake, cholesterol transport to mitochondria).
We also assessed by immunohistochemistry the cellular localization of the StAR protein within the CL throughout the luteal phase. Our current findings agree with our previously described localization of StAR in the human CL, indicating that StAR is expressed in both thecal- and granulosa-lutein cells (10, 16). We found that StAR staining intensity was greatest in thecal-lutein cells of the CL regardless of the stage of the luteal phase. The more intense staining of the thecal-lutein cells may reflect their smaller volume compared with the larger granulosa-lutein cells. It could also reflect a higher level of gene expression. This would be concordant with the greater steroidogenic responsiveness of enriched small luteal cells and their significantly greater specific binding capacity for [125I]hCG compared with large luteal cells (26).
StAR immunostaining in granulosa-lutein cells was heterogeneous within the CL. Numerous intensely stained cells were interspersed among others that were only lightly stained. This pattern was observed in CL of all ages. Additionally, the granulosa-lutein cells close to the central cavity from mid CL exhibited the most intense staining. This interesting regional distribution is evidence for intraluteal control of StAR gene expression, possibly as a result of paracrine factors such as IGF-I, which is expressed in CL (5) and stimulates StAR expression (15, 27).
The underlying mechanisms controlling the diminished StAR gene and
protein expression during luteal regression could not be determined in
this study. However, several possible explanations can be suggested for
the diminished levels of StAR mRNA and protein. It was recently noted
by our group that IL-1ß and nitric oxide inhibit progesterone
synthesis by human luteal cells (3, 28). Cytokines have an
inhibitory action on StAR gene and protein expression
(29). In vitro experiments show that luteal
leukocytes secrete high levels of cytokines that inhibit hCG-stimulated
progesterone production (3, 4). Furthermore, TNF may
affect StAR gene expression by suppressing transcription
(29). Hence, intraluteal factors may control the
production of StAR and, consequently, the steroidogenic activity of the
CL.
Acknowledgments
We are grateful to Prof. Ludwig Wildt, University of Erlangen, for providing Cetrorelix. We also thank the Human Reproduction Program of WHO for providing the reagents for the progesterone assay.
Footnotes
This work was supported in part by Fondecyt Grant 1-99-0042; Rockefeller Grant PS-9903; and NIH Grants HD-06274, TW/HD-00671, and TW001485.
Abbreviations: CL, Corpus luteum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; StAR, steroidogenic acute regulatory protein.
Received January 9, 2001.
Accepted July 16, 2001.
References
) throughout the menstrual cycle and secretion of TNF
from the human corpus luteum. Eur J Obstet Gynecol Reprod Biol 83:213–217[CrossRef][Medline]
regulation of messenger
ribonucleic acid encoding steroidogenic acute regulatory protein in
human corpora lutea. Endocrine 8:153–160[CrossRef][Medline]
inhibits Leydig cell steroidogenesis through a
decrease in steroidogenic acute regulatory protein expression. Endocrinology 139:2863–2868This article has been cited by other articles:
 |
|
 |
|
  P. R. Manna, M. T. Dyson, and D. M. Stocco Regulation of the steroidogenic acute regulatory protein gene expression: present and future perspectives Mol. Hum. Reprod., June 1, 2009; 15(6): 321 - 333. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. V. Bishop, J. D. Hennebold, and R. L. Stouffer The effects of luteinizing hormone ablation/replacement versus steroid ablation/replacement on gene expression in the primate corpus luteum Mol. Hum. Reprod., March 1, 2009; 15(3): 181 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Y. Jarvela, A. Ruokonen, and A. Tekay Effect of rising hCG levels on the human corpus luteum during early pregnancy Hum. Reprod., December 1, 2008; 23(12): 2775 - 2781. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.D. Alvarez, A. Hansen, T. Ord, P. Bebas, P. E. Chappell, J. M. Giebultowicz, C. Williams, S. Moss, and A. Sehgal The Circadian Clock Protein BMAL1 Is Necessary for Fertility and Proper Testosterone Production in Mice J Biol Rhythms, February 1, 2008; 23(1): 26 - 36. [Abstract] [PDF]
|
|
|
|
 |
|
 F. Del Canto, W. Sierralta, P. Kohen, A. Munoz, J. F. Strauss III, and L. Devoto Features of Natural and Gonadotropin-Releasing Hormone Antagonist-Induced Corpus Luteum Regression and Effects of in Vivo Human Chorionic Gonadotropin J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4436 - 4443. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. V. Orozco, Z. Sosa, V. Fillipa, F. Mohamed, and A. M. Rastrilla The cholinergic influence on the mesenteric ganglion affects the liberation of ovarian steroids and nitric oxide in oestrus day rats: characterization of an ex vivo system J. Endocrinol., December 1, 2006; 191(3): 587 - 598. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Assou, T. Anahory, V. Pantesco, T. Le Carrour, F. Pellestor, B. Klein, L. Reyftmann, H. Dechaud, J. De Vos, and S. Hamamah The human cumulus-oocyte complex gene-expression profile Hum. Reprod., July 1, 2006; 21(7): 1705 - 1719. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Kohen, O. Castro, A. Palomino, A. Munoz, L. K. Christenson, W. Sierralta, P. Carvallo, J. F. Strauss III, and L. Devoto The Steroidogenic Response and Corpus Luteum Expression of the Steroidogenic Acute Regulatory Protein after Human Chorionic Gonadotropin Administration at Different Times in the Human Luteal Phase J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3421 - 3430. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. K. Yadav, R. R. Sudhagar, and R. Medhamurthy Apoptosis During Spontaneous and Prostaglandin F2{alpha}-Induced Luteal Regression in the Buffalo Cow (Bubalus bubalis): Involvementof Mitogen-Activated Protein Kinases Biol Reprod, September 1, 2002; 67(3): 752 - 759. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
