| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Institute for Biomedical Aging Research (G.U., H.R., P.B.), Austrian Academy of Sciences, Innsbruck, Austria A6020; and Department of Urology and Ludwig Boltzmann Institute for Andrology and Urology (E.P., M.W.), Lainz Hospital Vienna, Austria A1130
Address all correspondence and requests for reprints to: Peter Berger, Ph.D., Institute for Biomedical Aging Research, Austrian Academy of Sciences, Rennweg 10, A-6020 Innsbruck, Austria. E-mail: peter.berger{at}oeaw.ac.at
Abstract
Next to the sex steroid hormone T, PRL has been shown to influence prostatic function and development. Transgenic mice overexpressing the rat PRL gene develop dramatic enlargements of the prostate gland. Proliferation and secretory activities of epithelial cells are stimulated by PRL in rodents and men. Low concentrations of human PRL (hPRL) and hPRL receptors have been observed in human prostatic epithelial cells (ECs). The aim of this study was to compare regulation of the in vitro hPRL secretion in prostatic ECs and stromal smooth muscle cells (SMCs) after stimulation with seminal plasma (SMP), containing a variety of prostatic factors. SMCs released up to 1 ng hPRL/ml (i.e., approximately 500-fold more than unstimulated SMCs and ECs). Quantification of PRL mRNA by highly sensitive quantitative RT-PCR revealed that hPRL gene expression increased 5-fold within 24 h of SMP incubation. Sex steroids (dihydrotestosterone, progesterone, 17ß-estradiol), prostaglandins (PGE-1, PGE-2), and cAMP-stimulating substances (forskolin) were not responsible for induction of hPRL. Compared with endometrial SMCs, regulation of prostatic hPRL secretion was independent of progesterone and cAMP. HPLC analysis of human SMP revealed that the common action of at least two different proteins and a low molecular cofactor is required. We concluded that prostatic ECs secrete proteins acting synergistically with low-molecular-weight cofactors to induce differentiation and hPRL release in SMCs. Age-related increases in SMC-derived hPRL might contribute to the development of benign hyperplasia of the prostate.
THE HUMAN PROTEIN hormone PRL (hPRL), a protein of 23 kDa, is predominantly expressed in lactotroph cells of the pituitary and in the decidua. It plays important roles in the regulation of reproductive functions in both genders. In addition to stimulation of milk protein gene transcription in the mammary gland (1) and in regulation of testicular steroidogenesis (2, 3), hPRL is meant to be an essential factor for prostatic development and function (4).
The importance of PRL for development and function of the rodent prostate has been demonstrated in a transgenic mouse model, bearing the rat PRL gene (5). Compared with wild-type mice, weight of the prostate increased about 20-fold in transgenic animals. Apart from this marked increase, transgenic mice with prostate-specific rat PRL expression revealed higher amounts of interstitial tissue, more branch tips per major duct, and a thicker, more dilated appearance of the individual ducts (6).
Prostatic epithelial secretory function has been shown to be highly
dependent on PRL (4). Exogenous administration of PRL
results in stimulation of prostatic 5-
reductase activity and in
elevation of IGF-I and IGF-I receptor mRNA levels in rodents
(7). Furthermore, prostatic epithelial receptivity to
androgens and physiological zinc and citrate production is increased. A
direct influence of hPRL on mitochondrial aspartate amino-transferase
and PKC has been observed in human prostatic cancer cell lines
PC3 and LNCaP (8); Exogenous administration of hPRL
resulted in increased activities of both enzymes and in elevation of
citrate production.
Recently, it has been reported that hPRL receptors (9) and low concentrations of hPRL are expressed in human prostatic epithelial cells and that exogenously added hPRL increases DNA synthesis and influences epithelial morphology of prostate organ cultures (10). Furthermore, an androgen-dependent PRL expression was observed in rat prostate epithelium in vivo and in organ culture. Thus, it has been speculated that prostatic PRL represents a local factor mediating some of the actions of androgens (11).
Expression of the hPRL gene has been extensively studied in endometrial
stromal cells. Those cells express hPRL when they undergo
differentiation (i.e., decidualization) and enable the
implantation process of the developing blastocyst. Decidual hPRL
expression and secretion has been shown to be regulated by progesterone
(12, 13, 14), PGE2 (15), cAMP, PKA activity
(16, 17), and human glycoprotein hormone
(GPH
)
subunit (18, 19). CAAT/enhancer-binding proteins and the
respective consensus sequences in the promotor of PRL, responsible for
the PKA-dependent decidual PRL expression, have been identified
(17).
The aim of the study was to investigate and compare hPRL secretion in cultures of stromal smooth muscle cells (SMCs) and epithelial cells (ECs) after in vitro stimulation with factors present in seminal plasma (SMP). In analogy to decidualizing endometrial stromal cells, sex steroid hormones (dihydrotestosterone, progesterone, 17ß-estradiol), prostaglandins (PGs), and cAMP-elevating substances were studied in prostatic cells for induction of PRL expression and secretion in the supernatant. Moreover, SMP-derived proteins were separated by HPLC and tested for their effects on prostatic hPRL production.
Materials and Methods
HPLC of human SMP
Human seminal fluid was obtained from healthy donors (n = 12, age 2840 yr). After liquefaction (approximately 1 h), spermatozoa were removed by centrifugation (1,000 x g, 20 min, 4 C) and the supernatants stored at -20 C for up to 8 wk. Samples were diluted 1:2 with RPMI 1640 (Biowittaker, Verviers, Belgium) containing 10 mg/ml penicillin, 100 U/ml streptomycin, and 10 mg/ml L-glutamine and then pooled. Supernatants were filtered to remove residual sperm (Anotop R 10, 0.2 µm; Merck, Darmstadt, Germany), loaded on a Sephadex column (Superdex 200, Amersham Pharmacia Biotech, Uppsala, Sweden), and eluted with PBS (0.05 M phosphate pH 7.0, 0.15 M NaCl) at 0.4 ml/min. Fractions of 0.4 ml or 2 ml (corresponding to 1 or 5 min) were collected and monitored at 280 nm. A modified mol wt gel filtration calibration kit (Amersham Pharmacia Biotech) containing blue dextran 2000 (2,000,000 Da), mouse IgG (160,000 Da), BSA (67,000 Da), ovalbumin (43,000 Da), chymotrypsinogen A (25,000 Da), ribonuclease A (13,700 Da), and PGE1 (360 Da) was used to estimate SMP protein sizes.
Low-mol-wt SMP (<5 kDa) was obtained by centrifugation of native, unfractionated SMP through a Biomax-5 kDa NMWL membrane centrifugal filter device (Millipore Corp., Bedford, MA). The purity of separation was proven by HPLC analysis.
High-mol-wt SMP was obtained by dialyzing native SMP against the 1000-fold volume of PBS (30 mmol/liter, 4 C, 4 h) in the Microdialyzer System 500 (Pierce Chemical Co., Rockford, IL) with a framed dialysis membrane (mol wt cut-off 8000).
Tissue culture
Human epithelial prostate cells were obtained from patients suffering from hormonally untreated prostatic cancer (n = 16; 6883 yr). Written, informed consent was obtained from all patients before surgical intervention.
Following radical prostatectomy, a cube of approximately 0.125 cm3 was removed from an area containing no histological signs of tumor. After mechanical disruption, small (15 mm) organoids (3) were cultured on 2-in. Biocoat collagen type I coated discs (Becton Dickinson and Co., New York, NY). Organoids were cultivated in RPMI 1640 containing 10 mg/ml penicillin, 100 U/ml streptomycin, and 10 mg/ml L-glutamine and 10% bovine calf serum (BCS, A-2151-L, HyClone Laboratories, Inc., Logan, UT) for a least 7 d. Most organoids attached and were surrounded by outgrown cells of epithelial origin (EC, approximately 95%) (20). A lower percentage (less than 5%) of stromal cells has also been observed. To establish stromal SMC cultures, cells were incubated with 1 ml trypsine-EDTA solution (Roche Molecular Biochemicals, Mannheim, Germany) for 10 min. After inactivation of the trypsine-solution with medium containing 10% BCS, cells were centrifuged and resuspended in fresh medium, transferred into 6-well plates (Falcon, Becton Dickinson and Co.), and incubated for 4 h. Whereas most SMCs attached within this time period, ECs still floated and were removed by changing the medium. SMCs were cultured in RPMI 1640 containing 10% BCS until reaching confluence.
SMC and EC cultures were repeatedly stimulated with 2 ml medium containing 1% BCS and 0.5% SMP for a time period of 321 d by changing the medium every third day. Supernatants were collected and stored at -20 C. Dihydrotestosterone (DHT, 1 x 10-8 M, Fluka, Buchs, Switzerland), progesterone (1 x 10-8 M, Sigma Biochemicals, St. Louis, MO), 17ß-estradiol (1 x 10-8 M, Sigma Biochemicals), PGE-1 and PGE-2 (Sigma Biochemicals, 1 x 10-61 x 10-8 M), and forskolin (1 x 10-8 M, Fluka) were tested in medium containing 1% charcoal/dextran-treated FBS (A-1120, HyClone Laboratories, Inc.).
Immunohistochemistry and immunofluorescence
Human prostate ECs (organoids) and SMCs were cultured on
permanox chamber slides (Lab-tech, Nalco Nunc International, Naperville, IL). Then they were fixed in 4%
paraformaldehyde/PBS for 20 min and permeabilized for 10 min with 0.2%
Triton X-100 dissolved in PBS. Chamber slides were washed twice with
PBS (10 min); cells were then either incubated for 90 min with 1
µg/ml monoclonal antibody (MAB) directed against cytokeratin 8/18
(Autogen Bioclear, Wiltshire, UK), a marker for ECs of the
urogenital system, or 1.2 µg/ml MAB directed against
-SMC actin
(Sigma Biochemicals) dissolved in PBS containing 1%
BSA.
For immunohistochemistry, cells were stained with a 1:2000 dilution of biotinylated rabbit antimouse (DAKO Corp., Glostrup, Denmark) for 45 min, followed by a 30-min incubation with peroxidase-conjugated streptavidin complex (1:1000; DAKO Corp.). Subsequently, cells were stained for 10 min with Fast 3,3'-diaminobenzidine tetrahydrochloride (Sigma Biochemicals).
For immunofluorescence, cells were incubated for 60 min with 100 µl fluorescein-conjugated F(ab)2 rabbit antimouse IgG (DAKO Corp.) diluted 1:50 in 1% BSA/PBS. Subsequently, they were incubated for 1 h in PBS containing 1 µg/ml propidium iodide (Fluka), washed twice with PBS, resuspended in 30% glycerol/PBS, and mounted. Cells were analyzed with an Axiophot-equipped µ-radiance confocal scanning system (Carl Zeiss, Göttingen, Germany) by the use of the Laser Sharp software (Bio-Rad Laboratories, Inc., Hercules, CA).
Quantitative RT-PCR
After harvesting unstimulated and SMP-stimulated prostate cells,
RNA isolation and cDNA synthesis were done as described elsewhere
(3). Specific exon-spanning primers for the quantitative
detection of PRL cDNAs were designed to avoid amplification of residual
genomic DNA or nuclear pre-mRNA. Amplified cDNA segments were <300 bp
to ensure a good efficiency of the reaction. Primer sequences were as
follows: PRL sense 5' ggttcattaccaaggccatc, PRL antisense
5'ttcaggatgaacctggctgac, elongation factor-1
(Ef-1
) sense
5'cacacggctcattgcat, Ef-1
antisense 5'cacgaacagcaaagcgacc. Because
Ef-1
(translation factor) was an unregulated gene in most serial
analyses of gene expression library screensprostatic cancer and
normal tissueit was used as internal standard. Reactions (20 µl
each) were performed under conditions suggested by the Light
Cycler-FastStart DNA Master SYBR Green I kit (Roche Molecular Biochemicals). The final concentration of
MgCl2 was 1.5 mM and that of each
primer 10 pmol. The Light Cycler II was programmed for the initial step
of 8 min at 95 C, followed by 38 thermal cycles of 15 sec at 95 C,
8-sec annealing at 55 C, and 20-sec elongation at 72 C. Detection of
the fluorescent product was carried out at the end of the 72 C
extension period. To confirm amplification specificity, the PCR
products were subjected to a melting curve analysis (6095 C),
subsequent gel electrophoresis, and sequencing. Each measurement was
set up in duplicates, and two separate measurements were carried out.
The quantification data were analyzed by the Light Cycler software
version 3.3 (Roche Molecular Biochemicals) and converted
into threshold cycle (Ct, crossing point) values.
The results are expressed in terms of change in Ct values (
Ct),
which refer to the cycle number during exponential amplification at
which the PCR product (real-time SYBR green fluorescence) crosses a set
threshold. The correlation between the Ct and the fold difference in
template concentrations was measured by creating a dilution curve over
the entire detection scale. The correlation coefficient of detection
was 0.982 for PRL and 0.988 for Ef-1
. To adjust for variations in
the amount of input mRNA/cDNA, the average Ct values for PRL were
normalized against average Ct values for the housekeeping gene Ef-1
(i.e.,
Ct = average Ct PRL to
average Ct Ef-1
. Because Ef-1
is an
abundant message, lower
Ct values correspond to higher expression.
The fold difference in gene expression was calculated by assuming
a PCR efficiency of 2 and after normalizing each PRL Ct to the internal
standard Ef-1
: fold difference = 2
||
Ct1-Ct2||.
Immunofluorometric assay (IFMA) for hPRL
Specific IFMAs for pituitary-derived hPRL were established on the basis of a panel of well-characterized monoclonal antibodies (4, 21). The hPRL 81/541 (NIBSC, South Mimms, UK) was used as hormone standard preparation.
Briefly, 10 µg of highly purified MAB, coded as INN-hPRL-9
(21), were diluted in 100 µl PBS pH 7.2 and incubated
for 2 h at 37 C in a microtiter plate (Nunc,
Roskilde, Denmark). Remaining binding sites were blocked with 200 µl
of 1% BSA in PBS for 30 min at 37 C and then plates washed three times
with 200 µl/well with PBS containing 0.5 ml Tween 20 and 5 g
thiomersal/liter as a preservative. For the actual assay, we used an
incubation volume of 100 µl/well and an assay buffer consisting of 50
mM Tris-HCl (pH 7.75), 9 g/liter NaCl, 5 g BSA/liter,
0.1 g/liter Tween 40, 0.5 g/liter bovine
-globulin and 20
mM diethylenetriaminepentaacid (Sigma Biochemicals). Graded amounts of the hormone standards or
supernatants (1:2 in assay buffer) were allowed to react on an orbit
shaker (500 rpm, 90 min, 20 C) followed by three washes and
subsequently by incubation with 100 ng europium-labeled detection MAB
(INN-hPRL-1; 30 min, 20 C; orbit shaker). After extensive washing,
enhancement solution was added (0.1 mM potassium-phthalate,
pH 3.2, containing 15 mmol 2-naphtoyltrifluoroaceton, 50 mmol
tri-n-octylphosphine oxide, and 1 g Triton X-100/liter) and
incubated for 5 min on a orbit shaker. Time-resolved fluorescence was
measured for 1 sec in a fluorometer (1232 Delfia-fluorometer,
Wallac, Inc., Turku, Finland).
Immunoabsorption of SMP
For absorption of human GPH
from human SMP, a mixture of
three GPH
-specific MABs directed against distinct epitopes was used
(INN-hCG-72, INN-hFSH-132, and INN-hFSH-158) (22). Mock
absorption was performed with an MAB (INN-hCG-106) directed against the
ß-core fragment of human CG (hCG) ß (hCGßcf), which is not
present in human SMP (23). Goat antimouse
immunoglobulin-coated Sepharose 6B (0.5 ml; 5 µg polyclonal Ig/mg
Sepharose; 300 mg Sepharose/ml, Amersham Pharmacia Biotech) was incubated with 0.5 ml antibody mixture (200
µg/ml) overnight at 4 C (shaker, 100 rpm). Subsequently, Sepharose
beads were washed twice (10,000 x g, 10 min, 4 C) in 1
volume RPMI 1640 without serum. Then 0.5 ml SMP was diluted 1:2 with
RPMI-1640 and added to the Sepharose beads, which thereafter were
incubated under agitation for 2 h at reverse transcription. After
a centrifugation step (10,000 x g, 10 min, 4 C) the
supernatant (SMP) was collected and stored at -20 C. Absorption
processes were controlled by measurement of GPH
in a highly
sensitive IFMA (24).
Results
Differences in hPRL secretion between SMC and EC after stimulation with SMP
EC cultures were characterized by immunohistochemistry and
immunofluorescence (confocal image scanning) for the urogenital
epithelial cell marker cytokeratin 8/18. SMC expressed specifically
-SMC actin and were consistently negative for cytokeratin 8/18 (Fig. 1
).
|
|
The hPRL secretion of SMC was not influenced by sex steroid
hormones such as progesterone, dihydrotestosterone, or 17ß-estradiol
even in supraphysiological concentrations (each at
10-8 M). There was no synergistic
effect observed between sex steroids and SMP (Fig. 3
). SMP strongly elevated intracellular
cAMP production (data not shown) owing to the enormously high
concentrations of PGs. HPLC-purified PGs from human SMP, for the most
part containing 19-hydroxy-prostaglandins E1 and E2, and synthetic
prostaglandins (PGE-1 and PGE-2) tested in different concentrations
(10-610-8
M) had no effects on SMC hPRL secretion. Furthermore,
forskolin (10-8 M), a nonspecific
stimulator of the adenylyl cyclase and equally potent as SMP in
stimulating cAMP production, did not affect SMC hPRL secretion (Fig. 4
).
|
|
SMC cultivated in the presence of 0.5% SMP for 15 d had
significant (up to 500-fold) higher hPRL protein levels in their
supernatants than unstimulated cells. This increase in secreted hPRL
amount is preceded by an immediate induction of PRL gene transcription,
which occurs already 24 h after stimulation of SMC (Fig. 5
). PRL mRNA analysis by Light Cycler
(Roche Molecular Biochemicals) revealed that PRL gene
expression was induced 5.24-fold in comparison with unstimulated SMC
when standardized against the internal control gene
EF-1
. Moreover, SMC retained these PRL gene expression
levels within the observed period of SMP stimulation. In contrast, even
after stimulation with SMP, prostatic ECs contained almost undetectable
amounts of PRL mRNA, which were outside the quantitative measure range
of the PRL RT-PCR (data not shown).
|
Crude separation of human SMP into <5 kDa (membrane filtration)
and >8 kDa (microdialyzation) fractions revealed that the former alone
had no potent effect on SMC hPRL secretion (Fig. 6
). The >8 kDa fraction of SMP did not
induce hPRL secretion as efficiently as unfractionated SMP within
15 d of cultivation. Furthermore, denatured SMP (boiled for 10
min) lost most of its biological activity and was approximately equally
potent as the >8 kDa fraction with respect to the observed hPRL
secretion. Interestingly, coincubation of SMC with both SMP fractions
<5 kDa and >8 kDa restored the original hPRL secretion capacity of
the native SMP. SMP was separated by size-exclusion HPLC into 510,
1026, 2666, 66160, 160420, and 420-1050 kDa fractions, which
were then tested alone or in combination with <5 kDa SMP for their
regulatory effects on hPRL secretion (Fig. 7A
). Fractions 1026 and 2666 kDa
induced a significant but moderate increase of SMC hPRL secretion. A
further, more detailed separation of SMP (1068 kDa) revealed that
hPRL secretion was the result of at least two proteins with different
molecular sizes (approximately 2224 and 55 kDa, Fig. 7B
). Most
interestingly, reconstituted SMP (a mix consisting of all analyzed
fractions) was equally potent in hPRL secretion than unfractionated
SMP.
|
|
(22 kDa) does not affect hPRL secretion in
SMCs
SMP containing approximately 2.6 µg/ml GPH
and 4 ng/ml hPRL
(23) was absorbed by incubation with MABs directed against
hCG
and hCGßcf. Successful depletion was controlled by a specific
IFMA for GHP
. Thereafter, samples depleted of either GPH
or
hCGßcf were analyzed for their effects on SMC hPRL secretion in a
time course of 15 d. Compared with native SMP, the absorption
process was responsible for a slight loss of activity in both SMP
samples (Fig. 4
). Most noteworthy, SMC stimulated with
GPH
-depleted SMP did not differ from the control, still
containing GPH
(mock-depleted SMP). Thus, although high amounts of
GPH
were present in human SMP, the free subunit had no effect on
hPRL production in SMC.
Discussion
Despite extensive research on benign prostatic hyperplasia, the molecular mechanisms underlying the age-related enlargement of the prostate in humans are still obscure. In the last decades, however, there has been an enormous growth of new knowledge on molecular aspects of cellular growth control favoring the involvement of locally produced secreted and cell surface-bound proteins in aberrant prostatic growth (25). The adult prostatic epithelium maintains the capacity to respond to stromal mediators of growth and differentiation (26). Therefore, this third growth process, after embryonic and pubertal prostatic development, occurring later in life in men mainly independent of sex steroid hormones, has been postulated to be rather the result of a reawakening of the inductive potential of the prostatic stroma and of changes in epithelial-stromal interactions (25, 27).
In this study we describe a complex interaction between factors secreted by ECs and SMCs of the human prostate. SMCs obtained from patients suffering from prostatic cancer (n = 16) differentiated in vitro and secreted the lactotrophic hormone hPRL upon stimulation with human SMP, containing a large number of EC-derived factors and proteins. Although these factors are mainly designated for secretion as "exocrine products," some of them might play an important role in the regulation of EC renewal and differentiation and, moreover, might affect fibromuscular growth. For one of the most predominant SMP proteins (i.e., prostate-specific antigen), it has been demonstrated that it increases human prostatic fibromuscular cell growth by modulating interactions between IGF-I and IGF-BP3 (28).
Most interestingly, hPRL secretion induced by SMP was clearly observed
only in SMCs, not in ECs (Fig. 2
). Up to a 500-fold increase of hPRL
amounts in the supernatant could be detected after repeated stimulation
with 0.5% SMP. These observations do not support the data of
Nevalainen et al. (10), who located hPRL
predominantly in prostatic ECs by immunohistochemistry.
Interestingly, SMC-derived PRL mRNA and protein must have a low
half-life ex vivo because neither the protein nor the mRNA
could be detected in prostatic tissue several hours after removal by
transurethral resection of the prostate (29). A similar
mechanism of in vitro hPRL secretion can be found in human
peripheral blood mononuclear cells (PBMCs), which are known to produce
immunoreactive PRL (30). Although freshly isolated PBMCs
had significant concentrations of hPRL in the cytoplasm, in culture
they lost hPRL storage and secretion. Upon stimulation with
phytohemagglutinin, the PBMCs started to secret significant
concentrations of hPRL into the supernatant (Untergasser, G. and P.
Berger, unpublished observation).
In prostatic SMCs, hPRL mRNA levels increased immediately (24 h) after
exposure to SMP, indicating that hPRL expression is regulated
transcriptionally (Fig. 5
). This was not the case in ECs, in which,
under both conditions, mRNA levels remained below the detection limit.
Although expression of the housekeeping gene translation
EF-1
was equal in SMCs and ECs, PRL gene expression was
clearly higher in SMCs. Thus, this cell type could unequivocally be
identified as a major source of prostatic hPRL.
PRL secretion is a well-established marker of differentiation in
decidualization of human endometrial smooth muscle cells
(16). Compared with control cells, SMP stimulation
morphologically resulted in a more light-refractory appearance and
increased secretory activity in prostatic SMCs. It can be concluded
that apart from stimuli of the sympathetic nerval system, SMC function
and proliferation is highly dependent on permanent interaction with
prostatic ECs. Semiconfluent SMC cultures responded with increased
proliferation and DNA synthesis upon stimulation with low
concentrations of SMP (0.5%, data not shown). When they reached
confluence, SMCs started to produce hPRL on further stimulation with
0.5% SMP. Compared with progesterone-driven endometrial SMC hPRL
expression and secretion (13, 14), prostatic SMC
production was not dependent on sex steroid hormones such as
progesterone, DHT, or 17ß-estradiol (Fig. 3
). All these steroids were
not able to increase hPRL secretion either alone or synergistically
with SMP. Furthermore, prostaglandins, such as PGE-1 and PGE-2, and
cAMP-elevating substances known to regulate hPRL expression in
endometrial SMC cultures (13, 15, 16, 17) had no effects on
hPRL secretion of prostatic SMC (Fig. 4
). Even
19-hydroxy-prostaglandins purified by HPLC from SMP and strongly
activating intracellular adenylyl cyclases did not increase hPRL levels
in the supernatant. The same was true for forskolin, a
nonspecific, highly potent activator of adenylyl cyclases (Fig.
4).
Recently, it has been reported that the free
-subunit of hCG
synergizes with progesterone in endometrial SMCs to induce
decidualization and hPRL expression (18). Human SMP
containing vast amounts of GPH
(23) was depleted of
this cystine knot growth factor and then tested for its influence on
prostatic SMC hPRL release (Fig. 4
). There was no significant
difference between SMP with or without GPH
. Interestingly, SMP
> 8 kDa and not SMP < 5 kDa was mainly responsible for the
observed hPRL production in SMC (Fig. 6
); but SMP > 8 kDa
required the presence of SMP < 5 kDa for maintaining its maximal
activity. HPLC analysis of SMP proteins revealed that SMC
differentiation and hPRL secretion seemed not to be the result of a
single factor. The synergistical action of at least two proteins with
different molecular weights (55 and 2224 kDa) was required because
reconstituted SMP (a mix of the single fractions) had the same effect
as unfractionated SMP (Fig. 7B
). The single fractions were less potent
in induction of hPRL secretion. It can be assumed that a complex
interaction of SMP proteins and low molecular cofactors are required
for SMC differentiation processes and hPRL release. Furthermore, these
data demonstrate that hPRL secretion of prostatic SMC is regulated by
distinct factors and not by those described to be responsible for
decidualization of endometrial SMC.
SMC-derived prostatic hPRL might represent an important paracrine factor mediating stromal/epithelial interactions. PRL receptors have been shown to be expressed and functionally active in human prostate epithelium (9, 10). Thus, hPRL produced by SMCs could be a stimulator of EC growth and secretory function. It has been shown to influence proliferation, zinc uptake, citrate production, and secretory activities of the epithelium (4, 8, 10, 31, 32). Owing to an increase in the number of SMC in nodular benign prostatic hyperplasia (BPH) tissue, an elevation of local hPRL secretion might occur. This higher production of hPRL could lead to higher secretory activity of the adjacent glands. In turn, ECs might produce more factors stimulating SMC proliferation and inducing further hPRL release. This intensified feedback circuit between SMCs and ECs in areas of microscopic BPH might favor proliferation of the stromal bulk and the development of macroscopic BPH. Further in vivo investigations are required to elucidate the regulation of prostatic hPRL secretion and the role of SMC-derived hPRL in the pathogenesis of BPH.
Acknowledgments
We give special thanks to Dr. G. Pfister for the help in confocal image scanning and Mrs. R. Künz for her help in performing the immunofluorometric assays.
Footnotes
This work was supported by a grant from the Austrian Science Fund (P-13652-GEN) and the Hans and Blanca Moser Foundation.
Abbreviations: BCS, Bovine calf serum; BPH, benign prostatic
hyperplasia; Ct, threshold cycle;
Ct, change in Ct values; DHT,
dihydrotestosterone; EC, epithelial cell; Ef-1
, elongation factor-1
; GPH
, glycoprotein hormone
; hCG, human CG; hCGßcf,
ß-core fragment of human CGß; hPRL, human PRL; IFMA,
immunofluorometric assay; MAB, monoclonal antibody; PBMC, peripheral
blood mononuclear cell; PG, prostaglandin; SMC, smooth muscle cell;
SMP, seminal plasma.
Received November 29, 2000.
Accepted July 17, 2001.
References
-subunit from
human chorionic gonadotropin, which can synergize with progesterone to
induce decidualization. J Clin Endocrinol Metab 83:575581
-subunit in a healthy elderly population selected
according to the SENIEUR protocol. Analyses with ultrasensitive time
resolved fluoroimmunoassays. Mech Ageing Dev 71:223233[CrossRef][Medline]
This article has been cited by other articles:
![]() |
H. Rumpold, K. Mascher, G. Untergasser, E. Plas, M. Hermann, and P. Berger Trans-Differentiation of Prostatic Stromal Cells Leads to Decreased Glycoprotein Hormone {alpha} Production J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5297 - 5303. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |