help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Untergasser, G.
Right arrow Articles by Berger, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Untergasser, G.
Right arrow Articles by Berger, P.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 11 5577-5584
Copyright © 2001 by The Endocrine Society


Other Original Articles

Seminal Plasma Factors Induce in Vitro PRL Secretion in Smooth Muscle Cells of the Human Prostate

Gerold Untergasser, Holger Rumpold, Eugen Plas, Marc Witkowski and Peter Berger

Institute for Biomedical Aging Research (G.U., H.R., P.B.), Austrian Academy of Sciences, Innsbruck, Austria A6020; and Department of Urology and Ludwig Boltzmann Institute for Andrology and Urology (E.P., M.W.), Lainz Hospital Vienna, Austria A1130

Address all correspondence and requests for reprints to: Peter Berger, Ph.D., Institute for Biomedical Aging Research, Austrian Academy of Sciences, Rennweg 10, A-6020 Innsbruck, Austria. E-mail: peter.berger{at}oeaw.ac.at

Abstract

Next to the sex steroid hormone T, PRL has been shown to influence prostatic function and development. Transgenic mice overexpressing the rat PRL gene develop dramatic enlargements of the prostate gland. Proliferation and secretory activities of epithelial cells are stimulated by PRL in rodents and men. Low concentrations of human PRL (hPRL) and hPRL receptors have been observed in human prostatic epithelial cells (ECs). The aim of this study was to compare regulation of the in vitro hPRL secretion in prostatic ECs and stromal smooth muscle cells (SMCs) after stimulation with seminal plasma (SMP), containing a variety of prostatic factors. SMCs released up to 1 ng hPRL/ml (i.e., approximately 500-fold more than unstimulated SMCs and ECs). Quantification of PRL mRNA by highly sensitive quantitative RT-PCR revealed that hPRL gene expression increased 5-fold within 24 h of SMP incubation. Sex steroids (dihydrotestosterone, progesterone, 17ß-estradiol), prostaglandins (PGE-1, PGE-2), and cAMP-stimulating substances (forskolin) were not responsible for induction of hPRL. Compared with endometrial SMCs, regulation of prostatic hPRL secretion was independent of progesterone and cAMP. HPLC analysis of human SMP revealed that the common action of at least two different proteins and a low molecular cofactor is required. We concluded that prostatic ECs secrete proteins acting synergistically with low-molecular-weight cofactors to induce differentiation and hPRL release in SMCs. Age-related increases in SMC-derived hPRL might contribute to the development of benign hyperplasia of the prostate.

THE HUMAN PROTEIN hormone PRL (hPRL), a protein of 23 kDa, is predominantly expressed in lactotroph cells of the pituitary and in the decidua. It plays important roles in the regulation of reproductive functions in both genders. In addition to stimulation of milk protein gene transcription in the mammary gland (1) and in regulation of testicular steroidogenesis (2, 3), hPRL is meant to be an essential factor for prostatic development and function (4).

The importance of PRL for development and function of the rodent prostate has been demonstrated in a transgenic mouse model, bearing the rat PRL gene (5). Compared with wild-type mice, weight of the prostate increased about 20-fold in transgenic animals. Apart from this marked increase, transgenic mice with prostate-specific rat PRL expression revealed higher amounts of interstitial tissue, more branch tips per major duct, and a thicker, more dilated appearance of the individual ducts (6).

Prostatic epithelial secretory function has been shown to be highly dependent on PRL (4). Exogenous administration of PRL results in stimulation of prostatic 5-{alpha} reductase activity and in elevation of IGF-I and IGF-I receptor mRNA levels in rodents (7). Furthermore, prostatic epithelial receptivity to androgens and physiological zinc and citrate production is increased. A direct influence of hPRL on mitochondrial aspartate amino-transferase and PKC has been observed in human prostatic cancer cell lines PC3 and LNCaP (8); Exogenous administration of hPRL resulted in increased activities of both enzymes and in elevation of citrate production.

Recently, it has been reported that hPRL receptors (9) and low concentrations of hPRL are expressed in human prostatic epithelial cells and that exogenously added hPRL increases DNA synthesis and influences epithelial morphology of prostate organ cultures (10). Furthermore, an androgen-dependent PRL expression was observed in rat prostate epithelium in vivo and in organ culture. Thus, it has been speculated that prostatic PRL represents a local factor mediating some of the actions of androgens (11).

Expression of the hPRL gene has been extensively studied in endometrial stromal cells. Those cells express hPRL when they undergo differentiation (i.e., decidualization) and enable the implantation process of the developing blastocyst. Decidual hPRL expression and secretion has been shown to be regulated by progesterone (12, 13, 14), PGE2 (15), cAMP, PKA activity (16, 17), and human glycoprotein hormone {alpha} (GPH{alpha}) subunit (18, 19). CAAT/enhancer-binding proteins and the respective consensus sequences in the promotor of PRL, responsible for the PKA-dependent decidual PRL expression, have been identified (17).

The aim of the study was to investigate and compare hPRL secretion in cultures of stromal smooth muscle cells (SMCs) and epithelial cells (ECs) after in vitro stimulation with factors present in seminal plasma (SMP). In analogy to decidualizing endometrial stromal cells, sex steroid hormones (dihydrotestosterone, progesterone, 17ß-estradiol), prostaglandins (PGs), and cAMP-elevating substances were studied in prostatic cells for induction of PRL expression and secretion in the supernatant. Moreover, SMP-derived proteins were separated by HPLC and tested for their effects on prostatic hPRL production.

Materials and Methods

HPLC of human SMP

Human seminal fluid was obtained from healthy donors (n = 12, age 28–40 yr). After liquefaction (approximately 1 h), spermatozoa were removed by centrifugation (1,000 x g, 20 min, 4 C) and the supernatants stored at -20 C for up to 8 wk. Samples were diluted 1:2 with RPMI 1640 (Biowittaker, Verviers, Belgium) containing 10 mg/ml penicillin, 100 U/ml streptomycin, and 10 mg/ml L-glutamine and then pooled. Supernatants were filtered to remove residual sperm (Anotop R 10, 0.2 µm; Merck, Darmstadt, Germany), loaded on a Sephadex column (Superdex 200, Amersham Pharmacia Biotech, Uppsala, Sweden), and eluted with PBS (0.05 M phosphate pH 7.0, 0.15 M NaCl) at 0.4 ml/min. Fractions of 0.4 ml or 2 ml (corresponding to 1 or 5 min) were collected and monitored at 280 nm. A modified mol wt gel filtration calibration kit (Amersham Pharmacia Biotech) containing blue dextran 2000 (2,000,000 Da), mouse IgG (160,000 Da), BSA (67,000 Da), ovalbumin (43,000 Da), chymotrypsinogen A (25,000 Da), ribonuclease A (13,700 Da), and PGE1 (360 Da) was used to estimate SMP protein sizes.

Low-mol-wt SMP (<5 kDa) was obtained by centrifugation of native, unfractionated SMP through a Biomax-5 kDa NMWL membrane centrifugal filter device (Millipore Corp., Bedford, MA). The purity of separation was proven by HPLC analysis.

High-mol-wt SMP was obtained by dialyzing native SMP against the 1000-fold volume of PBS (30 mmol/liter, 4 C, 4 h) in the Microdialyzer System 500 (Pierce Chemical Co., Rockford, IL) with a framed dialysis membrane (mol wt cut-off 8000).

Tissue culture

Human epithelial prostate cells were obtained from patients suffering from hormonally untreated prostatic cancer (n = 16; 68–83 yr). Written, informed consent was obtained from all patients before surgical intervention.

Following radical prostatectomy, a cube of approximately 0.125 cm3 was removed from an area containing no histological signs of tumor. After mechanical disruption, small (1–5 mm) organoids (3) were cultured on 2-in. Biocoat collagen type I coated discs (Becton Dickinson and Co., New York, NY). Organoids were cultivated in RPMI 1640 containing 10 mg/ml penicillin, 100 U/ml streptomycin, and 10 mg/ml L-glutamine and 10% bovine calf serum (BCS, A-2151-L, HyClone Laboratories, Inc., Logan, UT) for a least 7 d. Most organoids attached and were surrounded by outgrown cells of epithelial origin (EC, approximately 95%) (20). A lower percentage (less than 5%) of stromal cells has also been observed. To establish stromal SMC cultures, cells were incubated with 1 ml trypsine-EDTA solution (Roche Molecular Biochemicals, Mannheim, Germany) for 10 min. After inactivation of the trypsine-solution with medium containing 10% BCS, cells were centrifuged and resuspended in fresh medium, transferred into 6-well plates (Falcon, Becton Dickinson and Co.), and incubated for 4 h. Whereas most SMCs attached within this time period, ECs still floated and were removed by changing the medium. SMCs were cultured in RPMI 1640 containing 10% BCS until reaching confluence.

SMC and EC cultures were repeatedly stimulated with 2 ml medium containing 1% BCS and 0.5% SMP for a time period of 3–21 d by changing the medium every third day. Supernatants were collected and stored at -20 C. Dihydrotestosterone (DHT, 1 x 10-8 M, Fluka, Buchs, Switzerland), progesterone (1 x 10-8 M, Sigma Biochemicals, St. Louis, MO), 17ß-estradiol (1 x 10-8 M, Sigma Biochemicals), PGE-1 and PGE-2 (Sigma Biochemicals, 1 x 10-6–1 x 10-8 M), and forskolin (1 x 10-8 M, Fluka) were tested in medium containing 1% charcoal/dextran-treated FBS (A-1120, HyClone Laboratories, Inc.).

Immunohistochemistry and immunofluorescence

Human prostate ECs (organoids) and SMCs were cultured on permanox chamber slides (Lab-tech, Nalco Nunc International, Naperville, IL). Then they were fixed in 4% paraformaldehyde/PBS for 20 min and permeabilized for 10 min with 0.2% Triton X-100 dissolved in PBS. Chamber slides were washed twice with PBS (10 min); cells were then either incubated for 90 min with 1 µg/ml monoclonal antibody (MAB) directed against cytokeratin 8/18 (Autogen Bioclear, Wiltshire, UK), a marker for ECs of the urogenital system, or 1.2 µg/ml MAB directed against {alpha}-SMC actin (Sigma Biochemicals) dissolved in PBS containing 1% BSA.

For immunohistochemistry, cells were stained with a 1:2000 dilution of biotinylated rabbit antimouse (DAKO Corp., Glostrup, Denmark) for 45 min, followed by a 30-min incubation with peroxidase-conjugated streptavidin complex (1:1000; DAKO Corp.). Subsequently, cells were stained for 10 min with Fast 3,3'-diaminobenzidine tetrahydrochloride (Sigma Biochemicals).

For immunofluorescence, cells were incubated for 60 min with 100 µl fluorescein-conjugated F(ab)2 rabbit antimouse IgG (DAKO Corp.) diluted 1:50 in 1% BSA/PBS. Subsequently, they were incubated for 1 h in PBS containing 1 µg/ml propidium iodide (Fluka), washed twice with PBS, resuspended in 30% glycerol/PBS, and mounted. Cells were analyzed with an Axiophot-equipped µ-radiance confocal scanning system (Carl Zeiss, Göttingen, Germany) by the use of the Laser Sharp software (Bio-Rad Laboratories, Inc., Hercules, CA).

Quantitative RT-PCR

After harvesting unstimulated and SMP-stimulated prostate cells, RNA isolation and cDNA synthesis were done as described elsewhere (3). Specific exon-spanning primers for the quantitative detection of PRL cDNAs were designed to avoid amplification of residual genomic DNA or nuclear pre-mRNA. Amplified cDNA segments were <300 bp to ensure a good efficiency of the reaction. Primer sequences were as follows: PRL sense 5' ggttcattaccaaggccatc, PRL antisense 5'ttcaggatgaacctggctgac, elongation factor-1 {alpha} (Ef-1{alpha}) sense 5'cacacggctcattgcat, Ef-1{alpha} antisense 5'cacgaacagcaaagcgacc. Because Ef-1{alpha} (translation factor) was an unregulated gene in most serial analyses of gene expression library screens—prostatic cancer and normal tissue—it was used as internal standard. Reactions (20 µl each) were performed under conditions suggested by the Light Cycler-FastStart DNA Master SYBR Green I kit (Roche Molecular Biochemicals). The final concentration of MgCl2 was 1.5 mM and that of each primer 10 pmol. The Light Cycler II was programmed for the initial step of 8 min at 95 C, followed by 38 thermal cycles of 15 sec at 95 C, 8-sec annealing at 55 C, and 20-sec elongation at 72 C. Detection of the fluorescent product was carried out at the end of the 72 C extension period. To confirm amplification specificity, the PCR products were subjected to a melting curve analysis (60–95 C), subsequent gel electrophoresis, and sequencing. Each measurement was set up in duplicates, and two separate measurements were carried out. The quantification data were analyzed by the Light Cycler software version 3.3 (Roche Molecular Biochemicals) and converted into threshold cycle (Ct, crossing point) values.

The results are expressed in terms of change in Ct values ({Delta}Ct), which refer to the cycle number during exponential amplification at which the PCR product (real-time SYBR green fluorescence) crosses a set threshold. The correlation between the Ct and the fold difference in template concentrations was measured by creating a dilution curve over the entire detection scale. The correlation coefficient of detection was 0.982 for PRL and 0.988 for Ef-1{alpha}. To adjust for variations in the amount of input mRNA/cDNA, the average Ct values for PRL were normalized against average Ct values for the housekeeping gene Ef-1{alpha} (i.e., {Delta}Ct = average Ct PRL to average Ct Ef-1{alpha}. Because Ef-1{alpha} is an abundant message, lower {Delta}Ct values correspond to higher expression. The fold difference in gene expression was calculated by assuming a PCR efficiency of 2 and after normalizing each PRL Ct to the internal standard Ef-1{alpha}: fold difference = 2 ||{Delta}Ct1-Ct2||.

Immunofluorometric assay (IFMA) for hPRL

Specific IFMAs for pituitary-derived hPRL were established on the basis of a panel of well-characterized monoclonal antibodies (4, 21). The hPRL 81/541 (NIBSC, South Mimms, UK) was used as hormone standard preparation.

Briefly, 10 µg of highly purified MAB, coded as INN-hPRL-9 (21), were diluted in 100 µl PBS pH 7.2 and incubated for 2 h at 37 C in a microtiter plate (Nunc, Roskilde, Denmark). Remaining binding sites were blocked with 200 µl of 1% BSA in PBS for 30 min at 37 C and then plates washed three times with 200 µl/well with PBS containing 0.5 ml Tween 20 and 5 g thiomersal/liter as a preservative. For the actual assay, we used an incubation volume of 100 µl/well and an assay buffer consisting of 50 mM Tris-HCl (pH 7.75), 9 g/liter NaCl, 5 g BSA/liter, 0.1 g/liter Tween 40, 0.5 g/liter bovine {gamma}-globulin and 20 mM diethylenetriaminepentaacid (Sigma Biochemicals). Graded amounts of the hormone standards or supernatants (1:2 in assay buffer) were allowed to react on an orbit shaker (500 rpm, 90 min, 20 C) followed by three washes and subsequently by incubation with 100 ng europium-labeled detection MAB (INN-hPRL-1; 30 min, 20 C; orbit shaker). After extensive washing, enhancement solution was added (0.1 mM potassium-phthalate, pH 3.2, containing 15 mmol 2-naphtoyltrifluoroaceton, 50 mmol tri-n-octylphosphine oxide, and 1 g Triton X-100/liter) and incubated for 5 min on a orbit shaker. Time-resolved fluorescence was measured for 1 sec in a fluorometer (1232 Delfia-fluorometer, Wallac, Inc., Turku, Finland).

Immunoabsorption of SMP

For absorption of human GPH{alpha} from human SMP, a mixture of three GPH{alpha}-specific MABs directed against distinct epitopes was used (INN-hCG-72, INN-hFSH-132, and INN-hFSH-158) (22). Mock absorption was performed with an MAB (INN-hCG-106) directed against the ß-core fragment of human CG (hCG) ß (hCGßcf), which is not present in human SMP (23). Goat antimouse immunoglobulin-coated Sepharose 6B (0.5 ml; 5 µg polyclonal Ig/mg Sepharose; 300 mg Sepharose/ml, Amersham Pharmacia Biotech) was incubated with 0.5 ml antibody mixture (200 µg/ml) overnight at 4 C (shaker, 100 rpm). Subsequently, Sepharose beads were washed twice (10,000 x g, 10 min, 4 C) in 1 volume RPMI 1640 without serum. Then 0.5 ml SMP was diluted 1:2 with RPMI-1640 and added to the Sepharose beads, which thereafter were incubated under agitation for 2 h at reverse transcription. After a centrifugation step (10,000 x g, 10 min, 4 C) the supernatant (SMP) was collected and stored at -20 C. Absorption processes were controlled by measurement of GPH{alpha} in a highly sensitive IFMA (24).

Results

Differences in hPRL secretion between SMC and EC after stimulation with SMP

EC cultures were characterized by immunohistochemistry and immunofluorescence (confocal image scanning) for the urogenital epithelial cell marker cytokeratin 8/18. SMC expressed specifically {alpha}-SMC actin and were consistently negative for cytokeratin 8/18 (Fig. 1Go).



View larger version (81K):
[in this window]
[in a new window]
 
Figure 1. Immunohistochemical characterization of in vitro cultivated human prostate ECs and SMCs. A, ECs and SMCs were stained in immunohistochemistry with cytokeratin 8/18 and {alpha}-smooth muscle cell actin. Primary cultures of ECs contained predominantly cytokeratin 8/18-positive cells, an established marker for ECs deriving from the urogenital system. Some SMCs (less than 5%) were also observed in the outgrown ECs. In contrast to the EC cultures, the SMC cultures contained only {alpha}-SMC actin-expressing cells; no cytokeratin 8/18-positive cell could be observed. B, Cytokeratin and {alpha}-SMC expression in ECs and SMCs was proven by immunofluorescence and subsequent confocal image scanning. Cytokeratin 8/18 was present predominantly closely under the cell membrane (left image) and {alpha}-SMC actin staining could be localized in cytoskeletal filaments along the entire cell body (right image). Nuclei with DNA were counterstained with propidium iodide.

 
Stimulation of prostatic SMC and EC cultures (Fig. 2Go, A and B) with 0.5% SMP revealed that only the former released significant amounts of hPRL into the culture medium. Steadily increasing hPRL concentrations up to 1 ng/ml could be detected by a highly sensitive IFMA in supernatants of SMC after repeated SMP stimulation (period of 21 d, 3-d stimulation intervals, Fig. 2BGo). Maximum levels of hPRL could be detected between days 15 and 18. Conversely, EC cultures did not secrete measurable hPRL on SMP stimulation (<20 pg/ml, Fig. 2AGo). The measured 20 pg hPRL/ml in the supernatant were identical to those present in 0.5% SMP. Even after immunoabsorption of SMP PRL by MAB (INN-hPRL-9), the levels of secretion were <5 pg/ml PRL and thus under the detection limit of the sensitive IFMA (data not shown). Unstimulated control cells from EC as well as from SMC cultures produced less than 5 pg hPRL/ml. Interestingly, there was no acute effect of SMP on hPRL secretion after 12, 24, and 48 h, either in SMC or EC (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Analysis of hPRL secretion in ECs and SMCs in response to stimulation with seminal plasma. PRL secretion was analyzed in EC and SMC cultures isolated from two patients (black and gray) in a follow-up study of 21 d. SMCs and ECs were cultivated in triplicate and stimulated with medium alone (triangles) or with medium containing 0.5% human seminal plasma (squares). Medium was changed every third day and hPRL concentrations determined with a highly sensitive IFMA (bars indicate mean of triplicates ± SD). Sixteen independent experiments were performed. Interestingly, ECs did not increase hPRL production upon SMP stimulation (A). The somewhat higher hPRL concentrations originated from the SMP present in the culture medium. In contrast, SMCs of both patients under stimulation with SMP produced hPRL (B). Concentrations steadily increased up to 500-fold upon repeated stimulation with SMP along the observed time period. Note the large difference in scale between A and B.

 
hPRL production of SMC is not dependent on sex steroid hormones, PGs, and cAMP-stimulating substances

The hPRL secretion of SMC was not influenced by sex steroid hormones such as progesterone, dihydrotestosterone, or 17ß-estradiol even in supraphysiological concentrations (each at 10-8 M). There was no synergistic effect observed between sex steroids and SMP (Fig. 3Go). SMP strongly elevated intracellular cAMP production (data not shown) owing to the enormously high concentrations of PGs. HPLC-purified PGs from human SMP, for the most part containing 19-hydroxy-prostaglandins E1 and E2, and synthetic prostaglandins (PGE-1 and PGE-2) tested in different concentrations (10-6–10-8 M) had no effects on SMC hPRL secretion. Furthermore, forskolin (10-8 M), a nonspecific stimulator of the adenylyl cyclase and equally potent as SMP in stimulating cAMP production, did not affect SMC hPRL secretion (Fig. 4Go).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Sex steroid hormones do not affect hPRL secretion in prostatic SMC. SMCs were cultivated with sex steroids in the presence or absence of 0.5% human SMP. Compared with untreated control cells, sex steroids such as DHT (10-8 M), 17ß-estradiol (10-8 M), and progesterone (Prog; 10-8 M) did not induce PRL secretion in SMCs within 15 d of incubation (symbols indicate mean of duplicate wells). Furthermore, coincubation of sex steroid hormones with SMP revealed no significant changes of hPRL concentrations in the culture medium.

 


View larger version (11K):
[in this window]
[in a new window]
 
Figure 4. A, Effects of synthetic and SMP-derived PGs on hPRL secretion of SMC. Prostatic SMCs were cultivated in the presence of 1% charcoal-treated FCS and increasing concentrations of PGE-1, 10-6–10-8 M), PGE-2 (10-6–10-8 M), HPLC-purified PGs from human SMP (PG, approximately 10-6–10-8 M), and forskolin (10-8 M), a nonspecific stimulator of adenylyl cyclase. Although all tested substances tremendously increased cellular cAMP, no induction of SMC hPRL production could be observed even after repeated stimulation along the observed time period (15 d) (mean of duplicate wells). B, hPRL production in SMC occurred independently of SMP-derived GPH{alpha}. SMCs were repeatedly stimulated with SMP or SMP-depleted of either GPH{alpha} or hCGßcf for 15 d (stimulation intervals of 3 d). Compared with native SMP, the absorption process resulted in a less effective hPRL secretion. There were no significant differences, concerning the SMC hPRL release, between GPH{alpha}-containing and -depleted SMP samples (mean of duplicate wells).

 
PRL gene expression is induced in SMC after SMP stimulation

SMC cultivated in the presence of 0.5% SMP for 15 d had significant (up to 500-fold) higher hPRL protein levels in their supernatants than unstimulated cells. This increase in secreted hPRL amount is preceded by an immediate induction of PRL gene transcription, which occurs already 24 h after stimulation of SMC (Fig. 5Go). PRL mRNA analysis by Light Cycler (Roche Molecular Biochemicals) revealed that PRL gene expression was induced 5.24-fold in comparison with unstimulated SMC when standardized against the internal control gene EF-1{alpha}. Moreover, SMC retained these PRL gene expression levels within the observed period of SMP stimulation. In contrast, even after stimulation with SMP, prostatic ECs contained almost undetectable amounts of PRL mRNA, which were outside the quantitative measure range of the PRL RT-PCR (data not shown).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. PRL gene expression is induced in SMC after stimulation with SMP. SMCs were stimulated with 0.5% SMP for 24 h, and then PRL mRNA was analyzed by Light Cycler (Roche Molecular Biochemicals) PCR. In prostatic SMCs, however, a 5.24-fold induction (22.39) of PRL gene expression was observed 24 h after stimulation when standardized against the housekeeping gene EF-1{alpha} (EF). Cells retained this PRL gene induction when repeatedly stimulated with SMP (data not shown). A plasmid containing the cDNA of hPRL or EF-1{alpha} served as positive control. PCR reagents spiked with human genomic DNA served as negative control. PC, Positive control; NC, negative control; SM, size marker (100-bp ladder, GIBCO, Life Technologies, Inc.).

 
Two proteins of human SMP induce hPRL secretion: interaction with low-molecular-weight SMP factor required

Crude separation of human SMP into <5 kDa (membrane filtration) and >8 kDa (microdialyzation) fractions revealed that the former alone had no potent effect on SMC hPRL secretion (Fig. 6Go). The >8 kDa fraction of SMP did not induce hPRL secretion as efficiently as unfractionated SMP within 15 d of cultivation. Furthermore, denatured SMP (boiled for 10 min) lost most of its biological activity and was approximately equally potent as the >8 kDa fraction with respect to the observed hPRL secretion. Interestingly, coincubation of SMC with both SMP fractions <5 kDa and >8 kDa restored the original hPRL secretion capacity of the native SMP. SMP was separated by size-exclusion HPLC into 5–10, 10–26, 26–66, 66–160, 160–420, and 420-1050 kDa fractions, which were then tested alone or in combination with <5 kDa SMP for their regulatory effects on hPRL secretion (Fig. 7AGo). Fractions 10–26 and 26–66 kDa induced a significant but moderate increase of SMC hPRL secretion. A further, more detailed separation of SMP (10–68 kDa) revealed that hPRL secretion was the result of at least two proteins with different molecular sizes (approximately 22–24 and 55 kDa, Fig. 7BGo). Most interestingly, reconstituted SMP (a mix consisting of all analyzed fractions) was equally potent in hPRL secretion than unfractionated SMP.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 6. SMP-derived proteins are responsible for hPRL secretion in SMC: interaction with low-molecular-weight cofactors required for their maximal activity. Membrane-filtered (<5 K), -microdialyzed (>8 K), and -boiled (SMP denatured) seminal fluid was analyzed for induction of hPRL secretion in direct comparison with native SMP. SMP < 5 kDa had no predominant effect on hPRL production. Denaturation led to partial loss of activity. SMP > 8 kDa was less potent in its action than native SMP and reconstituted SMP consisting of both fractions, those <5 kDa and >8 kDa. Cells stimulated with 1% serum were used as negative control (mean of duplicate wells).

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 7. HPLC analysis of SMP proteins revealed that at least two proteins are responsible for increases in hPRL concentrations. A, Human SMP separated by size-exclusion HPLC was tested for its effect on hPRL release in SMC. Each fraction was analyzed in a time course for 15 d synergistically with SMP < 5 kDa. Compared with unfractionated SMP and SMP < 5 kDa (day 15: 632 and 23 pg hPRL/ml, respectively) fractions 10–26 and 26–66 kDa induced a slight but significant increase of hPRL (day 15: 76 and 59 pg hPRL/ml, respectively) (mean of duplicate wells). B, Detailed HPLC separation of SMP proteins: The proteins of fractions 10–26 and 26–66 kDa were further separated and the minute fractions (35–44 min) tested for their effects on hPRL secretion. Compared with the control (co.), containing SMP < 5 kDa, most fractions between 35 and 41 min induced a significant increase of hPRL. Interestingly, reconstituted SMP consisting of all tested fractions (mix) was more potent than the single fractions in its ability to stimulate SMCs to release hPRL. The synergistic action of at least two proteins with a molecular weight of approximately 55 and 22–24 kDa seemed to be required for efficient hPRL secretion (mean of triplicate wells).

 
SMP-derived GPH{alpha} (22 kDa) does not affect hPRL secretion in SMCs

SMP containing approximately 2.6 µg/ml GPH{alpha} and 4 ng/ml hPRL (23) was absorbed by incubation with MABs directed against hCG{alpha} and hCGßcf. Successful depletion was controlled by a specific IFMA for GHP{alpha}. Thereafter, samples depleted of either GPH{alpha} or hCGßcf were analyzed for their effects on SMC hPRL secretion in a time course of 15 d. Compared with native SMP, the absorption process was responsible for a slight loss of activity in both SMP samples (Fig. 4Go). Most noteworthy, SMC stimulated with GPH{alpha}-depleted SMP did not differ from the control, still containing GPH{alpha} (mock-depleted SMP). Thus, although high amounts of GPH{alpha} were present in human SMP, the free subunit had no effect on hPRL production in SMC.

Discussion

Despite extensive research on benign prostatic hyperplasia, the molecular mechanisms underlying the age-related enlargement of the prostate in humans are still obscure. In the last decades, however, there has been an enormous growth of new knowledge on molecular aspects of cellular growth control favoring the involvement of locally produced secreted and cell surface-bound proteins in aberrant prostatic growth (25). The adult prostatic epithelium maintains the capacity to respond to stromal mediators of growth and differentiation (26). Therefore, this third growth process, after embryonic and pubertal prostatic development, occurring later in life in men mainly independent of sex steroid hormones, has been postulated to be rather the result of a reawakening of the inductive potential of the prostatic stroma and of changes in epithelial-stromal interactions (25, 27).

In this study we describe a complex interaction between factors secreted by ECs and SMCs of the human prostate. SMCs obtained from patients suffering from prostatic cancer (n = 16) differentiated in vitro and secreted the lactotrophic hormone hPRL upon stimulation with human SMP, containing a large number of EC-derived factors and proteins. Although these factors are mainly designated for secretion as "exocrine products," some of them might play an important role in the regulation of EC renewal and differentiation and, moreover, might affect fibromuscular growth. For one of the most predominant SMP proteins (i.e., prostate-specific antigen), it has been demonstrated that it increases human prostatic fibromuscular cell growth by modulating interactions between IGF-I and IGF-BP3 (28).

Most interestingly, hPRL secretion induced by SMP was clearly observed only in SMCs, not in ECs (Fig. 2Go). Up to a 500-fold increase of hPRL amounts in the supernatant could be detected after repeated stimulation with 0.5% SMP. These observations do not support the data of Nevalainen et al. (10), who located hPRL predominantly in prostatic ECs by immunohistochemistry. Interestingly, SMC-derived PRL mRNA and protein must have a low half-life ex vivo because neither the protein nor the mRNA could be detected in prostatic tissue several hours after removal by transurethral resection of the prostate (29). A similar mechanism of in vitro hPRL secretion can be found in human peripheral blood mononuclear cells (PBMCs), which are known to produce immunoreactive PRL (30). Although freshly isolated PBMCs had significant concentrations of hPRL in the cytoplasm, in culture they lost hPRL storage and secretion. Upon stimulation with phytohemagglutinin, the PBMCs started to secret significant concentrations of hPRL into the supernatant (Untergasser, G. and P. Berger, unpublished observation).

In prostatic SMCs, hPRL mRNA levels increased immediately (24 h) after exposure to SMP, indicating that hPRL expression is regulated transcriptionally (Fig. 5Go). This was not the case in ECs, in which, under both conditions, mRNA levels remained below the detection limit. Although expression of the housekeeping gene translation EF-1{alpha} was equal in SMCs and ECs, PRL gene expression was clearly higher in SMCs. Thus, this cell type could unequivocally be identified as a major source of prostatic hPRL.

PRL secretion is a well-established marker of differentiation in decidualization of human endometrial smooth muscle cells (16). Compared with control cells, SMP stimulation morphologically resulted in a more light-refractory appearance and increased secretory activity in prostatic SMCs. It can be concluded that apart from stimuli of the sympathetic nerval system, SMC function and proliferation is highly dependent on permanent interaction with prostatic ECs. Semiconfluent SMC cultures responded with increased proliferation and DNA synthesis upon stimulation with low concentrations of SMP (0.5%, data not shown). When they reached confluence, SMCs started to produce hPRL on further stimulation with 0.5% SMP. Compared with progesterone-driven endometrial SMC hPRL expression and secretion (13, 14), prostatic SMC production was not dependent on sex steroid hormones such as progesterone, DHT, or 17ß-estradiol (Fig. 3Go). All these steroids were not able to increase hPRL secretion either alone or synergistically with SMP. Furthermore, prostaglandins, such as PGE-1 and PGE-2, and cAMP-elevating substances known to regulate hPRL expression in endometrial SMC cultures (13, 15, 16, 17) had no effects on hPRL secretion of prostatic SMC (Fig. 4Go). Even 19-hydroxy-prostaglandins purified by HPLC from SMP and strongly activating intracellular adenylyl cyclases did not increase hPRL levels in the supernatant. The same was true for forskolin, a nonspecific, highly potent activator of adenylyl cyclases (Fig. 4).

Recently, it has been reported that the free {alpha}-subunit of hCG synergizes with progesterone in endometrial SMCs to induce decidualization and hPRL expression (18). Human SMP containing vast amounts of GPH{alpha} (23) was depleted of this cystine knot growth factor and then tested for its influence on prostatic SMC hPRL release (Fig. 4Go). There was no significant difference between SMP with or without GPH{alpha}. Interestingly, SMP > 8 kDa and not SMP < 5 kDa was mainly responsible for the observed hPRL production in SMC (Fig. 6Go); but SMP > 8 kDa required the presence of SMP < 5 kDa for maintaining its maximal activity. HPLC analysis of SMP proteins revealed that SMC differentiation and hPRL secretion seemed not to be the result of a single factor. The synergistical action of at least two proteins with different molecular weights (55 and 22–24 kDa) was required because reconstituted SMP (a mix of the single fractions) had the same effect as unfractionated SMP (Fig. 7BGo). The single fractions were less potent in induction of hPRL secretion. It can be assumed that a complex interaction of SMP proteins and low molecular cofactors are required for SMC differentiation processes and hPRL release. Furthermore, these data demonstrate that hPRL secretion of prostatic SMC is regulated by distinct factors and not by those described to be responsible for decidualization of endometrial SMC.

SMC-derived prostatic hPRL might represent an important paracrine factor mediating stromal/epithelial interactions. PRL receptors have been shown to be expressed and functionally active in human prostate epithelium (9, 10). Thus, hPRL produced by SMCs could be a stimulator of EC growth and secretory function. It has been shown to influence proliferation, zinc uptake, citrate production, and secretory activities of the epithelium (4, 8, 10, 31, 32). Owing to an increase in the number of SMC in nodular benign prostatic hyperplasia (BPH) tissue, an elevation of local hPRL secretion might occur. This higher production of hPRL could lead to higher secretory activity of the adjacent glands. In turn, ECs might produce more factors stimulating SMC proliferation and inducing further hPRL release. This intensified feedback circuit between SMCs and ECs in areas of microscopic BPH might favor proliferation of the stromal bulk and the development of macroscopic BPH. Further in vivo investigations are required to elucidate the regulation of prostatic hPRL secretion and the role of SMC-derived hPRL in the pathogenesis of BPH.

Acknowledgments

We give special thanks to Dr. G. Pfister for the help in confocal image scanning and Mrs. R. Künz for her help in performing the immunofluorometric assays.

Footnotes

This work was supported by a grant from the Austrian Science Fund (P-13652-GEN) and the Hans and Blanca Moser Foundation.

Abbreviations: BCS, Bovine calf serum; BPH, benign prostatic hyperplasia; Ct, threshold cycle; {Delta}Ct, change in Ct values; DHT, dihydrotestosterone; EC, epithelial cell; Ef-1{alpha}, elongation factor-1 {alpha}; GPH{alpha}, glycoprotein hormone {alpha}; hCG, human CG; hCGßcf, ß-core fragment of human CGß; hPRL, human PRL; IFMA, immunofluorometric assay; MAB, monoclonal antibody; PBMC, peripheral blood mononuclear cell; PG, prostaglandin; SMC, smooth muscle cell; SMP, seminal plasma.

Received November 29, 2000.

Accepted July 17, 2001.

References

  1. Freeman ME, Kanyicska B, Lerant A, Nagy G 2000 Prolactin: structure, function and regulation of secretion. Physiol Rev 80:1523–1631[Abstract/Free Full Text]
  2. Zipf WB, Payne AH, Kelch RP 1978 Prolactin, growth hormone, and luteinizing hormone in the maintenance of testicular luteinizing hormone receptor. Endocrinology 103:595–600[Abstract/Free Full Text]
  3. Untergasser G, Kranewitter W, Dirnhofer S, Madersbacher S, Berger P 1997 Organ-specific expression pattern of the growth hormone/placental lactogen gene-cluster in the testis. Mol Cell Endocrinol 130:53–60[CrossRef][Medline]
  4. Reiter E, Hennuy B, Bruyninx M, Cornet A, Klug M, McNamura M, Closset J, Hennen G 1999 Effects of pituitary hormones on the prostate. Prostate 38:159–165[CrossRef][Medline]
  5. Wennbo H, Kindblom J, Isaksson O, Törnell J 1997 Transgenic mice overexpressing the prolactin gene develop dramatic enlargement of the prostate gland. Endocrinology 138:4410–4415[Abstract/Free Full Text]
  6. Kindblom J, Wennbo H, Isaksson OG, Törnell J 1997 Generation of transgenic mice with prostate specific prolactin expression. Proc 79th Annual Meeting of The Endocrine Society, Minneapolis, MN, 1997 (Abstract P3–535)
  7. Reiter E, Bonnet P, Sente B, Dombrovicz D, Leval J, Closset J, Hennen G 1992 Growth hormone and prolactin stimulate androgen receptor, insulin-like growth factor-I (IGF-I) and IGF-I receptor levels in the prostate of immature rats. Mol Cell Endocrinol 88:77–87[CrossRef][Medline]
  8. Franklin RB, Zou J, Gorski E, Yang YH, Costello LC 1997 Prolactin regulation of mitochondrial aspartate aminotransferase and protein kinase C in human prostate cancer cells. Mol Cell Endocrinol 127:19–25[CrossRef][Medline]
  9. Leav I, Merk FB, Lee KF, Loda M, Mandoki M, McNeal JE, Ho SM 1999 Prolactin receptor expression in the developing human prostate and in hyperplastic, dysplastic, and neoplastic lesions. Am J Pathol 154:863–870[Abstract/Free Full Text]
  10. Nevalainen M, Valve E, Ingleton P, Nurmi M, Martikainen P, Härkönen P 1997 Prolactin and prolactin receptors are expressed and functioning in the human prostate. J Clin Invest 99:618–627[Medline]
  11. Nevalainen M, Valve EM, Ahonen T, Yagi A, Paranko J, Harkonen P 1997 Androgen-dependent expression of prolactin in rat prostate epithelium in vivo and in organ culture. FASEB J 11:1297–1307[Abstract]
  12. Healy DL 1991 Endometrial prolactin and implantation. Baillieres Clin Obstet Gynaecol 5:95–105[CrossRef][Medline]
  13. Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S 1997 Progesterone-dependent decidualization of the human endometrium is mediated by cAMP. Endocrine 6:301–307[Medline]
  14. Brosens JJ, Hayashi N, White JO 1999 Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology 140:4809–4820[Abstract/Free Full Text]
  15. Frank GR, Brar AK, Cedars MI, Handwerger S 1994 Prostaglandin E2 enhances human endometrial stromal cell differentiation. Endocrinology 134:258–263[Abstract/Free Full Text]
  16. Telgmann R, Maronde E, Tasken K, Gellersen B 1997 Activated protein kinase A is required for differentiation-dependent transcription of the decidual prolactin gene in human endometrial stromal cells. Endocrinology 138:929–937[Abstract/Free Full Text]
  17. Pohnke Y, Kempf R, Gellersen B 1999 CCATT/enhance-binding proteins are mediators in the protein kinase A-dependent activation of the decidual PRL promotor. J Biol Chem 274:24808–24818[Abstract/Free Full Text]
  18. Nemansky M, Moy E, Lyons CD, Yu I, Blithe DL 1998 Human endometrial stromal cells generate uncombined {alpha}-subunit from human chorionic gonadotropin, which can synergize with progesterone to induce decidualization. J Clin Endocrinol Metab 83:575–581[Abstract/Free Full Text]
  19. Han SW, Lei ZM, Rao CV 1999 Treatment of human endometrial stromal cells with chorionic gonadotropin promotes their morphological and functional differentiation into decidua. Mol Cell Endocrinol 147:7–16[CrossRef][Medline]
  20. Pretlow TG, Yang B, Pretlow TP 1995 Organ culture of benign, aging, and hyperplastic human prostate. Microsc Res Tech 30:271–281[CrossRef][Medline]
  21. Berger P, Staindl B, Wick G 1988 Antigenic features of the human protein hormones elucidated by monoclonal antibodies. In: Paul IP, McCurden AB, Schuetz PW, eds. The influence of new technology in the medical practice. London: Macmillian Press Ltd.
  22. Berger P, Klieber R, Panmoung W, Madersbacher S, Wolf H, Wick G 1990 Monoclonal antibodies against the free subunits of human chorionic gonadotropin. J Endocrinol 125:301–309[Abstract/Free Full Text]
  23. Berger P, Gerth R, Madersbacher S, Gruschwitz M 1999 Glycoprotein hormones in human seminal plasma. Exp Clin Endocrinol Diabetes 107 (Suppl):61
  24. Madersbacher S, Stulnig T, Huber LA, Schonitzer D, Dirnhofer S, Wick G, Berger P 1993 Serum glycoprotein hormones and their free {alpha}-subunit in a healthy elderly population selected according to the SENIEUR protocol. Analyses with ultrasensitive time resolved fluoroimmunoassays. Mech Ageing Dev 71:223–233[CrossRef][Medline]
  25. Freemann MR, Gleave ME, Chung LW 1996 Stromal-epithelial interactions: molecular aspects and relevance to benign prostatic hyperplasia. In: Kirby RS, McConnell JD, Fitzpatrick JM, Roehrborn CG, Boyle P, eds. Textbook of benign prostatic hyperplasia. Oxford: ISIS Medical Media
  26. Chung LW, Cunha GR 1983 Stromal-epithelial interactions II. Regulation of prostatic growth by embryonic urogenital sinus mesenchyme. Prostate 4:503–511[Medline]
  27. McNeal JE 1978 Origin and evolution of benign prostatic enlargement. Invest Urol 150:340–345
  28. Sutkowski DM, Goode RL, Baniel J, Teater C, Cohen P, McNulty AM, Hsiung HM, Becker GW, Neubauer BL 1999 Growth regulation of prostatic stromal cells by prostate-specific antigen. J Natl Cancer Inst 91:1663–1669[Abstract/Free Full Text]
  29. Untergasser G, Rumpold H, Hermann H, Dirnhofer S, Jilg G, Berger P 1999 Proliferative disorders of the aging human prostate: involvement of protein hormones and their receptors. Exp Gerontol 34:275–287[CrossRef][Medline]
  30. Sabharwal P, Glaser R, Lafuse W, Varma S, Liu Q, Arkins S, Kooijman R, Kutz L, Kelley KW, Malarkey WB 1992 Prolactin synthesized and secreted by human peripheral blood mononuclear cells: an autocrine growth factor for lymphoproliferation. Proc Natl Acad Sci 89:7713–7716[Abstract/Free Full Text]
  31. Costello LC, Liu Y, Zou J, Franklin RB 1999 Evidence for a zinc uptake transporter in human prostate cancer cells which is regulated by prolactin and testosterone. J Biol Chem 274:17499–17504[Abstract/Free Full Text]
  32. Ahonen TJ, Harkonen PL, Laine J, Rui H, Martikainen PM, Nevalainen MT 1999 Prolactin is a survival factor for androgen-deprived rat dorsal and lateral prostate epithelium in organ culture. Endocrinology 140:5412–5421[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
H. Rumpold, K. Mascher, G. Untergasser, E. Plas, M. Hermann, and P. Berger
Trans-Differentiation of Prostatic Stromal Cells Leads to Decreased Glycoprotein Hormone {alpha} Production
J. Clin. Endocrinol. Metab., November 1, 2002; 87(11): 5297 - 5303.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Untergasser, G.
Right arrow Articles by Berger, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Untergasser, G.
Right arrow Articles by Berger, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals