| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Departments of Medicine (K.S., K.N., A.Y., T.Y., Y.K., K.T.) and Surgery (T.O., K.Y., M.K.), Institute of Clinical Endocrinology, and Department of Surgical Pathology (T.N.), Tokyo Womens Medical University, Tokyo 162-8666, Japan
Address all correspondence and requests for reprints to: Dr. Kanji Sato, Institute of Clinical Endocrinology, Tokyo Womens Medical University, Kawada-cho 8-1, Shinjuku-ku, Tokyo, Japan 162-8666. E-mail: satokan{at}attglobal.net
Abstract
Somatic mutations of the MEN type 1 (MEN1) gene were recently shown
to be responsible for tumorigenesis in 1326% of sporadic,
nonfamilial primary hyperparathyroidism. However, it is unknown whether
these mutations are also involved in tumorigenesis of parathyroid
glands occurring during high phosphate therapy for hypophosphatemic
rickets or osteomalacia. A male patient with adult-onset,
hypophosphatemic osteomalacia had been treated with
1
-OHD3 and oral phosphate for 13 yr when tertiary
hyperparathyroidism developed. After total resection of four enlarged
parathyroid glands and autotransplantation of a hyperplastic gland, the
patient has continued to do well for the last 2 yr. Sequence analysis
of the coding exons of MEN1 gene revealed a 36-bp deletion
with a 2-bp insertion (exon 2) in the right upper parathyroid gland
accompanied with loss of heterozygosity at 11q13 locus and a
heterozygous mutation of 2-bp deletion (AG) in exon 10 in the right
lower gland, in which microsatellite instability was also found. No
MEN1 gene mutation was detected in the other two
hyperplastic parathyroid glands or in the peripheral blood. These
findings indicate that MEN1 gene mutations contributed to
tumorigenesis of the right upper parathyroid gland in this case of
phosphate-induced tertiary hyperparathyroidism. Very recently a bone
tumor was found in the right femoral neck, and the tumor
(chondroblastoma) was resected.
GERMLINE MUTATIONS OF the MEN type 1 (MEN1) gene was recently reported to be responsible for the tumorigenesis of MEN1 (1). Moreover, somatic mutations of the MEN1 gene were reported to be responsible for tumorigenesis in 1326% of sporadic, nonfamilial, primary hyperparathyroidism (PHP) (2, 3, 4, 5, 6, 7). In a previous study, we found that the sites of point mutation in the MEN1 gene in parathyroid glands were often exactly the same in PHP and MEN1 (6). Furthermore, LOH in chromosome 11q13 was reported in 2.5% (1 of 39 tumors) to 17% (2 of 12 tumors) of uremic patients on long-term hemodialysis (8, 9, 10). Arnold et al. (11) demonstrated monoclonality in parathyroid tumors in chronic renal failure and in PHP, and very recently somatic MEN1 gene mutations in uremia-associated hyperplastic parathyroid glands were identified in a few uremic patients, namely, 2 of 48 (4.2%) and only 1 of 81 (1.2%) in the United States and Japan, respectively (12, 13).
There is an increasing number of case reports of patients with familial or nonfamilial hypophosphatemic rickets or osteomalacia who developed parathyroid hyperplasia or adenoma after being treated with oral phosphate supplements for a prolonged period, even though their renal function remained intact (14, 15, 16, 17, 18, 19, 20, 21). Although monoclonality in hyperplastic parathyroid glands were reported in X-lined hypophosphatemic rickets with normal renal function (22), the molecular pathogenesis of these phosphate-induced parathyroid hyperplasia and adenoma causing hypercalcemia, namely tertiary hyperparathyroidism, remains largely unknown.
We have been treating a patient with adult-onset hypophosphatemic
osteomalacia of undetermined origin, with 1
-OHD3
and oral phosphate for 13 yr, when tertiary hyperparathyroidism
developed. The patient was treated by total resection of four enlarged
parathyroid glands and autotransplantation of a hyperplastic
parathyroid gland and has been doing well for the last 2 yr. Sequence
analysis of the coding exons of the MEN1 gene revealed
somatic MEN1 gene mutations in two of the four hyperplastic
parathyroid glands, accompanied by LOH at locus 11q13 in one gland,
suggesting that the repeated increase in serum phosphate concentrations
for a prolonged period may be related to tumorigenesis of the
parathyroid glands.
Case Report
A 38-yr-old patient with severe bone pains in the back and loins, 1.5 yr in duration, was admitted to the Tokyo Womens Medical University Hospital in August 1985. Because of generalized bone pain, the patient had difficulty in walking, and lancinating pains developed in the thorax during coughing. Physical findings were unremarkable except for the severe bone pains. His height (165 cm) remained unchanged, and his growth and development had been normal. No family history of bone metabolic diseases was found.
Laboratory study results were as follows (normal ranges in parentheses): Total protein 74 g/liter (6582), albumin 41 g/liter (3851), alkaline phosphatase 27.4 King-Armstrong units (2.710), serum calcium 2.25 mM (2.12.5), serum phosphorus 0.38 mM (0.811.39), blood urea nitrogen 2.4 mM (1.12.85), creatinine 88 µM (62115), and uric acid 218 µM (231375). A complete blood cell count was normal. There was no proteinuria, glucosuria, or aminoaciduria. Despite marked hypophosphatemia, the urinary excretion of phosphate was not decreased (5001000 mg/d), and the renal threshold phosphate concentration (TmPO4/GFR) was reduced to 0.35 mM/liter (1.1 mg/dl). Serum level of 25-OHD (25.7 nM) was marginally decreased (26143). Serum level of 1,25-(OH)2D (53.6 pM) was in the normal range (52156), but it was interpreted to be inappropriately normal relative to the marked hypophosphatemia (14). The serum levels of PTH, determined by house-made RIA using antibody specific for the C terminal fragment, were in the normal range (less than 0.6 µg/liter) (23). Iliac bone biopsy following two courses of tetracycline administration revealed marked osteoidosis and diffuse tetracycline fluorescence indicative of osteomalacia (14).
Oncogenic osteomalacia was suspected, but systemic examinations (bone
x-ray survey, 99mTc bone scintigraphy, and urological
and otolaryngological examinations) and cranial, chest, and abdominal
computed tomography scanning could not detect any responsible tumor. A
tentative diagnosis of idiopathic, acquired, hypophosphatemic
osteomalacia was made, and 1
-OHD3 (9 µg/d) and
oral phosphate (Joulies solution, 23 g phosphorus/d, t.i.d.) was
prescribed. After a few months, the bone pains gradually subsided and
the patient was doing well. After 12 months, serum calcium levels
increased more than 2.5 mM; therefore, the dose of
1
-OHD3 was gradually tapered to 3 µg/d (Table 1
).
|
-OHD3
to 1 µg/d, the serum level of calcium rose progressively to more than
2.5 mM in 1995. Serum levels of intact PTH increased to
more than 22 pM in July 1998 (normal range 2.58.0
pM). Echographic examination revealed four enlarged
parathyroid glands. Oral supplementation of phosphate and vitamin D was
therefore discontinued in December 1997. The four enlarged parathyroid
glands did not decrease in size, and serum intact PTH levels remained
elevated. Serum levels of phosphorus remained low (0.290.48
mM). Serum levels of alkaline phosphatase, mostly of bone
origin, gradually increased to more than 800 IU/liter (normal range
70260 IU/liter) in July 1998 and the bone pains exacerbated again. On
November 4, 1998, total parathyroidectomy was performed, and the left
lower parathyroid gland was dissected into small pieces and about 100
mg of the dissected tissue were autotransplanted intramuscularly into
the left forearm. For the following 2 yr, the patient was doing well
without any bone pain and with normal serum levels of calcium and
intact PTH, at an oral dose of 3 µg/d 1
-OHD3 and
1 g/d phosphate, q.i.d. (Table 1
At the end of 2000, magnetic resonance imaging skeletal survey
(24) revealed a well-defined low-density area (3 x
4 x 3 cm) in the greater trochanter of the right femur. On
January 13, 2001, the tumor was totally resected. Pathological
examination revealed benign chondroblastoma. After the operation,
1
-OHD3 and Joulies solution were discontinued.
However, hypophosphatemia and hyperphosphaturia persisted, accompanied
with decreased serum levels of 1,25-(OH)2D. Because serum
levels of alkaline phosphatase of bone origin gradually increased,
1
-OHD3 and Joulies solution were again
prescribed. At the present time, the patient is doing well without any
bone pain.
Pathology of the four enlarged parathyroid glands
Histopathology of the left upper and lower parathyroid glands,
weighing 181 and 427 mg, respectively, revealed chief cell hyperplasia
with various degrees of multinodular hyperplasia of another cell
component and with a decrease of stromal fat cells (Table 2
). The right upper and lower
glands, weighing 519 and 769 mg, respectively, showed a large
circumscribed nodule with uniformity of cell appearance, consisting of
chief cell hyperplasia with mainly solid arrangement of parenchymal
cells and virtually no fat cells (Fig. 1
). Oxyphilic cells were focally
present in the right hyperplastic parathyroid glands.
|
|
The four parathyroid glands were snap frozen and stored in liquid nitrogen until analysis. After thawing, about 30 mg of parathyroid gland were cut out from each enlarged parathyroid gland. Because the right upper and lower parathyroid glands contained a large hyperplastic lesion with a monotonous color, relatively homogenous tissues could be obtained. A peripheral blood sample was collected from the patient after surgery. Informed consent for gene analyses was obtained from the patient.
LOH and microsatellite instability (MSI)
Allelic loss of the MEN1 gene was assessed by microsatellite analysis based on PCR amplification of polymorphic short tandem repeat sequences flanking the MEN1 gene locus. Fluorescent (6FAM) oligonucleotide primers were used to amplify polymorphic markers PYGM, D11S4946, D11S4940, and D11S449 (25). Primers for D11S4946 and D11S4940 were prepared as described (25). For analysis of D11S449, the forward (5'-GGTGAAAAAACACACTTGTCTG) and the reverse (5'-ACAGGATCTCACTATGTCGCC) primers were prepared.
Furthermore, to confirm MSI, five microsatellite loci were analyzed, as recommended at the 1997 National Cancer Institute-sponsored conference on MSI, namely, BAT-25, BAT-26, D2S123, D5S346, and D17S250 (26). Primers were synthesized as described by Berg et al. (27). After PCR amplification, each PCR product was analyzed by laser-induced fluorescence on the ABI Prism 377 DNA sequencing system (PE Applied Biosystems, Chiba, Japan).
Markers were considered informative if two alleles were detected in normal tissue (peripheral blood lymphocytes). LOH was scored as a significant decrease (>75%) in fluorescence intensity (area under the curve) of one allele. MSIreplication error by DNA mismatch repair genes (10, 26, 28)was detected as variations in the number of tandemly repeated nucleotides of polymorphic markers, compared with the peripheral blood.
Gene analysis of MEN1
Genomic DNA was extracted from parathyroid glands and blood samples using QIAamp tissue and blood kits, respectively (QIAGEN, Hilden, Germany). All the protein-coding regions of exons 210 of the MEN1 gene were amplified by the PCR using a 20-µl reaction mixture containing100 ng genomic DNA, 1 of 15 pairs of primers, and Taq DNA polymerase (Takara Taq, Takara, Tokyo, Japan) in an automated thermal cycler (PC-700, Asutekku, Fukuoka-Ken, Japan). The primers used were as described previously (6). PCR products formed by these primer were 379 (exon 3) to 638 bp (exon 2). Thirty cycles of PCR amplifications were performed in a thermal cycler with denaturation at 94 C for 1 min, annealing at 5563 C for 1 min, and extension at 72 C for 1 min. The PCR products were purified with a QIAquick PCR purification kit (QIAGEN). These products were then sequenced (200 nmol DNA template/reaction) using an ABI 377 automated DNA sequencer (Perkin-Elmer Corp., PE Applied Biosystems, Foster City, CA) and the BigDye terminator cycle sequencing kit (Perkin-Elmer Corp.). Both strands of each exon were sequenced and their sequences were compared.
To demonstrate a 36-bp deletion with a 2-bp insertion in exon 2 by PCR, the forward primer (5'-GGCGGCCTCACCTACTTTC, nt 25042522) and the reverse primer (5'-TGAAGAGGGACTGGATGTGGG, nt 27002720) were prepared to amplify a short PCR product (217 bp) in the wild allele.
Results
LOH and MSI analysis of 11q13 locus
When D11S449 (CCTT repeat) was used as a polymorphic
microsatellite marker, LOH was observed in the right upper parathyroid
gland but not in the other three glands or the peripheral blood (Fig. 2D
). This was also the case using
D11S4946 (TA and TG repeat) (Fig. 2B
). When PYGM (CA and GA repeat) was
used as a polymorphic marker, several shadow bands were observed,
compared with D11S4940 (TATC repeat) (29); however,
both polymorphic markers were noninformative (Fig. 2
, A and C).
|
To confirm MSI, a panel of five markers (i.e., D2S123 [CA
repeat]), BAT-26 [mononucleotide (A) repeat], BAT-25
[mononucleotide (T) repeat], D5S346 [CA repeat], and D17S250 [TA
and CA repeat]) were analyzed as shown in Fig. 3
. When D2S123 was used, slightly longer
bands differing 2 or 4 nt were also demonstrated in the right lower
parathyroid gland (Fig. 3A
). Bat 26, Bat-25 and D17S250 were
noninformative. Although no MSI was demonstrated in the former two
microsatellite markers, D17S250 gave two bands, one in the same
position accompanied with a longer PCR product differing 14 nt.
Furthermore, D5S346, which was informative in the peripheral blood as
well as the three parathyroid glands, gave a single band in the right
lower parathyroid gland (Fig. 3D
). It is difficult to discern whether
this represents LOH or MSI in which the shifted allele has comigrated
with the remaining wild-type allele (26). However, because
at least two of five reference panels of microsatellite markers
revealed MSI, the right lower parathyroid gland was interpreted to have
developed high frequency MSI (26).
|
Complete analysis of the MEN1 gene of the four
parathyroid glands revealed a 36-bp deletion (451486,
GCCGTGAGCTGGTGAAGAAGGTCTCCGATGTCATAT) and 2-bp insertion (TC) in
exon 2 (Fig. 4
, upper panel),
in addition to an absent normal allele in the right upper parathyroid
gland. These mutations are frame-shift deletion mutations that result
in altered amino acid sequences and creation of stop codon (TAG) after
28 triplets.
|
To confirm a 36-bp deletion with a 2-bp insertion in exon 2, the
primers were prepared to produce a small PCR product of 217 bp. As
shown in Fig. 5
, a normal PCR
product was obtained in DNA derived from the left upper, left lower,
and right lower parathyroid glands and the peripheral blood, whereas
DNA derived from the right upper parathyroid gland gave a shorter PCR
product (lane 3).
|
By performing direct sequencing of the MEN1 gene, two mutations were identified in two of the four hyperplastic parathyroid glands that developed in a patient with adult-onset hypophosphatemic osteomalacia after 13-yr supplementation with phosphate and vitamin D. One mutation consisted of a 36-bp deletion and a 2-bp insertion with LOH, and the other of a 2-bp deletion without LOH. Because the MEN1 gene is regarded as a tumor suppressor gene, the frame-shift mutation (36-bp deletion plus 2-bp insertion) in the right upper parathyroid gland, accompanied with LOH (without a wild MEN1 gene) is likely to be contributed to the tumorigenesis in this parathyroid gland in accordance with Knudsons two-hit theory (30).
In this context, the 2-bp deletion in the right lower parathyroid gland, which represents the first hit, would not be capable of causing tumorigenesis because LOH was not detected and the other allele contained a wild-type MEN1 gene. It should be pointed out, however, that MSI was observed in this hyperplastic lesion. MSI, which is associated with mutations in certain DNA repair genes, was originally identified in hereditary nonpolyposis colorectal carcinoma (31) but recently found in sporadic parathyroid adenoma as well as secondary proliferative lesions of the parathyroid glands (10, 28). The reference panel used in the present paper was recommended for the characterization of MSI in colorectal cancer only, and it is well established that colorectal tumors with high-frequency MSI are associated with a less aggressive clinical course than are those with low-frequency MSI (26). Whether parathyroid tumors with high-frequency MSI also grow less aggressively remains to be elucidated in the future because only a few parathyroid tumors with MSI have been reported so far.
The present gene analysis data together with histopathological findings suggest that a large circumscribed nodule in the right upper and lower parathyroid glands is of monoclonal origin. No mutation was observed in the other parathyroid glands or in the peripheral blood, indicating that the MEN1 gene mutations were somatic. Therefore, it is evident that MEN1 gene mutations were involved in the tumorigenesis of the right upper parathyroid gland, whereas the other tumor suppressor genes (i.e., p53) and several oncogenes (i.e., PRAD1/cyclin D) may be involved in the hyperplastic lesions in the other three parathyroid glands (32). Furthermore, putative tumor suppressor genes located in 1p, 1q, 6p, 9p, 11p, 11q, and 15p as well as unidentified parathyroid oncogenes located in 16p and 19p may also have been involved (33, 34, 35).
Recently evidence has been presented to show that increased serum levels of phosphate not only promote PTH secretion but also stimulate parathyroid cell proliferation, leading to parathyroid hyperplasia (36, 37, 38). This effect is independent of serum-ionized calcium and vitamin D. It is highly likely, therefore, that a repeated increase in serum phosphate concentrations stimulated parathyroid cell proliferation, and the increased number of cell divisions increased the probability of a mutation of any kind. In the present case, however, MEN1 gene mutations and deletion occurred in three of eight alleles in the four hyperplastic parathyroid glands. Therefore, it is of interest to speculate that the MEN1 gene is very susceptible to mutation, when parathyroid cells are exposed to a rapid increase in serum phosphate concentration for a prolonged period. The mechanism by which a rapid and repeated increase in serum phosphate concentration causes mutations of oncogenes and tumor suppressor genes including MEN1 gene remains to be elucidated, but it would be certainly different from MEN1 gene mutations in patients who received irradiation to the cervical region (35).
The parathyroid growth response to chronic renal failure progresses through several stages (39). Initially, diffuse secondary hyperplasia of polyclonal origin develops during a prolonged period of hemodialysis. The hyperplasia gradually becomes nodular. The next stage is monoclonal proliferation of parathyroid cells, or adenoma in one or occasionally more than one, of the nodules. We presume that this is also the case in phosphate-induced hyperparathyroidism in patients with hypophosphatemic osteomalacia (14, 15, 16, 17, 18, 19, 20). By analyzing the MEN1 gene in the parathyroid glands, we have clearly demonstrated that the right upper parathyroid hyperplasia was monoclonal and that tertiary hyperparathyroidism definitely occurred in the present patient.
Very recently a well-circumscribed tumor was found in the greater trochanter of the right femur by magnetic resonance imaging survey. Although the tumor (chondroblastoma) was totally resected, serum levels of phosphate did not rapidly increase (40), but hypophosphatemia and hyperphosphaturia persisted even 1 month after the operation, accompanied with suppressed serum levels of 1,25-(OH)2D. We are reevaluating whether the tumor was completely resected or an additional tumor may be present. Because the tumor resection did not cure the state of hypophosphatemic osteomalacia, we cannot make a diagnosis of oncogenic osteomalacia at the present time. Definite diagnosis will be made when a not-yet-identified phosphaturic factor, phosphatonin, is identified (41). During the revision of this manuscript, however, a candidate of phosphatonin was found to be identical to FGF23 (42, 43, 44), whose gene is point mutated, presumably leading to gain of function, in patients with autosomal dominant rickets and/or osteomalacia (45). Currently, we are culturing the tumor cells, and planning to determine whether FGF-23 mRNA is abundantly expressed in the primary culture cells as demonstrated in the tumors obtained from patients with oncogenic osteomalacia (42, 43). Furthermore, we are eagerly waiting for assay kits that can detect serum levels of FGF-23 so that we can localize the tumor-secreting humoral factors that stimulates excessively phosphaturia, leading to severe hypophosphatemia.
To minimize a chance of additional gene mutations in the transplanted parathyroid tissue, the patient is now taking lower doses of oral phosphate (1 g/d) q.i.d. so that a rapid and sharp increase in serum phosphate concentration would be ameliorated. Recent serum levels of intact PTH is 711 pM, which cannot account for the hypophosphatemia and decreased serum levels of 1,25-(OH)2D. If serum levels of intact PTH steadily increases, partial resection of the transplanted hyperplastic parathyroid tissue is planned in the near future.
In summary, two somatic mutations of the MEN1 gene were identified in hyperplastic lesions of the four parathyroid glands obtained from a patient with adult-onset hypophosphatemic (probably oncogenic) osteomalacia, which developed after prolonged supplementation of phosphate and vitamin D. The present case suggests that a rapid and repeated increase in serum levels of phosphate, when continued for more than 10 yr, may be related to tumorigenesis in parathyroid glands leading to tertiary hyperparathyroidism, irrespective of renal function.
Footnotes
This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan (13671164) and a research grant from the Chugai Pharmaceutical Co. (Tokyo, Japan).
Abbreviations: MEN1, MEN type 1; MSI, microsatellite instability; PHP, primary hyperparathyroidism.
Received May 3, 2001.
Accepted July 5, 2001.
References
This article has been cited by other articles:
![]() |
S. M. Mallya, J. J. Gallagher, and A. Arnold Analysis of Microsatellite Instability in Sporadic Parathyroid Adenomas J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1248 - 1251. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |