help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sato, K.
Right arrow Articles by Takano, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sato, K.
Right arrow Articles by Takano, K.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 11 5564-5571
Copyright © 2001 by The Endocrine Society


Other Original Articles

Somatic Mutations of the MEN1 Gene and Microsatellite Instability in a Case of Tertiary Hyperparathyroidism Occurring during High Phosphate Therapy for Acquired, Hypophosphatemic Osteomalacia

Kanji Sato, Takao Obara, Kazuko Yamazaki, Masako Kanbe, Kishiko Nakajima, Akemi Yamada, Tetsuo Yanagisawa, Yoshiyuki Kato, Toshio Nishikawa and Kazue Takano

Departments of Medicine (K.S., K.N., A.Y., T.Y., Y.K., K.T.) and Surgery (T.O., K.Y., M.K.), Institute of Clinical Endocrinology, and Department of Surgical Pathology (T.N.), Tokyo Women’s Medical University, Tokyo 162-8666, Japan

Address all correspondence and requests for reprints to: Dr. Kanji Sato, Institute of Clinical Endocrinology, Tokyo Women’s Medical University, Kawada-cho 8-1, Shinjuku-ku, Tokyo, Japan 162-8666. E-mail: satokan{at}attglobal.net

Abstract

Somatic mutations of the MEN type 1 (MEN1) gene were recently shown to be responsible for tumorigenesis in 13–26% of sporadic, nonfamilial primary hyperparathyroidism. However, it is unknown whether these mutations are also involved in tumorigenesis of parathyroid glands occurring during high phosphate therapy for hypophosphatemic rickets or osteomalacia. A male patient with adult-onset, hypophosphatemic osteomalacia had been treated with 1{alpha}-OHD3 and oral phosphate for 13 yr when tertiary hyperparathyroidism developed. After total resection of four enlarged parathyroid glands and autotransplantation of a hyperplastic gland, the patient has continued to do well for the last 2 yr. Sequence analysis of the coding exons of MEN1 gene revealed a 36-bp deletion with a 2-bp insertion (exon 2) in the right upper parathyroid gland accompanied with loss of heterozygosity at 11q13 locus and a heterozygous mutation of 2-bp deletion (AG) in exon 10 in the right lower gland, in which microsatellite instability was also found. No MEN1 gene mutation was detected in the other two hyperplastic parathyroid glands or in the peripheral blood. These findings indicate that MEN1 gene mutations contributed to tumorigenesis of the right upper parathyroid gland in this case of phosphate-induced tertiary hyperparathyroidism. Very recently a bone tumor was found in the right femoral neck, and the tumor (chondroblastoma) was resected.

GERMLINE MUTATIONS OF the MEN type 1 (MEN1) gene was recently reported to be responsible for the tumorigenesis of MEN1 (1). Moreover, somatic mutations of the MEN1 gene were reported to be responsible for tumorigenesis in 13–26% of sporadic, nonfamilial, primary hyperparathyroidism (PHP) (2, 3, 4, 5, 6, 7). In a previous study, we found that the sites of point mutation in the MEN1 gene in parathyroid glands were often exactly the same in PHP and MEN1 (6). Furthermore, LOH in chromosome 11q13 was reported in 2.5% (1 of 39 tumors) to 17% (2 of 12 tumors) of uremic patients on long-term hemodialysis (8, 9, 10). Arnold et al. (11) demonstrated monoclonality in parathyroid tumors in chronic renal failure and in PHP, and very recently somatic MEN1 gene mutations in uremia-associated hyperplastic parathyroid glands were identified in a few uremic patients, namely, 2 of 48 (4.2%) and only 1 of 81 (1.2%) in the United States and Japan, respectively (12, 13).

There is an increasing number of case reports of patients with familial or nonfamilial hypophosphatemic rickets or osteomalacia who developed parathyroid hyperplasia or adenoma after being treated with oral phosphate supplements for a prolonged period, even though their renal function remained intact (14, 15, 16, 17, 18, 19, 20, 21). Although monoclonality in hyperplastic parathyroid glands were reported in X-lined hypophosphatemic rickets with normal renal function (22), the molecular pathogenesis of these phosphate-induced parathyroid hyperplasia and adenoma causing hypercalcemia, namely tertiary hyperparathyroidism, remains largely unknown.

We have been treating a patient with adult-onset hypophosphatemic osteomalacia of undetermined origin, with 1{alpha}-OHD3 and oral phosphate for 13 yr, when tertiary hyperparathyroidism developed. The patient was treated by total resection of four enlarged parathyroid glands and autotransplantation of a hyperplastic parathyroid gland and has been doing well for the last 2 yr. Sequence analysis of the coding exons of the MEN1 gene revealed somatic MEN1 gene mutations in two of the four hyperplastic parathyroid glands, accompanied by LOH at locus 11q13 in one gland, suggesting that the repeated increase in serum phosphate concentrations for a prolonged period may be related to tumorigenesis of the parathyroid glands.

Case Report

A 38-yr-old patient with severe bone pains in the back and loins, 1.5 yr in duration, was admitted to the Tokyo Women’s Medical University Hospital in August 1985. Because of generalized bone pain, the patient had difficulty in walking, and lancinating pains developed in the thorax during coughing. Physical findings were unremarkable except for the severe bone pains. His height (165 cm) remained unchanged, and his growth and development had been normal. No family history of bone metabolic diseases was found.

Laboratory study results were as follows (normal ranges in parentheses): Total protein 74 g/liter (65–82), albumin 41 g/liter (38–51), alkaline phosphatase 27.4 King-Armstrong units (2.7–10), serum calcium 2.25 mM (2.1–2.5), serum phosphorus 0.38 mM (0.81–1.39), blood urea nitrogen 2.4 mM (1.1–2.85), creatinine 88 µM (62–115), and uric acid 218 µM (231–375). A complete blood cell count was normal. There was no proteinuria, glucosuria, or aminoaciduria. Despite marked hypophosphatemia, the urinary excretion of phosphate was not decreased (500–1000 mg/d), and the renal threshold phosphate concentration (TmPO4/GFR) was reduced to 0.35 mM/liter (1.1 mg/dl). Serum level of 25-OHD (25.7 nM) was marginally decreased (26–143). Serum level of 1,25-(OH)2D (53.6 pM) was in the normal range (52–156), but it was interpreted to be inappropriately normal relative to the marked hypophosphatemia (14). The serum levels of PTH, determined by house-made RIA using antibody specific for the C terminal fragment, were in the normal range (less than 0.6 µg/liter) (23). Iliac bone biopsy following two courses of tetracycline administration revealed marked osteoidosis and diffuse tetracycline fluorescence indicative of osteomalacia (14).

Oncogenic osteomalacia was suspected, but systemic examinations (bone x-ray survey, 99mTc bone scintigraphy, and urological and otolaryngological examinations) and cranial, chest, and abdominal computed tomography scanning could not detect any responsible tumor. A tentative diagnosis of idiopathic, acquired, hypophosphatemic osteomalacia was made, and 1{alpha}-OHD3 (9 µg/d) and oral phosphate (Joulie’s solution, 2–3 g phosphorus/d, t.i.d.) was prescribed. After a few months, the bone pains gradually subsided and the patient was doing well. After 12 months, serum calcium levels increased more than 2.5 mM; therefore, the dose of 1{alpha}-OHD3 was gradually tapered to 3 µg/d (Table 1Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Laboratory data of a patient with hypophosphatemic osteomalacia treated with 1{alpha}-OHD3 and phosphate

 
Despite a stepwise reduction in the dose of 1{alpha}-OHD3 to 1 µg/d, the serum level of calcium rose progressively to more than 2.5 mM in 1995. Serum levels of intact PTH increased to more than 22 pM in July 1998 (normal range 2.5–8.0 pM). Echographic examination revealed four enlarged parathyroid glands. Oral supplementation of phosphate and vitamin D was therefore discontinued in December 1997. The four enlarged parathyroid glands did not decrease in size, and serum intact PTH levels remained elevated. Serum levels of phosphorus remained low (0.29–0.48 mM). Serum levels of alkaline phosphatase, mostly of bone origin, gradually increased to more than 800 IU/liter (normal range 70–260 IU/liter) in July 1998 and the bone pains exacerbated again. On November 4, 1998, total parathyroidectomy was performed, and the left lower parathyroid gland was dissected into small pieces and about 100 mg of the dissected tissue were autotransplanted intramuscularly into the left forearm. For the following 2 yr, the patient was doing well without any bone pain and with normal serum levels of calcium and intact PTH, at an oral dose of 3 µg/d 1{alpha}-OHD3 and 1 g/d phosphate, q.i.d. (Table 1Go), but the hypophosphatemia and the hyperphosphaturia continued with a markedly reduced TmPO4/GFR (0.32 mmol/liter).

At the end of 2000, magnetic resonance imaging skeletal survey (24) revealed a well-defined low-density area (3 x 4 x 3 cm) in the greater trochanter of the right femur. On January 13, 2001, the tumor was totally resected. Pathological examination revealed benign chondroblastoma. After the operation, 1{alpha}-OHD3 and Joulie’s solution were discontinued. However, hypophosphatemia and hyperphosphaturia persisted, accompanied with decreased serum levels of 1,25-(OH)2D. Because serum levels of alkaline phosphatase of bone origin gradually increased, 1{alpha}-OHD3 and Joulie’s solution were again prescribed. At the present time, the patient is doing well without any bone pain.

Pathology of the four enlarged parathyroid glands

Histopathology of the left upper and lower parathyroid glands, weighing 181 and 427 mg, respectively, revealed chief cell hyperplasia with various degrees of multinodular hyperplasia of another cell component and with a decrease of stromal fat cells (Table 2Go). The right upper and lower glands, weighing 519 and 769 mg, respectively, showed a large circumscribed nodule with uniformity of cell appearance, consisting of chief cell hyperplasia with mainly solid arrangement of parenchymal cells and virtually no fat cells (Fig. 1Go). Oxyphilic cells were focally present in the right hyperplastic parathyroid glands.


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of the resected hyperplastic parathyroid glands

 


View larger version (161K):
[in this window]
[in a new window]
 
Figure 1. Histology of the right upper parathyroid gland. The right upper parathyroid gland showed a large circumscribed nodule with uniformity of cell appearance. The hyperplastic cells resemble chief cells revealing alveolar pattern of development with clear cytoplasma and compact nuclei (hematoxylin-eosin stain; original magnification, x100).

 
Materials and Methods

The four parathyroid glands were snap frozen and stored in liquid nitrogen until analysis. After thawing, about 30 mg of parathyroid gland were cut out from each enlarged parathyroid gland. Because the right upper and lower parathyroid glands contained a large hyperplastic lesion with a monotonous color, relatively homogenous tissues could be obtained. A peripheral blood sample was collected from the patient after surgery. Informed consent for gene analyses was obtained from the patient.

LOH and microsatellite instability (MSI)

Allelic loss of the MEN1 gene was assessed by microsatellite analysis based on PCR amplification of polymorphic short tandem repeat sequences flanking the MEN1 gene locus. Fluorescent (6FAM) oligonucleotide primers were used to amplify polymorphic markers PYGM, D11S4946, D11S4940, and D11S449 (25). Primers for D11S4946 and D11S4940 were prepared as described (25). For analysis of D11S449, the forward (5'-GGTGAAAAAACACACTTGTCTG) and the reverse (5'-ACAGGATCTCACTATGTCGCC) primers were prepared.

Furthermore, to confirm MSI, five microsatellite loci were analyzed, as recommended at the 1997 National Cancer Institute-sponsored conference on MSI, namely, BAT-25, BAT-26, D2S123, D5S346, and D17S250 (26). Primers were synthesized as described by Berg et al. (27). After PCR amplification, each PCR product was analyzed by laser-induced fluorescence on the ABI Prism 377 DNA sequencing system (PE Applied Biosystems, Chiba, Japan).

Markers were considered informative if two alleles were detected in normal tissue (peripheral blood lymphocytes). LOH was scored as a significant decrease (>75%) in fluorescence intensity (area under the curve) of one allele. MSI—replication error by DNA mismatch repair genes (10, 26, 28)—was detected as variations in the number of tandemly repeated nucleotides of polymorphic markers, compared with the peripheral blood.

Gene analysis of MEN1

Genomic DNA was extracted from parathyroid glands and blood samples using QIAamp tissue and blood kits, respectively (QIAGEN, Hilden, Germany). All the protein-coding regions of exons 2–10 of the MEN1 gene were amplified by the PCR using a 20-µl reaction mixture containing100 ng genomic DNA, 1 of 15 pairs of primers, and Taq DNA polymerase (Takara Taq, Takara, Tokyo, Japan) in an automated thermal cycler (PC-700, Asutekku, Fukuoka-Ken, Japan). The primers used were as described previously (6). PCR products formed by these primer were 379 (exon 3) to 638 bp (exon 2). Thirty cycles of PCR amplifications were performed in a thermal cycler with denaturation at 94 C for 1 min, annealing at 55–63 C for 1 min, and extension at 72 C for 1 min. The PCR products were purified with a QIAquick PCR purification kit (QIAGEN). These products were then sequenced (200 nmol DNA template/reaction) using an ABI 377 automated DNA sequencer (Perkin-Elmer Corp., PE Applied Biosystems, Foster City, CA) and the BigDye terminator cycle sequencing kit (Perkin-Elmer Corp.). Both strands of each exon were sequenced and their sequences were compared.

To demonstrate a 36-bp deletion with a 2-bp insertion in exon 2 by PCR, the forward primer (5'-GGCGGCCTCACCTACTTTC, nt 2504–2522) and the reverse primer (5'-TGAAGAGGGACTGGATGTGGG, nt 2700–2720) were prepared to amplify a short PCR product (217 bp) in the wild allele.

Results

LOH and MSI analysis of 11q13 locus

When D11S449 (CCTT repeat) was used as a polymorphic microsatellite marker, LOH was observed in the right upper parathyroid gland but not in the other three glands or the peripheral blood (Fig. 2DGo). This was also the case using D11S4946 (TA and TG repeat) (Fig. 2BGo). When PYGM (CA and GA repeat) was used as a polymorphic marker, several shadow bands were observed, compared with D11S4940 (TATC repeat) (29); however, both polymorphic markers were noninformative (Fig. 2Go, A and C).



View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. LOH analysis of the four parathyroid glands and the peripheral blood. Representative electropherograms of the PCR products amplified by FAM6-labeled primers (PYGM, D11S4946, D11S4940, and D11S 449) are shown. The MEN1 gene is located between PYGM and D11S4946. Arrows and asterisks indicate LOH and MSI, respectively. Lane 1, Left upper parathyroid gland; lane 2, left lower gland; lane 3, right upper gland; lane 4, right lower gland; lane 5, peripheral blood. Abscissa, Fluorescence signal intensity; ordinate, number of base pairs of the PCR products.

 
In the right lower parathyroid gland, one allele of D11S449 yielded a shorter amplification product (Fig. 2DGo). D11S4940, which was noninformative and gave a single peak in the other three parathyroid glands and the peripheral blood, also yielded a shorter amplification product (Fig. 2CGo). The similar state of replication errors was also observed in PYGM and D11S4946.

To confirm MSI, a panel of five markers (i.e., D2S123 [CA repeat]), BAT-26 [mononucleotide (A) repeat], BAT-25 [mononucleotide (T) repeat], D5S346 [CA repeat], and D17S250 [TA and CA repeat]) were analyzed as shown in Fig. 3Go. When D2S123 was used, slightly longer bands differing 2 or 4 nt were also demonstrated in the right lower parathyroid gland (Fig. 3AGo). Bat 26, Bat-25 and D17S250 were noninformative. Although no MSI was demonstrated in the former two microsatellite markers, D17S250 gave two bands, one in the same position accompanied with a longer PCR product differing 14 nt. Furthermore, D5S346, which was informative in the peripheral blood as well as the three parathyroid glands, gave a single band in the right lower parathyroid gland (Fig. 3DGo). It is difficult to discern whether this represents LOH or MSI in which the shifted allele has comigrated with the remaining wild-type allele (26). However, because at least two of five reference panels of microsatellite markers revealed MSI, the right lower parathyroid gland was interpreted to have developed high frequency MSI (26).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 3. MSI analysis of the four parathyroid glands and the peripheral blood. Representative electropherograms of the PCR products amplified by FAM6-labeled primers (D2S123, Bat26, Bat25, D5S346, and D17S250) are shown. Lane 1, Left upper parathyroid gland; lane 2, left lower gland; lane 3, right upper gland; lane 4, right lower gland; lane 5, peripheral blood. Abscissa, Fluorescence signal intensity; ordinate, number of base pairs of the PCR products.

 
Point mutations of the MEN1 gene

Complete analysis of the MEN1 gene of the four parathyroid glands revealed a 36-bp deletion (451–486, GCCGTGAGCTGGTGAAGAAGGTCTCCGATGTCATAT) and 2-bp insertion (TC) in exon 2 (Fig. 4Go, upper panel), in addition to an absent normal allele in the right upper parathyroid gland. These mutations are frame-shift deletion mutations that result in altered amino acid sequences and creation of stop codon (TAG) after 28 triplets.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 4. Direct sequence analysis of MEN1 gene of the right upper and lower parathyroid glands. PCR products of exon 2 of the right upper parathyroid (upper panel) and exon 10 of the right lower parathyroid gland (lower panel) were directly sequenced as described in Materials and Methods. The sequences shown are of the sense strand using the forward primer (upper panel) and the complementary strand using the reverse primer (lower panel). Genomic DNA was obtained from the peripheral blood.

 
Furthermore, a 2-bp deletion (1471–1472, AG) was observed in exon 10 in one allele in the right lower parathyroid gland (Fig. 4Go, lower panel). This mutation also results in altered amino acid sequences and creation of stop codon after 56 triplets. In accordance with negative LOH analysis, the wild-type MEN1 gene was present in this parathyroid gland, suggesting that the mutation is the first hit to the MEN1 gene. No abnormalities were detected in the other parathyroid glands or in the peripheral blood (Table 2Go).

To confirm a 36-bp deletion with a 2-bp insertion in exon 2, the primers were prepared to produce a small PCR product of 217 bp. As shown in Fig. 5Go, a normal PCR product was obtained in DNA derived from the left upper, left lower, and right lower parathyroid glands and the peripheral blood, whereas DNA derived from the right upper parathyroid gland gave a shorter PCR product (lane 3).



View larger version (84K):
[in this window]
[in a new window]
 
Figure 5. PCR products of exon 2 of the four parathyroid glands. Lane 1, Left upper parathyroid gland; lane 2, left lower parathyroid gland; lane 3, right upper parathyroid gland; lane 4, right lower parathyroid gland; lane 5, peripheral blood. Left lane: {phi}174-HaeIII digest.

 
Discussion

By performing direct sequencing of the MEN1 gene, two mutations were identified in two of the four hyperplastic parathyroid glands that developed in a patient with adult-onset hypophosphatemic osteomalacia after 13-yr supplementation with phosphate and vitamin D. One mutation consisted of a 36-bp deletion and a 2-bp insertion with LOH, and the other of a 2-bp deletion without LOH. Because the MEN1 gene is regarded as a tumor suppressor gene, the frame-shift mutation (36-bp deletion plus 2-bp insertion) in the right upper parathyroid gland, accompanied with LOH (without a wild MEN1 gene) is likely to be contributed to the tumorigenesis in this parathyroid gland in accordance with Knudson’s two-hit theory (30).

In this context, the 2-bp deletion in the right lower parathyroid gland, which represents the first hit, would not be capable of causing tumorigenesis because LOH was not detected and the other allele contained a wild-type MEN1 gene. It should be pointed out, however, that MSI was observed in this hyperplastic lesion. MSI, which is associated with mutations in certain DNA repair genes, was originally identified in hereditary nonpolyposis colorectal carcinoma (31) but recently found in sporadic parathyroid adenoma as well as secondary proliferative lesions of the parathyroid glands (10, 28). The reference panel used in the present paper was recommended for the characterization of MSI in colorectal cancer only, and it is well established that colorectal tumors with high-frequency MSI are associated with a less aggressive clinical course than are those with low-frequency MSI (26). Whether parathyroid tumors with high-frequency MSI also grow less aggressively remains to be elucidated in the future because only a few parathyroid tumors with MSI have been reported so far.

The present gene analysis data together with histopathological findings suggest that a large circumscribed nodule in the right upper and lower parathyroid glands is of monoclonal origin. No mutation was observed in the other parathyroid glands or in the peripheral blood, indicating that the MEN1 gene mutations were somatic. Therefore, it is evident that MEN1 gene mutations were involved in the tumorigenesis of the right upper parathyroid gland, whereas the other tumor suppressor genes (i.e., p53) and several oncogenes (i.e., PRAD1/cyclin D) may be involved in the hyperplastic lesions in the other three parathyroid glands (32). Furthermore, putative tumor suppressor genes located in 1p, 1q, 6p, 9p, 11p, 11q, and 15p as well as unidentified parathyroid oncogenes located in 16p and 19p may also have been involved (33, 34, 35).

Recently evidence has been presented to show that increased serum levels of phosphate not only promote PTH secretion but also stimulate parathyroid cell proliferation, leading to parathyroid hyperplasia (36, 37, 38). This effect is independent of serum-ionized calcium and vitamin D. It is highly likely, therefore, that a repeated increase in serum phosphate concentrations stimulated parathyroid cell proliferation, and the increased number of cell divisions increased the probability of a mutation of any kind. In the present case, however, MEN1 gene mutations and deletion occurred in three of eight alleles in the four hyperplastic parathyroid glands. Therefore, it is of interest to speculate that the MEN1 gene is very susceptible to mutation, when parathyroid cells are exposed to a rapid increase in serum phosphate concentration for a prolonged period. The mechanism by which a rapid and repeated increase in serum phosphate concentration causes mutations of oncogenes and tumor suppressor genes including MEN1 gene remains to be elucidated, but it would be certainly different from MEN1 gene mutations in patients who received irradiation to the cervical region (35).

The parathyroid growth response to chronic renal failure progresses through several stages (39). Initially, diffuse secondary hyperplasia of polyclonal origin develops during a prolonged period of hemodialysis. The hyperplasia gradually becomes nodular. The next stage is monoclonal proliferation of parathyroid cells, or adenoma in one or occasionally more than one, of the nodules. We presume that this is also the case in phosphate-induced hyperparathyroidism in patients with hypophosphatemic osteomalacia (14, 15, 16, 17, 18, 19, 20). By analyzing the MEN1 gene in the parathyroid glands, we have clearly demonstrated that the right upper parathyroid hyperplasia was monoclonal and that tertiary hyperparathyroidism definitely occurred in the present patient.

Very recently a well-circumscribed tumor was found in the greater trochanter of the right femur by magnetic resonance imaging survey. Although the tumor (chondroblastoma) was totally resected, serum levels of phosphate did not rapidly increase (40), but hypophosphatemia and hyperphosphaturia persisted even 1 month after the operation, accompanied with suppressed serum levels of 1,25-(OH)2D. We are reevaluating whether the tumor was completely resected or an additional tumor may be present. Because the tumor resection did not cure the state of hypophosphatemic osteomalacia, we cannot make a diagnosis of oncogenic osteomalacia at the present time. Definite diagnosis will be made when a not-yet-identified phosphaturic factor, phosphatonin, is identified (41). During the revision of this manuscript, however, a candidate of phosphatonin was found to be identical to FGF23 (42, 43, 44), whose gene is point mutated, presumably leading to gain of function, in patients with autosomal dominant rickets and/or osteomalacia (45). Currently, we are culturing the tumor cells, and planning to determine whether FGF-23 mRNA is abundantly expressed in the primary culture cells as demonstrated in the tumors obtained from patients with oncogenic osteomalacia (42, 43). Furthermore, we are eagerly waiting for assay kits that can detect serum levels of FGF-23 so that we can localize the tumor-secreting humoral factors that stimulates excessively phosphaturia, leading to severe hypophosphatemia.

To minimize a chance of additional gene mutations in the transplanted parathyroid tissue, the patient is now taking lower doses of oral phosphate (1 g/d) q.i.d. so that a rapid and sharp increase in serum phosphate concentration would be ameliorated. Recent serum levels of intact PTH is 7–11 pM, which cannot account for the hypophosphatemia and decreased serum levels of 1,25-(OH)2D. If serum levels of intact PTH steadily increases, partial resection of the transplanted hyperplastic parathyroid tissue is planned in the near future.

In summary, two somatic mutations of the MEN1 gene were identified in hyperplastic lesions of the four parathyroid glands obtained from a patient with adult-onset hypophosphatemic (probably oncogenic) osteomalacia, which developed after prolonged supplementation of phosphate and vitamin D. The present case suggests that a rapid and repeated increase in serum levels of phosphate, when continued for more than 10 yr, may be related to tumorigenesis in parathyroid glands leading to tertiary hyperparathyroidism, irrespective of renal function.

Footnotes

This work was supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan (13671164) and a research grant from the Chugai Pharmaceutical Co. (Tokyo, Japan).

Abbreviations: MEN1, MEN type 1; MSI, microsatellite instability; PHP, primary hyperparathyroidism.

Received May 3, 2001.

Accepted July 5, 2001.

References

  1. Chandrasekharappa SC, Guru SC, Manickam P, et al. 1997 Positional cloning of the gene for multiple endocrine neoplasia type I. Science 276:404–407[Abstract/Free Full Text]
  2. Marx S, Spiegel AM, Skarulis MC, Doppman JL, Collings FS, Liotta LA 1998 NIH Conference: multiple endocrine neoplasia type I: clinical and genetic topics. Ann Int Med 129:484–494[Abstract/Free Full Text]
  3. Heppner C, Kester MB, Agarwal SK, et al. 1997 Somatic mutation of the MEN1 gene in parathyroid tumours. Nat Genet 16:375–378[CrossRef][Medline]
  4. Farnebo F, Teh BT, Kytölä S, et al. 1998 Alterations of the MEN1 gene in sporadic parathyroid tumors. J Clin Endocrinol Metab 83:2627–2630[Abstract/Free Full Text]
  5. Carling T, Correa P, Hessman O, et al. Parathyroid MEN1 gene mutations in relation to clinical characteristics of non-familial primary hyperparathyroidism. J Clin Endocrinol Metab 83:2951–2954
  6. Sato K, Yamazaki K, Zhu H, et al. 2000 Mutation of the multiple endocrine neoplasia type I gene in non-familial primary hyperparathyroidism. Surgery 127:337–341[CrossRef][Medline]
  7. Miedlich S, Krohn K, Lamesch P, Muller A, Paschke R 2000 Frequency of somatic MEN1 gene mutations in monoclonal parathyroid tumours of patients with primary hyperparathyroidism. Eur J Endocrinol 143:47–54[Abstract]
  8. Falchetti A, Bale AE, Amorosi A, Bordi C, Cicchi P, Bandini S, Marx SJ, Brandi ML 1993 Progression of uremic hyperparathyroidism involves allelic loss on chromosome 11. J Clin Endocrinol Metab 76:139–144[Abstract]
  9. Farnebo F, Farnebo L, Nordenström J, Larsson C 1997 Allelic loss on chromosome 11 is uncommon in parathyroid glands of patients with hypercalcemic secondary hyperparathyroidism. Eur J Surg 163:1102–1151
  10. Koshiishi N, Chong JM, Fukasawa T, et al. 1999 Microsatellite instability and loss of heterozygosity in primary and secondary proliferative lesions of the parathyroid gland. Lab Invest 79:1051–1058[Medline]
  11. Arnold A, Brown MF, Urena P, Gaz RD, Sarfati E, Drücke TB 1995 Monoclonality of parathyroid tumors in chronic renal failure and in primary parathyroid hyperplasia. J Clin Invest 95:2047–2053
  12. Tahara H, Imanishi Y, Yamada T, Imanishi Y 2000 Rare somatic mutation of the multiple endocrine neoplasia type I gene in secondary neoplasia type I gene in secondary hyperparathyroidism of uremia. J Clin Endocrinol Metab 85:4113–4117[Abstract/Free Full Text]
  13. Imanishi Y, Tahara H, Salusky I, et al. 1999 MEN1 gene mutations in refractory hyperparathyroidism of uremia. J Bone Miner Res 14(Suppl):S446
  14. Parfitt AM 1998 Osteomalacia and related disorders. In: Avioli LV, Krane SM, eds. Metabolic bone disease and clinically related disorders, ed. 3 San Diego: Academic Press; 327–386
  15. Firth RG, Grant CS, Riggs BL 1985 Development of hypercalcemic hyperthyroidism after long-term phosphate supplementation in hypophosphatemic osteomalacia. Report of two cases. Am J Med 78:669–673[CrossRef][Medline]
  16. Reid IR, Teitelbaum SL, Dusso A, Whyte MP 1987 Hypercalcemic hyperparathyroidism complicating oncogenic osteomalacia. Effect of successful tumor resection on mineral homeostasis. Am J Med 83:350–354[CrossRef][Medline]
  17. Rivkees SA, El-Haji-Fuleihan G, Brown EM, Crawford JD 1992 Tertiary hyperparathyroidism during high phosphate therapy of familial hypophosphatemic rickets. J Clin Endocrinol Metab 75:1514–1518[Abstract]
  18. Sullivan W, Carpenter T, Glorieux F, Travers R, Insogna K 1992 A prospective trial of phosphate and 1,25-dihydroxyvitamin D3 therapy in symptomatic adults with X-linked hypophosphatemic rickets. J Clin Endocrinol Metab 75:879–885[Abstract]
  19. Knudtzon J, Halse J, Monn E, et al. 1995 Autonomous hyperparathyroidism in X-linked hypophosphatemia. Clin Endocrinol 42:199–203[Medline]
  20. Narvaez J, Rodriguez-Moreno J, Moragues C, Campoy E, Clavaguera T, Roig-Escofet D 1996 Tertiary hyperparathyroidism after long-term phosphate supplementation in adult-onset hypophosphatemic osteomalacia. Br J Rheumatol 35:598–600[Abstract/Free Full Text]
  21. Yeung SJ, McCutcheon IE, Schultz P, Gagel RF 2000 Use of long-term intravenous phosphate infusion in the palliative treatment of tumor-induced osteomalacia. J Clin Endocrinol Metab 85:549–555[Abstract/Free Full Text]
  22. Imanishi Y, Rivkees S, Friedman N, Arnold A 1998 Monoclonality of parathyroid tumors in X-linked hypophosphatemic rickets. Bone 23 (Suppl):S191 (abstract 1179)
  23. Kasono K, Sato K, Suzuki T, et al. 1991 Falsely elevated parathyroid hormone levels due to immunoglobulin G in a patient with idiopathic hypoparathyroidism. J Clin Endocrinol Metab 72:217–222[Abstract/Free Full Text]
  24. Avila NA, Skarulis M, Rubino DM, Doppman JL 1996 Oncogenic osteomalacia: lesion detection by MR skeletal survey. Am J Roentgenol 167:343–345[Free Full Text]
  25. Manickam P, Guru SC, Develenko LV, et al. 1997 Eighteen new polymorphic markers in the multiple endocrine neoplasia type I (MEN1) region. Hum Genet 101:101–108
  26. Boland CR, Thibodeau SN, Hamilton SR, et al. 1998 A National Cancer Institute Workshop on microsatellite instability for cancer detection and familial predisposition: development of international criteria for detection of microsatellite instability in colorectal cancer. Cancer Res 58:5248–5257[Abstract/Free Full Text]
  27. Berg JD, Glaser CL, Thompson RE, Hamilton SR, Griffin CA, Eshleman JR 2000 Detection of microsatellite instability by fluorescence multiplex polymerase chain reaction. J Mol Diagn 2:20–26[Abstract/Free Full Text]
  28. Sarquis M, Friedman E, Boson WL, Gomes RS, Dias AF, De Marco L 2000 Microsatellite instability in sporadic parathyroid adenoma. J Clin Endocrinol Metab 85:250–252[Abstract/Free Full Text]
  29. Hauge XY, Litt M 1993 A study of the origin of ‘shadow bands’ seen when typing dinucleotide repeat polymorphism by the PCR. Hum Mol Genet 2:411–415[Abstract/Free Full Text]
  30. Knudson AG 1971 Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci USA 68:820–823[Abstract/Free Full Text]
  31. Arzimanoglou II, Gilvert F, Barker HRK 1998 Microsatellite instability in human solid tumors. Cancer 82:1808–1820[CrossRef][Medline]
  32. Arnold A 1994 Molecular basis of primary hyperparathyroidism. In: Bilezikian JP, Levine MA, Marcus R, eds. The parathyroids. New York: Raven Press; 373–405
  33. Tahara H, Smith AP, Gaz RD, Cryns VL, Arnold A 1996 Genomic localization of novel candidate tumor suppressor gene loci in human parathyroid adenomas. Cancer Res 56:599–605[Abstract/Free Full Text]
  34. Palanisamy N, Imanishi Y, Rao P, Tahara H, Chaganti R, Arnold A 1998 Novel chromosomal abnormalities identified by comparative genomic hybridization in parathyroid adenomas. J Clin Endocrinol Metab 83:1766–1770[Abstract/Free Full Text]
  35. Farnebo F, Kytölä S, Teh BT, et al. 1999 Alternative genetic pathway in parathyroid tumorigenesis. J Clin Endocrinol Metab 84:3775–3870[Abstract/Free Full Text]
  36. Slatopolsky E, Finch J, Denda M, et al. 1996 Phosphorus restriction prevents parathyroid gland growth: high phosphorus directly stimulates PTH secretion in vitro. J Clin Invest 97:2534–2540[Medline]
  37. Denda M, Finch J, Slatopolsky E 1996 Phosphorus accelerates the development of parathyroid hyperplasia and secondary hyperparathyroidism. Am J Kidney Dis 28:596–602[Medline]
  38. Estepa JC, Aguilera-Tejero E, Lopez I, Almaden Y, Rodoriguez M, Felsenfeld A 1999 Effect of phosphate on parathyroid hormone secretion in vivo. J Bone Miner Res 14:1848–1854[CrossRef][Medline]
  39. Parfitt AM 1994 Parathyroid growth. Normal and abnormal. In: Bilezikian JP, Levine MA, Marcus R, eds. The parathyroids. New York: Raven Press; 373–405
  40. Fukumoto Y, Tarui S, Tsukiyama K, et al. 1979 Tumor-induced vitamin D-resistant hypophosphatemic osteomalacia associated with proximal renal tubular dysfunction and 1,25-dihydroxyvitamin D deficiency. J Clin Endocrinol Metab 49:873–878[Abstract/Free Full Text]
  41. Drezner MK 2000 PHEX gene and hypophosphatemia. Kidney Int 57:9–18[CrossRef][Medline]
  42. White KE, Jonsson KB, Carn G, et al. 2001 The autosomal dominant hypophosphatemic rickets (ADHR) gene is a secreted polypeptide over-expressed by tumors that cause phosphate wasting. J Clin Endocrinol Metab 86:494–496[Free Full Text]
  43. Shimada T, Mizutani S, Muto T, et al. 2001 Cloning and characterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc Natl Acad Sci USA 98:6500–6505[Abstract/Free Full Text]
  44. Strewler GJ 2001 FGF23, hypophosphatemia, and rickets: has phosphatonin been found? Proc Natl Acad Sci USA 98:5945–5946[Free Full Text]
  45. The ADHR Consortium 2000 Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet 26:345–358[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
S. M. Mallya, J. J. Gallagher, and A. Arnold
Analysis of Microsatellite Instability in Sporadic Parathyroid Adenomas
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1248 - 1251.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sato, K.
Right arrow Articles by Takano, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sato, K.
Right arrow Articles by Takano, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals