| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Division of Medical Sciences (C.L.M., N.D., H.N., S.M.C., P.D., M.H., P.M.S.), Queen Elizabeth Hospital, and Division of Child and Reproductive Health (M.D.K.), Birmingham Womens Hospital, University of Birmingham, Edgbaston, Birmingham, United Kingdom B15 2TH
Address all correspondence and requests for reprints to: Prof. Paul M. Stewart, M.D., F.R.C.P., FmedSci, Division of Medical Sciences, University of Birmingham, Queen Elizabeth Hospital, Edgbaston, Birmingham, United Kingdom B15 2TH. E-mail p.m.stewart{at}bham.ac.uk
Abstract
11ß-Hydroxysteroid dehydrogenase type 2 (11ß-HSD2) inactivates
cortisol to cortisone. In the placenta 11ß-HSD2 activity is thought
to protect the fetus from the deleterious effects of maternal
glucocorticoids. Patients with apparent mineralocorticoid excess owing
to mutations in the 11ß-HSD2 gene invariably have reduced birth
weight, and we have recently shown reduced placental 11ß-HSD2
activity in pregnancies complicated by intrauterine growth restriction.
This is reflected in the literature by evidence of hypercortisolemia in
the fetal circulation of small babies. In this study we have determined
the levels of placental 11ß-HSD2 mRNA expression across normal
gestation (n = 86 placentae) and in pregnancies complicated by
intrauterine growth restriction (n = 19) and evaluated the
underlying mechanism for any aberrant 11ß-HSD2 mRNA expression in
intrauterine growth restriction. 11ß-HSD2 mRNA expression increased
more than 50-fold across gestation, peaking at term. Placental
11ß-HSD2 mRNA levels were significantly decreased in intrauterine
growth restriction pregnancies when compared with gestationally
matched, appropriately grown placentae [e.g. at term
Ct (11ß-hydroxysteroid dehydrogenase type 2/18S) 12.8 ±
0.8 (mean ± SE) vs. 10.2 ± 0.2,
respectively, P < 0.001]. These differences
were not attributable to changes in trophoblast mass in intrauterine
growth restriction placentae, as assessed by parallel analyses of
cytokeratin-8 mRNA expression. No mutations were found in the
11ß-HSD2 gene in the intrauterine growth restriction cohort, and
imprinting analysis revealed that the 11ß-HSD2 gene was not
imprinted. Although the underlying cause is unknown, 11ß-HSD2 gene
expression is reduced in intrauterine growth restriction pregnancies.
These data highlight the important role of 11ß-HSD2 in regulating
fetal growth, a known factor in determining fetal morbidity but also
the subsequent development of cardiovascular disease in
adulthood.
FETAL GROWTH RESTRICTION is an important cause of perinatal morbidity and mortality (1) but, through as yet ill-defined "programming" mechanisms, has also been linked to the development of prevalent adult diseases including hypertension, diabetes, and coronary artery disease (2). The endocrine control of fetal growth, therefore, seems likely to have a major impact on both neonatal and adult well-being. Glucocorticoid excess in utero has been shown to impair fetal growth in rodents (3) and man (4). It is also of note that in both animal models (5) and human pregnancies (6, 7), small-for-gestational-age babies appear to have elevated cortisol levels. A key factor in determining glucocorticoid hormone action is the "prereceptor" role played by two distinct isozymes of 11ß-hydroxysteroid dehydrogenase (11ß-HSD) that interconvert hormonally active cortisol to inactive cortisone (8, 9). 11ß-HSD1 is a low-affinity, nicotinamide adenine dinucleotide phosphate-dependent dehydrogenase/11-oxo-reductase (10, 11), which is expressed in the maternal decidua but is low or absent in human fetal tissues including trophoblast (12). 11ß-HSD2 is a high-affinity nicotinamide adenine dinucleotide-dependent dehydrogenase (13) that is principally expressed in the kidney and colon (12, 14) where it serves to protect the MR from cortisol excess, enabling aldosterone to interact with the MR (8, 9). In addition, the enzyme is widely distributed in human fetal tissues (12), including the placental trophoblast where it is expressed in particularly high abundance (15, 16, 17, 18, 19, 20). Unlike the kidney, however, the precise role of placental 11ß-HSD2 is unknown; the placenta is not an obvious mineralocorticoid target tissue and it seems likely that the enzyme may modulate cortisol exposure to the GR rather than the MR (21). Specifically in the placenta, the concept has emerged that 11ß-HSD2 inactivates the much higher maternal cortisol concentrations across gestation, thereby facilitating fetal growth (22). In support of this, significant correlations between birth weight and placental 11ß-HSD2 activity have been reported in some human studies (18) but not others (19).
Furthermore, patients with mutations in the HSD11B2 gene, located on human chromosome 16, present with a severe form of mineralocorticoid hypertension [the syndrome of apparent mineralocorticoid excess (AME)] (8) but, in addition, have impaired fetal growth with low birth weight (23). Genetic studies have documented the association between intrauterine growth restriction (IUGR) and confined placental mosaicism, and chromosome 16 has been shown to be involved. Furthermore, trisomy 16 is the most common trisomy associated with both miscarriage (10% of trisomies found) and IUGR (24). In recent studies we have reported reduced placental 11ß-HSD2 activity in pregnancies complicated by severe IUGR (25). The aim of this study was to further examine the role of placental 11ß-HSD2 across normal gestation and in pregnancies complicated by IUGR. Having documented reduced placental 11ß-HSD2 mRNA levels in IUGR, we also explored the underlying basis for this by screening the HSD11B2 gene for any disease-causing mutations similar to those seen in AME and determined the imprinting status of the gene in IUGR placentae.
Materials and Methods
Samples
The study had the approval of the local hospital ethics
committee. Placental samples were collected from either termination
tissues (in accordance with the Polkinghorne report) or elective
cesarean sections. A total of 86 placental samples were collected and
grouped as follows: early first trimester (68 wk gestation, n =
19), late first trimester (912 wk gestation, n = 16), second
trimester (1317 wk gestation, n = 6), early third trimester
(2734 wk gestation, n = 4), and term (n = 22). Nineteen
cases of IUGR were diagnosed prospectively, having at least three of
the four following characteristics determined from ultrasound
examination: 1) ultrasound measurement of fetal abdominal circumference
less than or equal to the third percentile for gestational age, 2)
abnormal fetal growth velocity (
abdominal circumference <1.5
SD over 14 d), 3) severe oligohydramnios (amniotic
fluid index less than or equal to the third percentile for gestational
age), 4) absent or reversed velocities in umbilical artery Doppler
waveforms. The IUGR group was divided into early and late gestation
groups, 15 patients being 2532 wk gestation and 4 patients 3738 wk
gestation.
In each case, placental samples were obtained by dissecting the placental tissue off the chorionic plate. No membrane was left adherent to the placental samples that were snap frozen in liquid nitrogen and stored at -80 C until analysis.
RNA extraction
RNA was extracted from placentae using the StrataPrep total RNA miniprep kit (Stratagene, Amsterdam, The Netherlands), which included a DNase digestion step to remove any contaminating genomic DNA. One microgram of RNA from each sample was reverse transcribed using AMV reverse transcriptase (Promega Corp., Southampton, UK) and random hexamers in 20-µl reaction volumes according to the manufacturers instructions.
Quantitative PCR
11ß-HSD2 mRNA levels were analyzed using an ABI 7700 sequence detection system, which employs TaqMan chemistry for highly accurate quantification of mRNA levels. Briefly, a fluorogenic TaqMan probe consists of an oligonucleotide with a 5' reporter and a 3' quencher dye. Fluorescent quenching of the reporter dye depends on the spatial proximity of its quencher. PCR amplification releases the reporter into solution, away from its quencher, yielding a signal that is read by a laser and CCD camera. One such event occurs for each PCR product generated, enabling real-time detection of cDNA amplification.
RT-PCR was performed in 25-µl volumes on 96-well plates, in reaction
buffer containing TaqMan universal PCR master mix, 3 mM
Mn(Oac)2, 200 µM dNTPs, 1.25 U
AmpliTaq Gold polymerase, 1.25 U AmpErase UNG, 100200 nmol TaqMan
probe, 900-nmol primers and 2550 ng cDNA. All reactions were
multiplexed with the housekeeping gene 18S, provided as a preoptimized
control probe (PE Biosystems, Warrington, UK)
enabling data to be expressed in relation to an internal reference to
allow for differences in reverse transcription efficiency. Data were
obtained as Ct values according to the manufacturers
guidelines (the cycle number at which logarithmic PCR plots cross a
calculated threshold line) and used to determine
Ct values
(
Ct = Ct of the target gene minus Ct of the housekeeping gene).
Measurements were carried out on at least three occasions for each
sample. All target gene probes were labeled with the fluorescent label
FAM, and the housekeeping gene with the fluorescent label VIC.
Reactions were as follows: 50 C for 2 min, 95 C for 10 min, and then 44
cycles of 95 C for 15 sec and 60 C for 1 min.
As a further control, RT-PCR was performed on all the placental samples to determine the levels of cytokeratin-8 mRNA expression, a trophoblast epithelial marker (26).
Quantitative primer and probe sequences for 11ß-HSD2 were forward primer GGGCCTATGGAACCTCCAA, reverse primer GACCCACGTTTCTCACTGACTCT, and TaqMan probe CCGTGGCGCTACTCATGGACACA and for cytokeratin-8 were forward primer ATGTGGATGAAGCATACATGAACA, reverse primer TCCCGGATCTCCTCTTCATACA, and TaqMan probe CCGACGAGATCAACTTCCTCAGGCA.
To exclude potential bias owing to averaging data that had been
transformed through the equation 2-
Ct, all
statistics were performed at the
Ct stage. Statistical analysis of
comparisons among groups was undertaken using an unpaired t
test.
DNA extraction and 11ß-HSD2 gene studies
DNA was extracted from IUGR and normal term placentae using the Nucleon Bacc II DNA extraction kit (Tepnel Life Sciences, Manchester, UK) according to the manufacturers instructions. PCR primers were designed for each of the five exons and the promoter of 11ß-HSD2 as previously reported by our group (27). PCR was performed on DNA from 10 IUGR placentae using 200 ng DNA, 25-pmol primers, and 2.5 U Taq polymerase (Promega Corp.) according to standard procedures. The cycling conditions were 94 C for 5 min for one cycle, 94 C for 20 sec, 5560 C for 20 sec, and 72 C for 2030 sec for 3032 cycles depending on the region being amplified. The amplicons were electrophoresed on agarose gels and then purified using the Qiaex II gel purification kit (QIAGEN, Crawley, UK). Amplicons were sequenced using BigDye terminator sequencing chemistry (PE Biosystems) and sequences analyzed and compared with both GenBank data (accession numbers U27317 and U27318) and our previous sequencing results.
Imprinting analyses used two single nucleotide polymorphisms (SNPs) present in exon 3 of the 11ß-HSD2 gene at codon positions 178 (GAG to GAA) (28) and 196 (GCG to GCA) (29). Exon 3 was amplified from DNA of 22 term placentae and the amplicons electrophoresed, gel purified, and sequenced as detailed previously. RNA was extracted from three placentae that were heterozygous for the SNPs; 1 µg of RNA from each sample was reverse transcribed, and exon 3 was amplified using a primer spanning the exon 34 boundary (5'ATATGGCATGTCCCCCGCTG3') and an exon 2 primer. This in conjunction with the DNase treatment of the RNA excludes the possibility of genomic DNA contamination in the PCR.
Results
mRNA expression studies
Normal gestation. Relative fold increases in 11ß-HSD2 mRNA
expression across gestation were calculated using the early first
trimester group as a reference (arbitrary value of 1). The 11ß-HSD2
mRNA expression was similar in the late first and second trimester
groups (relative fold increase: late first trimester 0.65; second
trimester 0.48) as it was in the early first trimester group. There
was, however, a 12-fold (
Ct 12.46, 2-
Ct
11.98) increase in 11ß-HSD2 mRNA expression at gestational wk 2734,
and a 56-fold (
Ct 10.24, 2-
Ct 55.7)
increase at term when compared with early first trimester (Fig. 1
).
|
Ct 14.2 ± 0.9 vs. 11.3 ± 1.0
(mean ± SE), respectively,
P = 0.04]. The later IUGR subgroup (3738 wk) also
had reduced 11ß-HSD2 mRNA levels, compared with term placentae
(
Ct, 12.8 ± 0.8 vs. 10.2 ± 0.2,
P < 0.001) (Fig. 1
There were no significant differences in the levels of cytokeratin-8
mRNA across gestation (early first trimester
Ct 12.66 ± 0.44;
second trimester
Ct 12.47 ± 0.31; term
Ct 13.04 ±
0.42) or, importantly, in the IUGR subgroup (2532 wk,
Ct
13.54 ± 0.69; 3738 wk,
Ct 14.55 ± 0.21), indicating
that the reduction in 11ß-HSD2 mRNA levels could not be explained by
changes in the amount of trophoblast tissue (Fig. 1
).
11ß-HSD2 gene studies
All five exons and the promoter region (-860 bp) of the 11ß-HSD2 gene were amplified and sequenced in 10 placentae from pregnancies complicated with IUGR. No mutations were identified.
The two SNPs in exon 3 of 11ß-HSD2, positions 178 (GAG to GAA) and
196 (GCG to GCA), were examined in 22 term placentae. Three of the
placentae were informative at one of these loci, and cDNA was prepared
from them and sequenced to determine which allele was being expressed.
Both alleles of the SNP were present in all three placentae (Fig. 2
), indicating that the parental allele
was not silenced suggesting that 11ß-HSD2 is not an imprinted
gene.
|
Across normal human pregnancy, levels of 11ß-HSD2 mRNA expression were similar in the first and second trimester groups but thereafter significantly increased in the early third trimester (12-fold) to term (56-fold increase). These data support earlier placental enzyme activity analysis carried out in a separate pregnancy cohort (25) and indicate that the exponential increase in placental 11ß-HSD2 expression as term progresses is mediated at the transcriptional level. In the baboon placenta, E increases 11ß-HSD2 enzyme expression (30) (as it does in the rodent kidney), and the rising E levels that occur across pregnancy may account for the changes in 11ß-HSD2 gene expression. Conversely, at least in late gestation, progesterone levels fall and in vitro studies have shown that progesterone inhibits 11ß-HSD2 enzyme activity (31). Other factors within the placenta may mediate these striking changes in 11ß-HSD2 expression. Thus, although the 11ß-HSD2 protein is identical in adult and fetal tissues (32), the use of alternate transcriptional start sites results in placental 11ß-HSD2 (as determined in the human choriocarcinoma cell, JEG-3 cells) but not adult kidney 11ß-HSD2 being regulated by cAMP and its analogs (33, 34, 35). Additionally, nitric oxide inhibits 11ß-HSD2 activity and mRNA levels in cultured human term trophoblast cells (34).
Placental 11ß-HSD2 activity studies together with selective sampling of the placental vascular beds indicate the immense capacity of the placenta to inactivate cortisol to cortisone (18, 19, 25, 36). Despite this impressive activity, the definitive role of placental 11ß-HSD2 remains unknown. Studies in the baboon, supported by data in humans, suggest that the placental inactivation of cortisol facilitates the development and "awakening" of the fetal hypothalamopituitary-adrenal axis. Thus, the removal of the suppressive influence of cortisol (be it maternal or fetal in origin) is the stimulus to activate fetal hypothalamic corticotrophin-releasing factor and pituitary POMC synthesis and secretion (30, 37). Alternatively, it has been suggested that placental 11ß-HSD2 may serve as a barrier, protecting the developing fetus from the possible deleterious effects of maternally derived glucocorticoids (3, 36). Evidence from rodent, primate, and human studies support the notion that glucocorticoid excess in utero impairs fetal growth (3, 4), thereby providing a potential mechanism to explain the Barker hypothesisthe inverse correlation between birth weight and prevalence of adult hypertension, diabetes, and coronary artery disease (2). Placental 11ß-HSD2 expression may, in turn, be crucial to this process. Thus, patients with AME owing to mutations in the 11ß-HSD2 gene invariably have reduced birth weight (23), and correlations between placental 11ß-HSD2 activity and birth weight have been reported across normal pregnancies in some (18) but not all (19) studies.
Several rodent studies have attempted to address this issue, and the adverse programming of insulin sensitivity and blood pressure has been documented in adult rats following maternal treatment with carbenoxolone, an 11ß-HSD2 inhibitor (38). However, recombinant mice lacking the 11ß-HSD2 gene are of normal birth weight (39); similarly, we were unable to alter birth weight in the mouse by inhibiting fetal 11ß-HSD2 expression across gestation (40). However, the ontogeny of 11ß-HSD2 in the rodent is notably different from that reported here across human pregnancy; in both rats and mice, 11ß-HSD2 gene transcription is effectively silenced in mid- and late gestation in fetal tissues including the placenta in contrast to the exponential increase observed in man (41, 42). The applicability of rodent models in this setting, therefore, is highly questionable.
In placentae from IUGR-complicated pregnancies, 11ß-HSD2 mRNA levels were significantly reduced when compared with term and gestationally matched, appropriately grown pregnancies. Importantly, this could not be attributed to obvious changes in trophoblast mass between IUGR and normal placentae in view of the similar amounts of the trophoblast marker, cytokeratin-8, present in each group of samples. Previous data from our group have noted that 11ß-HSD2 is the predominant isoform expressed in trophoblast tissue (12). However, other groups have noted the expression of 11ß-HSD1 on "intermediate villi and endothelial cells on the fetal vasculature" (20). Our own data from cultured primary cytotrophoblast cells, although confirming the type 2 isoform as the predominantly expressed 11ß-HSD2 in trophoblast, have noted low levels of mRNA encoding 11ß-HSD1 in these cultured cells (43). It is possible, therefore, that maintenance of some 11ß-HSD1 activity and attenuated 11ß-HSD2 would account for elevated fetal cortisol concentrations seen in IUGR pregnancies. These data support our earlier posttranscriptional (activity) studies performed on a separate cohort of patients with IUGR (25) and provide impressive, circumstantial evidence for a role of 11ß-HSD2 in regulating fetal growth. Whether this is mediated by glucocorticoid excess in utero remains to be proven; it should be noted that the expression of 11ß-HSD2 is widespread in many fetal tissues in addition to trophoblast, suggesting that developing fetal tissues can protect themselves in an autocrine fashion (12, 21). An alternative hypothesis, therefore, is that 11ß-HSD2 is directly involved in the placentation process itself.
The explanation for the reduction in placental 11ß-HSD2 gene expression in IUGR remains unknown. We have not identified any mutations in the 11ß-HSD2 gene from DNA extracted from IUGR placentae. Several cases of IUGR have been reported in association with confined placental mosaicism. In particular, a high incidence of maternal uniparental disomy for chromosome 16 (the chromosomal localization of the 11ß-HSD2 gene) has been found in confined placental mosaics of IUGR placentae (24). Imprinting of a gene on chromosome 16 therefore could result in distorted expression of that gene product. For example, if 11ß-HSD2 was an imprinted gene and expressed only on the paternal chromosome, maternal uniparental disomy for chromosome 16 would lead to zero expression of 11ß-HSD2; if this occurred in a confined placental mosaic, it would lead to areas of the placenta without 11ß-HSD2 activity. Additionally, it is established that a mechanism used in imprinting is methylation. Methylation of CpG sites within GC-rich promoters can effectively, and heritably, lock genes in the off condition (44). Both the promoter region and exon 1 of the 11ß-HSD2 gene are extremely GC rich and therefore a candidate for gene silencing by imprinting. However, by evaluating informative encoding polymorphisms within the 11ß-HSD2 gene, we can conclude that the gene is not imprinted and therefore any uniparental expression of 11ß-HSD2 would not result in varying levels of enzyme expression. It is still possible that methylation may result in epigenetic silencing of 11ß-HSD2 in IUGR placentae, and this needs further evaluation.
In summary, we have demonstrated that placental 11ß-HSD2 gene expression increases across normal human gestation but is significantly decreased in pregnancies complicated by IUGR. The cause of the reduction in mRNA expression cannot be explained on the basis of mutations in the 11ß-HSD2 gene or this gene being imprinted. This study supports the concept that placental 11ß-HSD2 plays a crucial role in regulating fetal growth across human pregnancy. Defects in expression of the enzyme in fetal life may have considerable ramifications for both neonatal and adult well-being.
Acknowledgments
Footnotes
This work was supported by Action Research and the MRC (UK). H.N. was Wellcome Trust summer student. P.M.S. is an MRC Senior Clinical Fellow.
Abbreviations: AME, Apparent mineralocorticoid excess; 11ß-HSD, 11ß-hydroxysteroid dehydrogenase; IUGR, intrauterine growth restriction; SNP, single nucleotide polymorphism.
Received March 27, 2001.
Accepted June 15, 2001.
References
This article has been cited by other articles:
![]() |
A. E. Michael and A. T. Papageorghiou Potential significance of physiological and pharmacological glucocorticoids in early pregnancy Hum. Reprod. Update, September 1, 2008; 14(5): 497 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chan, E. H Rabbitt, B. A Innes, J. N Bulmer, P. M Stewart, M. D Kilby, and M. Hewison Glucocorticoid-induced apoptosis in human decidua: a novel role for 11{beta}-hydroxysteroid dehydrogenase in late gestation J. Endocrinol., October 1, 2007; 195(1): 7 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Atanasov, I. D. Ignatova, L. G. Nashev, B. Dick, P. Ferrari, F. J. Frey, and A. Odermatt Impaired Protein Stability of 11beta-Hydroxysteroid Dehydrogenase Type 2: A Novel Mechanism of Apparent Mineralocorticoid Excess J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1262 - 1270. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Magnusson-Olsson, B. Hamark, A. Ericsson, M. Wennergren, T. Jansson, and T. L. Powell Gestational and hormonal regulation of human placental lipoprotein lipase J. Lipid Res., November 1, 2006; 47(11): 2551 - 2561. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Mark and B. J. Waddell P-Glycoprotein Restricts Access of Cortisol and Dexamethasone to the Glucocorticoid Receptor in Placental BeWo Cells Endocrinology, November 1, 2006; 147(11): 5147 - 5152. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. E. Murphy, R. Smith, W. B. Giles, and V. L. Clifton Endocrine Regulation of Human Fetal Growth: The Role of the Mother, Placenta, and Fetus Endocr. Rev., April 1, 2006; 27(2): 141 - 169. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kapoor, E. Dunn, A. Kostaki, M. H. Andrews, and S. G. Matthews Fetal programming of hypothalamo-pituitary-adrenal function: prenatal stress and glucocorticoids J. Physiol., April 1, 2006; 572(1): 31 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Kossintseva, S. Wong, E. Johnstone, L. Guilbert, D. M. Olson, and B. F. Mitchell Proinflammatory cytokines inhibit human placental 11{beta}-hydroxysteroid dehydrogenase type 2 activity through Ca2+ and cAMP pathways Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E282 - E288. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yang, L. Julan, F. Rubio, A. Sharma, and H. Guan Cadmium reduces 11{beta}-hydroxysteroid dehydrogenase type 2 activity and expression in human placental trophoblast cells Am J Physiol Endocrinol Metab, January 1, 2006; 290(1): E135 - E142. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Quinkler, D. Zehnder, J. Lepenies, M. D Petrelli, J. S Moore, S. V Hughes, P. Cockwell, M. Hewison, and P. M Stewart Expression of renal 11{beta}-hydroxysteroid dehydrogenase type 2 is decreased in patients with impaired renal function Eur. J. Endocrinol., August 1, 2005; 153(2): 291 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Julan, H. Guan, J. P. van Beek, and K. Yang Peroxisome Proliferator-Activated Receptor {delta} Suppresses 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Gene Expression in Human Placental Trophoblast Cells Endocrinology, March 1, 2005; 146(3): 1482 - 1490. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Y. Zhang, X. Ding, and R. A. Daynes The Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type I by Lymphocytes Provides a Novel Means for Intracrine Regulation of Glucocorticoid Activities J. Immunol., January 15, 2005; 174(2): 879 - 889. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. van Beek, H. Guan, L. Julan, and K. Yang Glucocorticoids Stimulate the Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 2 in Cultured Human Placental Trophoblast Cells J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5614 - 5621. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kajantie, T. Hytinantti, P. Hovi, and S. Andersson Cord Plasma Adiponectin: A 20-Fold Rise between 24 Weeks Gestation and Term J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4031 - 4036. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Tomlinson, J. S. Moore, P. M. S. Clark, G. Holder, L. Shakespeare, and P. M. Stewart Weight Loss Increases 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Expression in Human Adipose Tissue J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2711 - 2716. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. McTernan, F. M. Fisher, G. Valsamakis, R. Chetty, A. Harte, C. L. McTernan, P. M. S. Clark, S. A. Smith, A. H. Barnett, and S. Kumar Resistin and Type 2 Diabetes: Regulation of Resistin Expression by Insulin and Rosiglitazone and the Effects of Recombinant Resistin on Lipid and Glucose Metabolism in Human Differentiated Adipocytes J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6098 - 6106. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.M. Driver, S. Rauz, E.A. Walker, M. Hewison, M.D. Kilby, and P.M. Stewart Characterization of human trophoblast as a mineralocorticoid target tissue Mol. Hum. Reprod., December 1, 2003; 9(12): 793 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chan, S. Kachilele, E. Hobbs, J. N. Bulmer, K. Boelaert, C. J. McCabe, P. M. Driver, A. R. Bradwell, M. Kester, T. J. Visser, et al. Placental Iodothyronine Deiodinase Expression in Normal and Growth-Restricted Human Pregnancies J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4488 - 4495. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Wilcoxon, J. Schwartz, F. Aird, and E. E. Redei Sexually dimorphic effects of maternal alcohol intake and adrenalectomy on left ventricular hypertrophy in rat offspring Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E31 - E39. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Quinkler and P. M. Stewart Hypertension and the Cortisol-Cortisone Shuttle J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2384 - 2392. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Kajantie, L. Dunkel, U. Turpeinen, U.-H. Stenman, P. J. Wood, M. Nuutila, and S. Andersson Placental 11{beta}-Hydroxysteroid Dehydrogenase-2 and Fetal Cortisol/Cortisone Shuttle in Small Preterm Infants J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 493 - 500. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Tomlinson, B. Sinha, I. Bujalska, M. Hewison, and P. M. Stewart Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 in Adipose Tissue Is Not Increased in Human Obesity J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5630 - 5635. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Thompson, V.K.M. Han, and K. Yang Spatial and Temporal Patterns of Expression of 11{beta}-Hydroxysteroid Dehydrogenase Types 1 and 2 Messenger RNA and Glucocorticoid Receptor Protein in the Murine Placenta and Uterus During Late Pregnancy Biol Reprod, December 1, 2002; 67(6): 1708 - 1718. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Hardy and K. Yang The Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Is Induced during Trophoblast Differentiation: Effects of Hypoxia J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3696 - 3701. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zehnder, K. N. Evans, M. D. Kilby, J. N. Bulmer, B. A. Innes, P. M. Stewart, and M. Hewison The Ontogeny of 25-Hydroxyvitamin D3 1{alpha}-Hydroxylase Expression in Human Placenta and Decidua Am. J. Pathol., July 1, 2002; 161(1): 105 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. E. Murphy, T. Zakar, R. Smith, W. B. Giles, P. G. Gibson, and V. L. Clifton Reduced 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Activity Is Associated with Decreased Birth Weight Centile in Pregnancies Complicated by Asthma J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1660 - 1668. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |