help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McTernan, C. L.
Right arrow Articles by Stewart, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McTernan, C. L.
Right arrow Articles by Stewart, P. M.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 10 4979-4983
Copyright © 2001 by The Endocrine Society


Other Original Articles

Reduced Placental 11ß-Hydroxysteroid Dehydrogenase Type 2 mRNA Levels in Human Pregnancies Complicated by Intrauterine Growth Restriction: An Analysis of Possible Mechanisms

C. L. McTernan, N. Draper, H. Nicholson, S. M. Chalder, P. Driver, M. Hewison, M. D. Kilby and P. M. Stewart

Division of Medical Sciences (C.L.M., N.D., H.N., S.M.C., P.D., M.H., P.M.S.), Queen Elizabeth Hospital, and Division of Child and Reproductive Health (M.D.K.), Birmingham Women’s Hospital, University of Birmingham, Edgbaston, Birmingham, United Kingdom B15 2TH

Address all correspondence and requests for reprints to: Prof. Paul M. Stewart, M.D., F.R.C.P., FmedSci, Division of Medical Sciences, University of Birmingham, Queen Elizabeth Hospital, Edgbaston, Birmingham, United Kingdom B15 2TH. E-mail p.m.stewart{at}bham.ac.uk

Abstract

11ß-Hydroxysteroid dehydrogenase type 2 (11ß-HSD2) inactivates cortisol to cortisone. In the placenta 11ß-HSD2 activity is thought to protect the fetus from the deleterious effects of maternal glucocorticoids. Patients with apparent mineralocorticoid excess owing to mutations in the 11ß-HSD2 gene invariably have reduced birth weight, and we have recently shown reduced placental 11ß-HSD2 activity in pregnancies complicated by intrauterine growth restriction. This is reflected in the literature by evidence of hypercortisolemia in the fetal circulation of small babies. In this study we have determined the levels of placental 11ß-HSD2 mRNA expression across normal gestation (n = 86 placentae) and in pregnancies complicated by intrauterine growth restriction (n = 19) and evaluated the underlying mechanism for any aberrant 11ß-HSD2 mRNA expression in intrauterine growth restriction. 11ß-HSD2 mRNA expression increased more than 50-fold across gestation, peaking at term. Placental 11ß-HSD2 mRNA levels were significantly decreased in intrauterine growth restriction pregnancies when compared with gestationally matched, appropriately grown placentae [e.g. at term {Delta}Ct (11ß-hydroxysteroid dehydrogenase type 2/18S) 12.8 ± 0.8 (mean ± SE) vs. 10.2 ± 0.2, respectively, P < 0.001]. These differences were not attributable to changes in trophoblast mass in intrauterine growth restriction placentae, as assessed by parallel analyses of cytokeratin-8 mRNA expression. No mutations were found in the 11ß-HSD2 gene in the intrauterine growth restriction cohort, and imprinting analysis revealed that the 11ß-HSD2 gene was not imprinted. Although the underlying cause is unknown, 11ß-HSD2 gene expression is reduced in intrauterine growth restriction pregnancies. These data highlight the important role of 11ß-HSD2 in regulating fetal growth, a known factor in determining fetal morbidity but also the subsequent development of cardiovascular disease in adulthood.

FETAL GROWTH RESTRICTION is an important cause of perinatal morbidity and mortality (1) but, through as yet ill-defined "programming" mechanisms, has also been linked to the development of prevalent adult diseases including hypertension, diabetes, and coronary artery disease (2). The endocrine control of fetal growth, therefore, seems likely to have a major impact on both neonatal and adult well-being. Glucocorticoid excess in utero has been shown to impair fetal growth in rodents (3) and man (4). It is also of note that in both animal models (5) and human pregnancies (6, 7), small-for-gestational-age babies appear to have elevated cortisol levels. A key factor in determining glucocorticoid hormone action is the "prereceptor" role played by two distinct isozymes of 11ß-hydroxysteroid dehydrogenase (11ß-HSD) that interconvert hormonally active cortisol to inactive cortisone (8, 9). 11ß-HSD1 is a low-affinity, nicotinamide adenine dinucleotide phosphate-dependent dehydrogenase/11-oxo-reductase (10, 11), which is expressed in the maternal decidua but is low or absent in human fetal tissues including trophoblast (12). 11ß-HSD2 is a high-affinity nicotinamide adenine dinucleotide-dependent dehydrogenase (13) that is principally expressed in the kidney and colon (12, 14) where it serves to protect the MR from cortisol excess, enabling aldosterone to interact with the MR (8, 9). In addition, the enzyme is widely distributed in human fetal tissues (12), including the placental trophoblast where it is expressed in particularly high abundance (15, 16, 17, 18, 19, 20). Unlike the kidney, however, the precise role of placental 11ß-HSD2 is unknown; the placenta is not an obvious mineralocorticoid target tissue and it seems likely that the enzyme may modulate cortisol exposure to the GR rather than the MR (21). Specifically in the placenta, the concept has emerged that 11ß-HSD2 inactivates the much higher maternal cortisol concentrations across gestation, thereby facilitating fetal growth (22). In support of this, significant correlations between birth weight and placental 11ß-HSD2 activity have been reported in some human studies (18) but not others (19).

Furthermore, patients with mutations in the HSD11B2 gene, located on human chromosome 16, present with a severe form of mineralocorticoid hypertension [the syndrome of apparent mineralocorticoid excess (AME)] (8) but, in addition, have impaired fetal growth with low birth weight (23). Genetic studies have documented the association between intrauterine growth restriction (IUGR) and confined placental mosaicism, and chromosome 16 has been shown to be involved. Furthermore, trisomy 16 is the most common trisomy associated with both miscarriage (10% of trisomies found) and IUGR (24). In recent studies we have reported reduced placental 11ß-HSD2 activity in pregnancies complicated by severe IUGR (25). The aim of this study was to further examine the role of placental 11ß-HSD2 across normal gestation and in pregnancies complicated by IUGR. Having documented reduced placental 11ß-HSD2 mRNA levels in IUGR, we also explored the underlying basis for this by screening the HSD11B2 gene for any disease-causing mutations similar to those seen in AME and determined the imprinting status of the gene in IUGR placentae.

Materials and Methods

Samples

The study had the approval of the local hospital ethics committee. Placental samples were collected from either termination tissues (in accordance with the Polkinghorne report) or elective cesarean sections. A total of 86 placental samples were collected and grouped as follows: early first trimester (6–8 wk gestation, n = 19), late first trimester (9–12 wk gestation, n = 16), second trimester (13–17 wk gestation, n = 6), early third trimester (27–34 wk gestation, n = 4), and term (n = 22). Nineteen cases of IUGR were diagnosed prospectively, having at least three of the four following characteristics determined from ultrasound examination: 1) ultrasound measurement of fetal abdominal circumference less than or equal to the third percentile for gestational age, 2) abnormal fetal growth velocity ({Delta}abdominal circumference <1.5 SD over 14 d), 3) severe oligohydramnios (amniotic fluid index less than or equal to the third percentile for gestational age), 4) absent or reversed velocities in umbilical artery Doppler waveforms. The IUGR group was divided into early and late gestation groups, 15 patients being 25–32 wk gestation and 4 patients 37–38 wk gestation.

In each case, placental samples were obtained by dissecting the placental tissue off the chorionic plate. No membrane was left adherent to the placental samples that were snap frozen in liquid nitrogen and stored at -80 C until analysis.

RNA extraction

RNA was extracted from placentae using the StrataPrep total RNA miniprep kit (Stratagene, Amsterdam, The Netherlands), which included a DNase digestion step to remove any contaminating genomic DNA. One microgram of RNA from each sample was reverse transcribed using AMV reverse transcriptase (Promega Corp., Southampton, UK) and random hexamers in 20-µl reaction volumes according to the manufacturer’s instructions.

Quantitative PCR

11ß-HSD2 mRNA levels were analyzed using an ABI 7700 sequence detection system, which employs TaqMan chemistry for highly accurate quantification of mRNA levels. Briefly, a fluorogenic TaqMan probe consists of an oligonucleotide with a 5' reporter and a 3' quencher dye. Fluorescent quenching of the reporter dye depends on the spatial proximity of its quencher. PCR amplification releases the reporter into solution, away from its quencher, yielding a signal that is read by a laser and CCD camera. One such event occurs for each PCR product generated, enabling real-time detection of cDNA amplification.

RT-PCR was performed in 25-µl volumes on 96-well plates, in reaction buffer containing TaqMan universal PCR master mix, 3 mM Mn(Oac)2, 200 µM dNTPs, 1.25 U AmpliTaq Gold polymerase, 1.25 U AmpErase UNG, 100–200 nmol TaqMan probe, 900-nmol primers and 25–50 ng cDNA. All reactions were multiplexed with the housekeeping gene 18S, provided as a preoptimized control probe (PE Biosystems, Warrington, UK) enabling data to be expressed in relation to an internal reference to allow for differences in reverse transcription efficiency. Data were obtained as Ct values according to the manufacturer’s guidelines (the cycle number at which logarithmic PCR plots cross a calculated threshold line) and used to determine {Delta}Ct values ({Delta}Ct = Ct of the target gene minus Ct of the housekeeping gene). Measurements were carried out on at least three occasions for each sample. All target gene probes were labeled with the fluorescent label FAM, and the housekeeping gene with the fluorescent label VIC. Reactions were as follows: 50 C for 2 min, 95 C for 10 min, and then 44 cycles of 95 C for 15 sec and 60 C for 1 min.

As a further control, RT-PCR was performed on all the placental samples to determine the levels of cytokeratin-8 mRNA expression, a trophoblast epithelial marker (26).

Quantitative primer and probe sequences for 11ß-HSD2 were forward primer GGGCCTATGGAACCTCCAA, reverse primer GACCCACGTTTCTCACTGACTCT, and TaqMan probe CCGTGGCGCTACTCATGGACACA and for cytokeratin-8 were forward primer ATGTGGATGAAGCATACATGAACA, reverse primer TCCCGGATCTCCTCTTCATACA, and TaqMan probe CCGACGAGATCAACTTCCTCAGGCA.

To exclude potential bias owing to averaging data that had been transformed through the equation 2-{Delta}{Delta}Ct, all statistics were performed at the {Delta}Ct stage. Statistical analysis of comparisons among groups was undertaken using an unpaired t test.

DNA extraction and 11ß-HSD2 gene studies

DNA was extracted from IUGR and normal term placentae using the Nucleon Bacc II DNA extraction kit (Tepnel Life Sciences, Manchester, UK) according to the manufacturer’s instructions. PCR primers were designed for each of the five exons and the promoter of 11ß-HSD2 as previously reported by our group (27). PCR was performed on DNA from 10 IUGR placentae using 200 ng DNA, 25-pmol primers, and 2.5 U Taq polymerase (Promega Corp.) according to standard procedures. The cycling conditions were 94 C for 5 min for one cycle, 94 C for 20 sec, 55–60 C for 20 sec, and 72 C for 20–30 sec for 30–32 cycles depending on the region being amplified. The amplicons were electrophoresed on agarose gels and then purified using the Qiaex II gel purification kit (QIAGEN, Crawley, UK). Amplicons were sequenced using BigDye terminator sequencing chemistry (PE Biosystems) and sequences analyzed and compared with both GenBank data (accession numbers U27317 and U27318) and our previous sequencing results.

Imprinting analyses used two single nucleotide polymorphisms (SNPs) present in exon 3 of the 11ß-HSD2 gene at codon positions 178 (GAG to GAA) (28) and 196 (GCG to GCA) (29). Exon 3 was amplified from DNA of 22 term placentae and the amplicons electrophoresed, gel purified, and sequenced as detailed previously. RNA was extracted from three placentae that were heterozygous for the SNPs; 1 µg of RNA from each sample was reverse transcribed, and exon 3 was amplified using a primer spanning the exon 3–4 boundary (5'ATATGGCATGTCCCCCGCTG3') and an exon 2 primer. This in conjunction with the DNase treatment of the RNA excludes the possibility of genomic DNA contamination in the PCR.

Results

mRNA expression studies

Normal gestation. Relative fold increases in 11ß-HSD2 mRNA expression across gestation were calculated using the early first trimester group as a reference (arbitrary value of 1). The 11ß-HSD2 mRNA expression was similar in the late first and second trimester groups (relative fold increase: late first trimester 0.65; second trimester 0.48) as it was in the early first trimester group. There was, however, a 12-fold ({Delta}Ct 12.46, 2-{Delta}{Delta}Ct 11.98) increase in 11ß-HSD2 mRNA expression at gestational wk 27–34, and a 56-fold ({Delta}Ct 10.24, 2-{Delta}{Delta}Ct 55.7) increase at term when compared with early first trimester (Fig. 1Go).



View larger version (9K):
[in this window]
[in a new window]
 
Figure 1. The relative fold increase in 11ß-HSD2:18S (black) and cytokeratin 8:18S (white) mRNA expression, across gestation and in IUGR-complicated placentae. Statistically significant differences were observed between the early third trimester and early IUGR placentae (P = 0.04) and between the term and late IUGR placentae (P < 0.001).

 
IUGR. The 11ß-HSD2 mRNA levels were significantly reduced in placentae from IUGR pregnancies. When analyzed as a whole group, the IUGR placentae demonstrated only a 4-fold increase in 11ß-HSD2 mRNA expression, compared with early first trimester (a 12- to 56-fold increase in normal placentae was observed). When the IUGR cohort was analyzed on the basis of gestational age, the early subgroup (25–32 wk) had reduced 11ß-HSD2 mRNA levels, compared with gestational-matched normally grown placentae (early third trimester group) [{Delta}Ct 14.2 ± 0.9 vs. 11.3 ± 1.0 (mean ± SE), respectively, P = 0.04]. The later IUGR subgroup (37–38 wk) also had reduced 11ß-HSD2 mRNA levels, compared with term placentae ({Delta}Ct, 12.8 ± 0.8 vs. 10.2 ± 0.2, P < 0.001) (Fig. 1Go).

There were no significant differences in the levels of cytokeratin-8 mRNA across gestation (early first trimester {Delta}Ct 12.66 ± 0.44; second trimester {Delta}Ct 12.47 ± 0.31; term {Delta}Ct 13.04 ± 0.42) or, importantly, in the IUGR subgroup (25–32 wk, {Delta}Ct 13.54 ± 0.69; 37–38 wk, {Delta}Ct 14.55 ± 0.21), indicating that the reduction in 11ß-HSD2 mRNA levels could not be explained by changes in the amount of trophoblast tissue (Fig. 1Go).

11ß-HSD2 gene studies

All five exons and the promoter region (-860 bp) of the 11ß-HSD2 gene were amplified and sequenced in 10 placentae from pregnancies complicated with IUGR. No mutations were identified.

The two SNPs in exon 3 of 11ß-HSD2, positions 178 (GAG to GAA) and 196 (GCG to GCA), were examined in 22 term placentae. Three of the placentae were informative at one of these loci, and cDNA was prepared from them and sequenced to determine which allele was being expressed. Both alleles of the SNP were present in all three placentae (Fig. 2Go), indicating that the parental allele was not silenced suggesting that 11ß-HSD2 is not an imprinted gene.



View larger version (36K):
[in this window]
[in a new window]
 
Figure 2. Imprinting analysis of term placentae. A, Sequence of DNA from exon 3 11ß-HSD2 shown in the forward orientation. SNP at position 178 is indicated by an arrow, with both A and G present at the same position. B, Sequence of cDNA from exon 3 11ß-HSD2 shown in the reverse orientation. SNP at position 178 is indicated by an arrow, with both C and T present at the same position.

 
Discussion

Across normal human pregnancy, levels of 11ß-HSD2 mRNA expression were similar in the first and second trimester groups but thereafter significantly increased in the early third trimester (12-fold) to term (56-fold increase). These data support earlier placental enzyme activity analysis carried out in a separate pregnancy cohort (25) and indicate that the exponential increase in placental 11ß-HSD2 expression as term progresses is mediated at the transcriptional level. In the baboon placenta, E increases 11ß-HSD2 enzyme expression (30) (as it does in the rodent kidney), and the rising E levels that occur across pregnancy may account for the changes in 11ß-HSD2 gene expression. Conversely, at least in late gestation, progesterone levels fall and in vitro studies have shown that progesterone inhibits 11ß-HSD2 enzyme activity (31). Other factors within the placenta may mediate these striking changes in 11ß-HSD2 expression. Thus, although the 11ß-HSD2 protein is identical in adult and fetal tissues (32), the use of alternate transcriptional start sites results in placental 11ß-HSD2 (as determined in the human choriocarcinoma cell, JEG-3 cells) but not adult kidney 11ß-HSD2 being regulated by cAMP and its analogs (33, 34, 35). Additionally, nitric oxide inhibits 11ß-HSD2 activity and mRNA levels in cultured human term trophoblast cells (34).

Placental 11ß-HSD2 activity studies together with selective sampling of the placental vascular beds indicate the immense capacity of the placenta to inactivate cortisol to cortisone (18, 19, 25, 36). Despite this impressive activity, the definitive role of placental 11ß-HSD2 remains unknown. Studies in the baboon, supported by data in humans, suggest that the placental inactivation of cortisol facilitates the development and "awakening" of the fetal hypothalamopituitary-adrenal axis. Thus, the removal of the suppressive influence of cortisol (be it maternal or fetal in origin) is the stimulus to activate fetal hypothalamic corticotrophin-releasing factor and pituitary POMC synthesis and secretion (30, 37). Alternatively, it has been suggested that placental 11ß-HSD2 may serve as a barrier, protecting the developing fetus from the possible deleterious effects of maternally derived glucocorticoids (3, 36). Evidence from rodent, primate, and human studies support the notion that glucocorticoid excess in utero impairs fetal growth (3, 4), thereby providing a potential mechanism to explain the Barker hypothesis—the inverse correlation between birth weight and prevalence of adult hypertension, diabetes, and coronary artery disease (2). Placental 11ß-HSD2 expression may, in turn, be crucial to this process. Thus, patients with AME owing to mutations in the 11ß-HSD2 gene invariably have reduced birth weight (23), and correlations between placental 11ß-HSD2 activity and birth weight have been reported across normal pregnancies in some (18) but not all (19) studies.

Several rodent studies have attempted to address this issue, and the adverse programming of insulin sensitivity and blood pressure has been documented in adult rats following maternal treatment with carbenoxolone, an 11ß-HSD2 inhibitor (38). However, recombinant mice lacking the 11ß-HSD2 gene are of normal birth weight (39); similarly, we were unable to alter birth weight in the mouse by inhibiting fetal 11ß-HSD2 expression across gestation (40). However, the ontogeny of 11ß-HSD2 in the rodent is notably different from that reported here across human pregnancy; in both rats and mice, 11ß-HSD2 gene transcription is effectively silenced in mid- and late gestation in fetal tissues including the placenta in contrast to the exponential increase observed in man (41, 42). The applicability of rodent models in this setting, therefore, is highly questionable.

In placentae from IUGR-complicated pregnancies, 11ß-HSD2 mRNA levels were significantly reduced when compared with term and gestationally matched, appropriately grown pregnancies. Importantly, this could not be attributed to obvious changes in trophoblast mass between IUGR and normal placentae in view of the similar amounts of the trophoblast marker, cytokeratin-8, present in each group of samples. Previous data from our group have noted that 11ß-HSD2 is the predominant isoform expressed in trophoblast tissue (12). However, other groups have noted the expression of 11ß-HSD1 on "intermediate villi and endothelial cells on the fetal vasculature" (20). Our own data from cultured primary cytotrophoblast cells, although confirming the type 2 isoform as the predominantly expressed 11ß-HSD2 in trophoblast, have noted low levels of mRNA encoding 11ß-HSD1 in these cultured cells (43). It is possible, therefore, that maintenance of some 11ß-HSD1 activity and attenuated 11ß-HSD2 would account for elevated fetal cortisol concentrations seen in IUGR pregnancies. These data support our earlier posttranscriptional (activity) studies performed on a separate cohort of patients with IUGR (25) and provide impressive, circumstantial evidence for a role of 11ß-HSD2 in regulating fetal growth. Whether this is mediated by glucocorticoid excess in utero remains to be proven; it should be noted that the expression of 11ß-HSD2 is widespread in many fetal tissues in addition to trophoblast, suggesting that developing fetal tissues can protect themselves in an autocrine fashion (12, 21). An alternative hypothesis, therefore, is that 11ß-HSD2 is directly involved in the placentation process itself.

The explanation for the reduction in placental 11ß-HSD2 gene expression in IUGR remains unknown. We have not identified any mutations in the 11ß-HSD2 gene from DNA extracted from IUGR placentae. Several cases of IUGR have been reported in association with confined placental mosaicism. In particular, a high incidence of maternal uniparental disomy for chromosome 16 (the chromosomal localization of the 11ß-HSD2 gene) has been found in confined placental mosaics of IUGR placentae (24). Imprinting of a gene on chromosome 16 therefore could result in distorted expression of that gene product. For example, if 11ß-HSD2 was an imprinted gene and expressed only on the paternal chromosome, maternal uniparental disomy for chromosome 16 would lead to zero expression of 11ß-HSD2; if this occurred in a confined placental mosaic, it would lead to areas of the placenta without 11ß-HSD2 activity. Additionally, it is established that a mechanism used in imprinting is methylation. Methylation of CpG sites within GC-rich promoters can effectively, and heritably, lock genes in the off condition (44). Both the promoter region and exon 1 of the 11ß-HSD2 gene are extremely GC rich and therefore a candidate for gene silencing by imprinting. However, by evaluating informative encoding polymorphisms within the 11ß-HSD2 gene, we can conclude that the gene is not imprinted and therefore any uniparental expression of 11ß-HSD2 would not result in varying levels of enzyme expression. It is still possible that methylation may result in epigenetic silencing of 11ß-HSD2 in IUGR placentae, and this needs further evaluation.

In summary, we have demonstrated that placental 11ß-HSD2 gene expression increases across normal human gestation but is significantly decreased in pregnancies complicated by IUGR. The cause of the reduction in mRNA expression cannot be explained on the basis of mutations in the 11ß-HSD2 gene or this gene being imprinted. This study supports the concept that placental 11ß-HSD2 plays a crucial role in regulating fetal growth across human pregnancy. Defects in expression of the enzyme in fetal life may have considerable ramifications for both neonatal and adult well-being.

Acknowledgments

Footnotes

This work was supported by Action Research and the MRC (UK). H.N. was Wellcome Trust summer student. P.M.S. is an MRC Senior Clinical Fellow.

Abbreviations: AME, Apparent mineralocorticoid excess; 11ß-HSD, 11ß-hydroxysteroid dehydrogenase; IUGR, intrauterine growth restriction; SNP, single nucleotide polymorphism.

Received March 27, 2001.

Accepted June 15, 2001.

References

  1. CESDI 1996 Perinatal and neonatal deaths in the West Midlands: 1991–1994. HMSO
  2. Barker DJP 1996 The fetal origins of hypertension. J Hypertens 14S:117–120
  3. Benediktsson R, Lindsay RS, Noble J, Seckl JR, Edwards CRW 1993 Glucocorticoid exposure in utero: new model for adult hypertension. Lancet 34l:339–341
  4. Reinisch JM, Simon NG, Karow WG, Gandelman R 1978 Prenatal exposure to prednisone in humans and animals retards intrauterine growth. Science 202:436–438[Abstract/Free Full Text]
  5. Phillips ID, Simonetta G, Owens JA, Robinson JS, Clarke IJ, McMillen IC 1996 Placental restriction alters the functional development of the pituitary-adrenal axis in the sheep fetus during late gestation. Pediatr Res 40:861–866[Medline]
  6. Economides DL, Nicolaides KH, Campbell S Metabolic and endocrine findings in appropriate and small for gestation age fetuses. J Perinatal Med 19:97–105
  7. Parker CR, Buchina ES, Barefoot TK 1994 Abnormal adrenal steroidogenesis in growth retarded newborn infants. Pediatr Res 35:633–636[Medline]
  8. White PC, Mune T, Agarwal AK 1997 11ß-hydroxysteroid dehydrogenase and the syndrome of apparent mineralocorticoid excess. Endocr Rev 18:135–156[Abstract/Free Full Text]
  9. Stewart PM, Krozowski ZS 1999 11 ß-hydroxysteroid dehydrogenase. Vitam Horm 57:249–324[Medline]
  10. Tannin GM, Agarwal AK, Monder C, New MI, White PC 1991 The human gene for 11 ß-hydroxysteroid dehydrogenase. Structure, tissue distribution, and chromosomal localization. J Biol Chem 266:16653–16658[Abstract/Free Full Text]
  11. Stewart PM, Murry BA, Mason JI 1994 Human kidney 11ß-hydroxysteroid dehydrogenase is a high affinity NAD+-dependent enzyme and differs from the cloned "type I" isoform. J Clin Endocrinol Metab 79:480–484[Abstract]
  12. Stewart PM, Murry BA, Mason JI 1994 Type 2 11ß-hydroxysteroid dehydrogenase in human fetal tissues. J Clin Endocrinol Metab 78:1529–1532[Abstract]
  13. Albiston AL, Obeyesekere VR, Smith RE, Krozowski ZS 1994 Cloning and tissue distribution of the human 11ß-hydroxysteroid dehydrogenase type 2 enzyme. Mol Cell Endocrinol 105:R11–R17
  14. Whorwood CB, Mason JI, Ricketts ML, Howie AJ, Stewart PM 1995 Detection of human 11ß-hydroxysteroid dehydrogenase isoforms using reverse transcriptase-polymerase chain reaction and localization of the type 2 isoform to renal collecting ducts. Mol Cell Endocrinol 110:R7–R12
  15. Lopez Bernal A, Flint APF, Anderson ABM, Turnbull AC 1980 11ß-hydroxysteroid dehydrogenase activity (E.C.1.1.1.146) in human placenta and decidua. J Ster Biochem 13:1081–1087[CrossRef][Medline]
  16. Blasco MJ, Lopez Bernal A, Turnball AC 1986 11ß-hydroxysteroid dehydrogenase activity of the human placenta during pregnancy. Horm Metab Res 18:638–641
  17. Brown RW, Chapman KE, Edwards CRW, Seckl JR 1993 Human placental 11ß-hydroxysteroid dehydrogenase: evidence for and partial purification of a distinct NAD-dependent isoform. Endocrinology 132:2614–2621[Abstract/Free Full Text]
  18. Stewart PM, Rogerson F, Mason JI 1995 Type 2 11ß-hydroxysteroid dehydrogenase in human placenta and fetal membranes: its relationship to birth weight and putative role in fetal adrenal steroidogenesis. J Clin Endocrinol Metab 80:885–890[Abstract]
  19. Rogerson FM, Kayes MK, White PC 1997 Variation in placental type 2 11ß-hydroxysteroid dehydrogenase activity is not related to birth or placental weight. Mol Cell Endocrinol 128:103–109[CrossRef][Medline]
  20. Sun K, Yang K, Challis JRG 1997 Differential expression of 11ß-hydroxysteroid dehydrogenase types 1 and 2 in human placenta and fetal membranes. J Clin Endocrinol Metab 82:300–305[Abstract/Free Full Text]
  21. Condon J, Gosden C, Gardener D, et al. 1998 Expression of Type 2 11 ßhydroxysteroid dehydrogenase and corticosteroid hormone receptors in early human fetal life. J Clin Endocrinol Metab 83:4490–4497[Abstract/Free Full Text]
  22. Edwards CR, Benediktsson R, Lindsay RS, Seckl JR 1993 Dysfunction of placental glucocorticoid barrier: link between fetal environment and adult hypertension? Lancet 341:355–357[CrossRef][Medline]
  23. Kitanaka S, Tanae A, Hibi I 1996 Apparent mineralocorticoid excess due to 11 ß-hydroxysteroid dehydrogenase deficiency: a possible cause of intrauterine growth retardation. Clin Endocrinol 44:353–359[CrossRef][Medline]
  24. Kalousek DK 1994 Current topic: confined placental mosaicism and intrauterine fetal development. Placenta 15:219–230[Medline]
  25. Shams M, Kilby MD, Somerset DA, et al. 1998 Ontogeny of placental 11ß-hydroxysteroid dehydrogenase type 2 in human pregnancy and reduced expression in intrauterine growth retardation. Hum Reprod 13:799–804[Abstract/Free Full Text]
  26. Yamamoto R, Kao L-C, McKnight CE, Strauss III JF 1990 Cloning and sequence of cDNA for human placental cytokeratin 8. Regulation of the mRNA in trophoblastic cells by cAMP. Mol Endocrinol 4:370–374[Abstract/Free Full Text]
  27. Stewart PM, Krozowski ZS, Gupta A, et al. 1996 Hypertension in the syndrome of apparent mineralocorticoid excess due to mutation of the 11ßhydroxysteroid dehydrogenase type 2 gene. Lancet 347:88–91[CrossRef][Medline]
  28. Smolenicka Z, Bach E, Schaer A, Liechti-Gallati S, Frey FJ, Ferrari P 1998 A new polymorphic restriction site in the human 11 ß-hydroxysteroid dehydrogenase type 2 gene. J Clin Endocrinol Metab 83:1814–1817[Abstract/Free Full Text]
  29. http://www.genome.cwru.edu/candidates/snps.html
  30. Baggia S, Albrecht ED, Pepe GJ 1990 Regulation of 11ß-hydroxysteroid dehydrogenase activity in the baboon placenta by estrogen. Endocrinology 126:2742–2748[Abstract/Free Full Text]
  31. Bujalska I, Shimojo M, Howie A, Stewart PM 1997 Human 11ß-hydroxysteroid dehydrogenase: studies on the stably transfected isoforms and localization of the type 2 isozyme within renal tissue. Steroids 77:77–82
  32. Brown RW, Chapman KE, Murad P, Edwards CRW, Seckl JR 1996 Purification of 11 ß-hydroxysteroid dehydrogenase type 2 from human placenta utilizing a novel affinity labelling technique. Biochem J 313:997–1005
  33. Pasquarette MM, Stewart PM, Ricketts ML, Imaishi K, Mason JI 1996 Regulation of 11ß-hydroxysteroid dehydrogenase type 2 activity and mRNA in human choriocarcinoma cells. J Mol Endocrinol 16:269–275[Abstract/Free Full Text]
  34. Sun K, Yang K, Challis JRG 1997 Differential regulation of 11ß-hydroxysteroid dehydrogenase types 1 and 2 by nitric oxide cultured human placental trophoblast and chorionic cell preparation. Endocrinology 138:4912–4920[Abstract/Free Full Text]
  35. Agarwal AK, White PC 1996 Analysis of the promoter of the NAD+ dependent 11 ß-hydroxysteroid dehydrogenase (HSD11K) gene in JEG-3 human choriocarcinoma cells. Mol Cell Endocrinol 121:93–99[CrossRef][Medline]
  36. Benediktsson R, Calder AA, Edwards CRW, Seckl JR 1997 Placental 11ß-hydroxysteroid dehydrogenase: a key regulator of fetal glucocorticoid exposure. Clin Endocrinol 46:161–166[CrossRef][Medline]
  37. Pepe GJ, Davies WA, Albrecht ED 1994 Activation of the baboon foetal pituitary-adrenocortical axis at midgestation by estrogen: enhancement of foetal pituitary proopiomelanocortin mRNA expression. Endocrinology 135:2581–2587[Abstract]
  38. Lindsay RM, Edwards CR, Seckl JR 1996 Inhibition of 11 ß hydroxysteroid dehydrogenase in pregnant rats and the programming of blood pressure in the offspring. Hypertension 27:1200–1204[Abstract/Free Full Text]
  39. Kotelevtsev Y, Brown R, Fleming S, et al. 1999 Hypertension in mice lacking 11ß-hydroxysteroid dehydrogenase type 2. J Clin Invest 103:683–689[Medline]
  40. Condon J, Bujalska I, Stewart PM 1997 Inhibition of maternal and fetal 11ß-hydroxysteroid dehydrogenase type 2 (11ßHSD2) across gestation does not alter birth or placental weight in the mouse. J Endocrinol 152S:P57
  41. Condon J, Ricketts ML, Whorwood CB, Stewart PM 1997 Ontogeny and sexual dimorphic expression of mouse type 2 11ßß-hydroxysteroid dehydrogenase. Mol Cell Endocrinol 127:121–128[CrossRef][Medline]
  42. Brown RW, Diaz R, Robson AC, et al. 1996 The ontogeny of 11 ß-hydroxysteroid dehydrogenase type 2 and mineralocorticoid receptor gene expression reveal intricate control of glucocorticoid action in development. Endocrinology 137:794–797[Abstract]
  43. Driver PM, Kilby MD, Bulalska I, Walker EA, Hewison M, Stewart PM 2001 Expression of 11ß-hydroxysteroid dehydrogenase isozyme and corticosteroid hormone receptors in primary cultures of human trophoblast and placental bed biopsies. Mol Hum Reprod 7:357–363[Abstract/Free Full Text]
  44. Gardiner-Garden M, Frommer M 1987 CpG islands in vertebrate genomes. J Mol Biol 196:261–282[CrossRef][Medline]



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
A. E. Michael and A. T. Papageorghiou
Potential significance of physiological and pharmacological glucocorticoids in early pregnancy
Hum. Reprod. Update, September 1, 2008; 14(5): 497 - 517.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. Chan, E. H Rabbitt, B. A Innes, J. N Bulmer, P. M Stewart, M. D Kilby, and M. Hewison
Glucocorticoid-induced apoptosis in human decidua: a novel role for 11{beta}-hydroxysteroid dehydrogenase in late gestation
J. Endocrinol., October 1, 2007; 195(1): 7 - 15.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. G. Atanasov, I. D. Ignatova, L. G. Nashev, B. Dick, P. Ferrari, F. J. Frey, and A. Odermatt
Impaired Protein Stability of 11beta-Hydroxysteroid Dehydrogenase Type 2: A Novel Mechanism of Apparent Mineralocorticoid Excess
J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1262 - 1270.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. L. Magnusson-Olsson, B. Hamark, A. Ericsson, M. Wennergren, T. Jansson, and T. L. Powell
Gestational and hormonal regulation of human placental lipoprotein lipase
J. Lipid Res., November 1, 2006; 47(11): 2551 - 2561.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. J. Mark and B. J. Waddell
P-Glycoprotein Restricts Access of Cortisol and Dexamethasone to the Glucocorticoid Receptor in Placental BeWo Cells
Endocrinology, November 1, 2006; 147(11): 5147 - 5152.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
V. E. Murphy, R. Smith, W. B. Giles, and V. L. Clifton
Endocrine Regulation of Human Fetal Growth: The Role of the Mother, Placenta, and Fetus
Endocr. Rev., April 1, 2006; 27(2): 141 - 169.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. Kapoor, E. Dunn, A. Kostaki, M. H. Andrews, and S. G. Matthews
Fetal programming of hypothalamo-pituitary-adrenal function: prenatal stress and glucocorticoids
J. Physiol., April 1, 2006; 572(1): 31 - 44.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
I. Kossintseva, S. Wong, E. Johnstone, L. Guilbert, D. M. Olson, and B. F. Mitchell
Proinflammatory cytokines inhibit human placental 11{beta}-hydroxysteroid dehydrogenase type 2 activity through Ca2+ and cAMP pathways
Am J Physiol Endocrinol Metab, February 1, 2006; 290(2): E282 - E288.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Yang, L. Julan, F. Rubio, A. Sharma, and H. Guan
Cadmium reduces 11{beta}-hydroxysteroid dehydrogenase type 2 activity and expression in human placental trophoblast cells
Am J Physiol Endocrinol Metab, January 1, 2006; 290(1): E135 - E142.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
M. Quinkler, D. Zehnder, J. Lepenies, M. D Petrelli, J. S Moore, S. V Hughes, P. Cockwell, M. Hewison, and P. M Stewart
Expression of renal 11{beta}-hydroxysteroid dehydrogenase type 2 is decreased in patients with impaired renal function
Eur. J. Endocrinol., August 1, 2005; 153(2): 291 - 299.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Julan, H. Guan, J. P. van Beek, and K. Yang
Peroxisome Proliferator-Activated Receptor {delta} Suppresses 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Gene Expression in Human Placental Trophoblast Cells
Endocrinology, March 1, 2005; 146(3): 1482 - 1490.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Y. Zhang, X. Ding, and R. A. Daynes
The Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type I by Lymphocytes Provides a Novel Means for Intracrine Regulation of Glucocorticoid Activities
J. Immunol., January 15, 2005; 174(2): 879 - 889.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. P. van Beek, H. Guan, L. Julan, and K. Yang
Glucocorticoids Stimulate the Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 2 in Cultured Human Placental Trophoblast Cells
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5614 - 5621.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Kajantie, T. Hytinantti, P. Hovi, and S. Andersson
Cord Plasma Adiponectin: A 20-Fold Rise between 24 Weeks Gestation and Term
J. Clin. Endocrinol. Metab., August 1, 2004; 89(8): 4031 - 4036.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. W. Tomlinson, J. S. Moore, P. M. S. Clark, G. Holder, L. Shakespeare, and P. M. Stewart
Weight Loss Increases 11{beta}-Hydroxysteroid Dehydrogenase Type 1 Expression in Human Adipose Tissue
J. Clin. Endocrinol. Metab., June 1, 2004; 89(6): 2711 - 2716.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. G. McTernan, F. M. Fisher, G. Valsamakis, R. Chetty, A. Harte, C. L. McTernan, P. M. S. Clark, S. A. Smith, A. H. Barnett, and S. Kumar
Resistin and Type 2 Diabetes: Regulation of Resistin Expression by Insulin and Rosiglitazone and the Effects of Recombinant Resistin on Lipid and Glucose Metabolism in Human Differentiated Adipocytes
J. Clin. Endocrinol. Metab., December 1, 2003; 88(12): 6098 - 6106.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
P.M. Driver, S. Rauz, E.A. Walker, M. Hewison, M.D. Kilby, and P.M. Stewart
Characterization of human trophoblast as a mineralocorticoid target tissue
Mol. Hum. Reprod., December 1, 2003; 9(12): 793 - 798.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Chan, S. Kachilele, E. Hobbs, J. N. Bulmer, K. Boelaert, C. J. McCabe, P. M. Driver, A. R. Bradwell, M. Kester, T. J. Visser, et al.
Placental Iodothyronine Deiodinase Expression in Normal and Growth-Restricted Human Pregnancies
J. Clin. Endocrinol. Metab., September 1, 2003; 88(9): 4488 - 4495.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. S. Wilcoxon, J. Schwartz, F. Aird, and E. E. Redei
Sexually dimorphic effects of maternal alcohol intake and adrenalectomy on left ventricular hypertrophy in rat offspring
Am J Physiol Endocrinol Metab, July 1, 2003; 285(1): E31 - E39.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Quinkler and P. M. Stewart
Hypertension and the Cortisol-Cortisone Shuttle
J. Clin. Endocrinol. Metab., June 1, 2003; 88(6): 2384 - 2392.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
E. Kajantie, L. Dunkel, U. Turpeinen, U.-H. Stenman, P. J. Wood, M. Nuutila, and S. Andersson
Placental 11{beta}-Hydroxysteroid Dehydrogenase-2 and Fetal Cortisol/Cortisone Shuttle in Small Preterm Infants
J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 493 - 500.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. W. Tomlinson, B. Sinha, I. Bujalska, M. Hewison, and P. M. Stewart
Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 1 in Adipose Tissue Is Not Increased in Human Obesity
J. Clin. Endocrinol. Metab., December 1, 2002; 87(12): 5630 - 5635.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
A. Thompson, V.K.M. Han, and K. Yang
Spatial and Temporal Patterns of Expression of 11{beta}-Hydroxysteroid Dehydrogenase Types 1 and 2 Messenger RNA and Glucocorticoid Receptor Protein in the Murine Placenta and Uterus During Late Pregnancy
Biol Reprod, December 1, 2002; 67(6): 1708 - 1718.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. B. Hardy and K. Yang
The Expression of 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Is Induced during Trophoblast Differentiation: Effects of Hypoxia
J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3696 - 3701.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Zehnder, K. N. Evans, M. D. Kilby, J. N. Bulmer, B. A. Innes, P. M. Stewart, and M. Hewison
The Ontogeny of 25-Hydroxyvitamin D3 1{alpha}-Hydroxylase Expression in Human Placenta and Decidua
Am. J. Pathol., July 1, 2002; 161(1): 105 - 114.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. E. Murphy, T. Zakar, R. Smith, W. B. Giles, P. G. Gibson, and V. L. Clifton
Reduced 11{beta}-Hydroxysteroid Dehydrogenase Type 2 Activity Is Associated with Decreased Birth Weight Centile in Pregnancies Complicated by Asthma
J. Clin. Endocrinol. Metab., April 1, 2002; 87(4): 1660 - 1668.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McTernan, C. L.
Right arrow Articles by Stewart, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McTernan, C. L.
Right arrow Articles by Stewart, P. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals