| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Other Original Articles |
Departments of Endocrinology (C.E.F., M.P., L.M.), Cardiology (J.J.), and Internal Medicine (J.M.), Faculty of Medicine, Catholic University of Chile, and Division of Endocrinology, G. V. (Sonny) Montgomery Veterans Affairs Medical Center and the University of Mississippi Medical Center (C.G.-S.), Jackson, Mississippi 39216
Address all correspondence and requests for reprints to: Carlos E. Fardella., Dept. of Endocrinology, Faculty of Medicine, P. Universidad Católica de Chile, Marcoleta 391, Santiago, Chile. E-mail: cfardella{at}med.puc.cl
Abstract
Glucocorticoid-remediable aldosteronism is an inherited disorder caused by a chimeric gene duplication between the CYP11B1 (11ß-hydroxylase) and CYP11B2 (aldosterone synthase) genes. The disorder is characterized by hyperaldosteronism and high levels of 18-hydroxycortisol and 18-oxocortisol, which are under ACTH control. The diagnosis of glucocorticoid-remediable aldosteronism had been traditionally made using the dexamethasone suppression test; however, recent studies have shown that several patients with primary aldosteronism and a positive dexamethasone suppression test do not have the chimeric CYP11B1/CYP11B2 gene. The aim of this work was to evaluate whether other genetic alterations exist in CYP11B genes (gene conversion in the coding region of CYP11B1 or in the promoter of CYP11B2) that could explain a positive dexamethasone suppression test and to determine another genetic cause of glucocorticoid-remediable aldosteronism. We also evaluated the role of 18-hydroxycortisol as a specific biochemical marker of glucocorticoid-remediable aldosteronism. We studied eight patients with idiopathic hyperaldosteronism, a positive dexamethasone suppression test, and a negative genetic test for the chimeric gene. In all patients we amplified the CYP11B1 gene by PCR and sequenced exons 39 of CYP11B1 and a specific region (-138 to -284) of CYP11B2 promoter. We also measured the levels of 18-hydroxycortisol, and we compared the results with those found in four subjects with the chimeric gene. None of eight cases showed abnormalities in exons 39 of CYP11B1, disproving a gene conversion phenomenon. In all patients a fragment of 393 bp corresponding to a specific region of the promoter of CYP11B2 gene was amplified. The sequence of the fragment did not differ from that of the wild-type promoter of the CYP11B2 gene. The 18-hydroxycortisol levels in the eight idiopathic hyperaldosteronism patients and four controls with chimeric gene were 3.9 ± 2.3 and 21.9 ± 3.5 nmol/liter, respectively (P < 0.01). In summary, we did not find other genetic alterations or high levels of 18-hydroxycortisol that could explain a positive dexamethasone suppression test in idiopathic hyperaldosteronism. We suggest that the dexamethasone suppression test could lead to an incorrect diagnosis of glucocorticoid-remediable aldosteronism.
GLUCOCORTICOID-REMEDIABLE aldosteronism (GRA) is an autosomal dominant disorder characterized by hyperaldosteronism (1, 2) and high levels of the abnormal adrenal steroids 18-oxocortisol and 18-hydroxycortisol (18-OHF), which are all under the control of ACTH (3, 4, 5, 6). GRA is caused from the unequal crossing over of the genes encoding steroid 11ß-hydroxylase (CYP11B1) and aldosterone synthase (CYP11B2), which results in a chimeric gene CYP11B1/CYP11B2 that has aldosterone synthase activity, but is regulated by ACTH rather than angiotensin II (7, 8).
The prevalence of GRA is unknown, but the diagnosis is clinically relevant because it is treated specifically by suppressing ACTH with a synthetic glucocorticoid such as dexamethasone (2). The dexamethasone suppression test (DST) has traditionally been used to diagnose GRA. Litchfield et al. (9) evaluated the DST with the definitive genetic test for the chimeric CYP11B1/CYP11B2 gene and concluded that a post-DST aldosterone level below 4 ng/dl correctly diagnosed GRA patients with high sensitivity (92%) and specificity (100%). However, Mulatero et al. (10) recently showed that several patients with primary hyperaldosteronism who were suppressed by dexamethasone to the same degree as patients with GRA did not have the expected chimeric gene. More recently, we demonstrated that only 20% of patients with primary aldosteronism that suppressed aldosterone levels below 4 ng/dl after DST had a positive genetic test for the classical chimeric gene (11).
Other genetic defects that can explain a positive DST have not been demonstrated. However, it has been shown in vitro that the product of the CYP11B1 gene may acquire aldosterone synthase activity if serine 288 and valine 320 are replaced by the corresponding CYP11B2 residues, glycine and alanine (12). A more efficient aldosterone synthase activity occurs when all 10 of the amino acids encoded in exons 4, 5, and 6 of CYP11B2 replace those of the CYP11B1 gene (13). In addition, recombinant events in which promoter sequences from CYP11B1 are transferred into the CYP11B2 gene are other hypothetical causes of GRA.
The aim of this work was to evaluate whether patients with idiopathic hyperaldosteronism (IHA) without the classical chimeric CYP11B1/CYP11B2 gene have other genetic alterations that might explain a positive DST. We also evaluated the role of 18-OHF as a specific biochemical marker of GRA. If other genetic alterations exist in patients with high levels of 18-OHF, we can postulate other functionally equivalent mechanism to the chimeric gene to explain the GRA.
Subjects and Methods
Patients
We studied eight patients with IHA who had a positive DST and a
negative test for the chimeric CYP11B1/CYP11B2 gene. These patients
were detected in a previous study designed to establish the prevalence
of primary aldosteronism and GRA in essential hypertensive patients
(11). Primary aldosteronism was diagnosed in the eight
patients by the presence of high serum aldosterone (SA) levels (>16
ng/dl), low PRA levels (<0.5 ng/ml·h), and a very high SA/PRA ratio
(>50) in at least two determinations. The computed tomography scan
showed a bilateral adrenal gland enlargement in two of eight patients
and was reported to be normal in the other six of eight. The DST in the
eight patients was positive, as defined by the suppression of SA to
less than 4 ng/dl after receiving 2 d of dexamethasone (2 mg/d,
orally; 0.5 mg every 6 h). To evaluate whether the aldosterone
suppression persisted with a more prolonged dexamethasone
administration, we performed a 5-d DST in six of eight patients (two
patients refused the test), and we compared the results with those
found with the 2-d test. Suppression of plasma cortisol (<2.5 µg/dl)
was used as an index of dexamethasone efficacy in both tests. The long
PCR technique described by Jonsson et al. (14)
was used to detect the chimeric CYP11B1/CYP11B2 gene. The amplification
reactions were carried out using the XL PCR Kit from Perkin-Elmer Corp.
(Branchburg, NJ). We used four patients with the classical chimeric
gene as controls in each reaction. The clinical and biochemical
characteristics of patients are shown in Table 1
.
|
To determine whether gene conversions of CYP11B2 are present in the coding regions of CYP11B1, we amplified exons 39 by PCR, and the products were sequenced in an automatic fluorescent DNA sequencer (ABI Prism model 310). The PCR amplification was performed for exons 35 and 69 using the primers and conditions described previously by White et al. (15). To determine recombinant events of CYP11B1 in the promoter regions of CYP11B2, we amplified a specific region of CYP11B2 localized between nucleotides -138 to -284 using the following primers: sense (A), CAGGGGGTACGTGGACATTT (-440 to -420); and antisense (B), CAGGAACCTGCTCTGGAAAC (-67 to -47). The conditions of reactions were denaturing at 95 C for 40 sec, annealing at 56 C for 30 sec, and extension at 72 C for 45 sec for 35 cycles. The PCR products were sequenced as previously described. Serum 18-OHF was measured using a biotin-avidin enzyme-linked assay as previously described (16), and the levels were compared with those of 4 patients with a positive chimeric CYP11B1/CYP11B2 gene. The 18-OHF value in a nonhypertensive control population composed of 200 subjects was 2.68 ± 1.38 nmol/liter (our unpublished data).
Statistical analysis
The t test and Wilcoxon test were performed for compared variables between different groups.
Results
None of our 8 cases with IHA, positive DST, and negative genetic test for the chimeric CYP11B1/CYP11B2 gene showed nucleotide abnormalities in exons 39 of the CYP11B1 gene. In this region the sequence of CYP11B1 and CYP11B2 differ by 22 residues, which were identified and were specific for the CYP11B1 gene. In particular, we did not find the substitutions Ser288Gly and Val320Ala, disproving a gene conversion phenomenon. We found no nucleotide changes in the CYP11B1 gene that could generate new mutations.
A fragment of 393 bp corresponding to a specific region of the promoter of CYP11B2 gene was amplified by PCR in all patients. The equivalent region in CYP11B1 is approximately 100 bp shorter and was not found in any patient. The sequence of the PCR product did not have any nucleotide changes compared with the normal promoter sequence of the CYP11B2 gene.
The plasma 18-OHF level in the eight patients was 3.89 ±
2.32 nmol/liter, and the level in the four patients positive for the
chimeric CYP11B1/CYP11B2 gene was 21.85 ± 3.46 nmol/liter, a
difference that was statistically significant (P <
0.01). As shown in Table 1
, other clinical and laboratory findings were
not significantly different between those with a positive or negative
test for the chimeric CYP11B1/CYP11B2 gene.
The 5-d DST performed in six IHA patients confirmed the results of the 2-d test; aldosterone remained suppressed below 4 ng/dl. The average aldosterone value for the longer test was 2.70 ± 0.78 ng/dl, and that for the shorter test was 2.36 ± 0.53 ng/dl (not significant). Blood pressure decreased in all patients during the short and longer DST. After 5 d of dexamethasone, systolic blood pressure decreased from 153 ± 15 to 142 ± 14 mm Hg (not significant), and diastolic from 103 ± 10 to 85 ± 7 mm Hg (P < 0.05).
Discussion
We were unable to demonstrate other genetic alterations in IHA patients without the classical chimeric CYP11B1/CYP11B2 gene explaining the suppression of aldosterone levels with dexamethasone. In particular, we did not find the substitutions Ser288Gly and Val320Ala, disproving a gene conversion phenomenon. These results suggest that the DST could erroneously establish the diagnosis of GRA.
Gene conversions or point mutations affecting the exonic regions of CYP11B1 or the promoter regions of CYP11B2 could explain the positive DST in IHA patients without the chimeric gene (13). However, this hypothesis seems unlikely after we demonstrated a normal nucleotide sequence in the coding regions of CYP11B1 and a normal specific region of the CYP11B2 promoter. Because we did not sequence the entire promoter or intronic regions of CYP11B2 we cannot exclude the presence of abnormal regulatory elements for ACTH at these levels. However, a high frequency of intronic CYP11B2 gene conversions had been detected by our group in healthy individuals (unpublished) and in patients with hypoaldosteronism (17), suggesting that gene conversion in intronic region of CYP11B2 is very common and probably does not affect normal gene regulation.
The detection of normal levels of 18-OHF is another important difference between our patients and those with the classical genetics for GRA. In GRA the high levels of 18-OHF are produced by the abnormal expression of the chimeric CYP11B1/CYP11B2 gene resulting in aldosterone synthase activity in the zona fasciculata. Recent transfection studies using different recombinant CYP11B constructs have demonstrated that the encoded hybrid enzyme has the 11ß-hydroxylase, 18-hydroxylase, and 18-oxidase activities required for the conversion of 11-deoxycortisol to cortisol, 18-OHF, and 18-oxocortisol (13). In contrast, transfection experiments using CYP11B1 constructs result in very high levels of 11ß-hydroxylase activity, but very little 18-hydroxylase and virtually no 18-oxidase activity, thus impairing the synthesis of aldosterone and C18 oxygenated steroids (15, 18). Thus, the absence of high levels of 18-OHF is another argument against an abnormal regulatory pattern of aldosterone synthesis and makes unlikely the presence of genetic alterations similar to those seen in GRA patients.
The positive DST in patients without the classical genetic GRA might be attributed to mishandling when carrying out the test. However, Mulatero et al. found a similar high frequency of false positives even when using a more stringent criterion (2 ng/dl) for the aldosterone levels (10). We also evaluated our patients with a more prolonged DST. The results of a 5-d DST did not differ from those of the shorter 2-d suppression test previously described (11). This peculiar response to the DST in patients with primary aldosteronism has been attributed to transient dependency of aldosterone secretion to ACTH. The aldosterone secretion in aldosterone-producing adenoma is dependent at least in part on ACTH (19, 20). Moreover, an increase in the expression of the ACTH receptor was found in some patients with adenoma (21). Less dependency of aldosterone secretion on ACTH has been reported in patients with IHA (22, 23), suggesting that they would not respond by suppression of aldosterone when treated with dexamethasone. Our results suggest that patients with IHA are heterogeneous, and some show ACTH dependency similar to patients with adenomas. Adrenal suppression by dexamethasone in primary adrenal hyperplasia has been described, but the mechanism is unknown (24).
We conclude that the DST could lead to an incorrect diagnosis of GRA. Chronic dexamethasone administration can have deleterious effects if administered for long periods of time to patients with primary aldosteronism (25). For those reasons, we suggest that any IHA patient with an elevated level of 18-OHF and a positive DST is likely to have GRA. However, the diagnosis must be confirmed with the definitive genetic test for CYP11B1/CYP11B2 gene.
Acknowledgments
We acknowledge Dr. Elise Gómez-Sanchez from Mississippi University for her expert editorial assistance.
Footnotes
This work was supported by Chilean Grant Fondecyt 1980 999 and 1011035 (to C.E.F.), medical research funds from the Department of Veteran Affairs (to C.G.-S.), and NIH Grant HL-27255 from the NHLBI (to C.G.-S.).
Abbreviations: DST, Dexamethasone suppression test; GRA, glucocorticoid-remediable aldosteronism; IHA, idiopathic hyperaldosteronism; 17-OHF, 18-hydroxycortisol; SA, serum aldosterone.
Received December 27, 2000.
Accepted June 13, 2001.
References
His)
associated with steroid 11ß-hydroxylase deficiency in Jews of
Moroccan origin. J Clin Invest 87:16641667
This article has been cited by other articles:
![]() |
J. W. Funder, R. M. Carey, C. Fardella, C. E. Gomez-Sanchez, F. Mantero, M. Stowasser, W. F. Young Jr., and V. M. Montori Case Detection, Diagnosis, and Treatment of Patients with Primary Aldosteronism: An Endocrine Society Clinical Practice Guideline J. Clin. Endocrinol. Metab., September 1, 2008; 93(9): 3266 - 3281. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mulatero A New Form of Hereditary Primary Aldosteronism: Familial Hyperaldosteronism Type III J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 2972 - 2974. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |