help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fardella, C. E.
Right arrow Articles by Montero, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fardella, C. E.
Right arrow Articles by Montero, J.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 10 4805-4807
Copyright © 2001 by The Endocrine Society


Other Original Articles

Genetic Study of Patients with Dexamethasone-Suppressible Aldosteronism without the Chimeric CYP11B1/CYP11B2 Gene

Carlos E. Fardella, Mauricio Pinto, Lorena Mosso, Celso Gómez-Sánchez, Jorge Jalil and Joaquín Montero

Departments of Endocrinology (C.E.F., M.P., L.M.), Cardiology (J.J.), and Internal Medicine (J.M.), Faculty of Medicine, Catholic University of Chile, and Division of Endocrinology, G. V. (Sonny) Montgomery Veterans Affairs Medical Center and the University of Mississippi Medical Center (C.G.-S.), Jackson, Mississippi 39216

Address all correspondence and requests for reprints to: Carlos E. Fardella., Dept. of Endocrinology, Faculty of Medicine, P. Universidad Católica de Chile, Marcoleta 391, Santiago, Chile. E-mail: cfardella{at}med.puc.cl

Abstract

Glucocorticoid-remediable aldosteronism is an inherited disorder caused by a chimeric gene duplication between the CYP11B1 (11ß-hydroxylase) and CYP11B2 (aldosterone synthase) genes. The disorder is characterized by hyperaldosteronism and high levels of 18-hydroxycortisol and 18-oxocortisol, which are under ACTH control. The diagnosis of glucocorticoid-remediable aldosteronism had been traditionally made using the dexamethasone suppression test; however, recent studies have shown that several patients with primary aldosteronism and a positive dexamethasone suppression test do not have the chimeric CYP11B1/CYP11B2 gene. The aim of this work was to evaluate whether other genetic alterations exist in CYP11B genes (gene conversion in the coding region of CYP11B1 or in the promoter of CYP11B2) that could explain a positive dexamethasone suppression test and to determine another genetic cause of glucocorticoid-remediable aldosteronism. We also evaluated the role of 18-hydroxycortisol as a specific biochemical marker of glucocorticoid-remediable aldosteronism. We studied eight patients with idiopathic hyperaldosteronism, a positive dexamethasone suppression test, and a negative genetic test for the chimeric gene. In all patients we amplified the CYP11B1 gene by PCR and sequenced exons 3–9 of CYP11B1 and a specific region (-138 to -284) of CYP11B2 promoter. We also measured the levels of 18-hydroxycortisol, and we compared the results with those found in four subjects with the chimeric gene. None of eight cases showed abnormalities in exons 3–9 of CYP11B1, disproving a gene conversion phenomenon. In all patients a fragment of 393 bp corresponding to a specific region of the promoter of CYP11B2 gene was amplified. The sequence of the fragment did not differ from that of the wild-type promoter of the CYP11B2 gene. The 18-hydroxycortisol levels in the eight idiopathic hyperaldosteronism patients and four controls with chimeric gene were 3.9 ± 2.3 and 21.9 ± 3.5 nmol/liter, respectively (P < 0.01). In summary, we did not find other genetic alterations or high levels of 18-hydroxycortisol that could explain a positive dexamethasone suppression test in idiopathic hyperaldosteronism. We suggest that the dexamethasone suppression test could lead to an incorrect diagnosis of glucocorticoid-remediable aldosteronism.

GLUCOCORTICOID-REMEDIABLE aldosteronism (GRA) is an autosomal dominant disorder characterized by hyperaldosteronism (1, 2) and high levels of the abnormal adrenal steroids 18-oxocortisol and 18-hydroxycortisol (18-OHF), which are all under the control of ACTH (3, 4, 5, 6). GRA is caused from the unequal crossing over of the genes encoding steroid 11ß-hydroxylase (CYP11B1) and aldosterone synthase (CYP11B2), which results in a chimeric gene CYP11B1/CYP11B2 that has aldosterone synthase activity, but is regulated by ACTH rather than angiotensin II (7, 8).

The prevalence of GRA is unknown, but the diagnosis is clinically relevant because it is treated specifically by suppressing ACTH with a synthetic glucocorticoid such as dexamethasone (2). The dexamethasone suppression test (DST) has traditionally been used to diagnose GRA. Litchfield et al. (9) evaluated the DST with the definitive genetic test for the chimeric CYP11B1/CYP11B2 gene and concluded that a post-DST aldosterone level below 4 ng/dl correctly diagnosed GRA patients with high sensitivity (92%) and specificity (100%). However, Mulatero et al. (10) recently showed that several patients with primary hyperaldosteronism who were suppressed by dexamethasone to the same degree as patients with GRA did not have the expected chimeric gene. More recently, we demonstrated that only 20% of patients with primary aldosteronism that suppressed aldosterone levels below 4 ng/dl after DST had a positive genetic test for the classical chimeric gene (11).

Other genetic defects that can explain a positive DST have not been demonstrated. However, it has been shown in vitro that the product of the CYP11B1 gene may acquire aldosterone synthase activity if serine 288 and valine 320 are replaced by the corresponding CYP11B2 residues, glycine and alanine (12). A more efficient aldosterone synthase activity occurs when all 10 of the amino acids encoded in exons 4, 5, and 6 of CYP11B2 replace those of the CYP11B1 gene (13). In addition, recombinant events in which promoter sequences from CYP11B1 are transferred into the CYP11B2 gene are other hypothetical causes of GRA.

The aim of this work was to evaluate whether patients with idiopathic hyperaldosteronism (IHA) without the classical chimeric CYP11B1/CYP11B2 gene have other genetic alterations that might explain a positive DST. We also evaluated the role of 18-OHF as a specific biochemical marker of GRA. If other genetic alterations exist in patients with high levels of 18-OHF, we can postulate other functionally equivalent mechanism to the chimeric gene to explain the GRA.

Subjects and Methods

Patients

We studied eight patients with IHA who had a positive DST and a negative test for the chimeric CYP11B1/CYP11B2 gene. These patients were detected in a previous study designed to establish the prevalence of primary aldosteronism and GRA in essential hypertensive patients (11). Primary aldosteronism was diagnosed in the eight patients by the presence of high serum aldosterone (SA) levels (>16 ng/dl), low PRA levels (<0.5 ng/ml·h), and a very high SA/PRA ratio (>50) in at least two determinations. The computed tomography scan showed a bilateral adrenal gland enlargement in two of eight patients and was reported to be normal in the other six of eight. The DST in the eight patients was positive, as defined by the suppression of SA to less than 4 ng/dl after receiving 2 d of dexamethasone (2 mg/d, orally; 0.5 mg every 6 h). To evaluate whether the aldosterone suppression persisted with a more prolonged dexamethasone administration, we performed a 5-d DST in six of eight patients (two patients refused the test), and we compared the results with those found with the 2-d test. Suppression of plasma cortisol (<2.5 µg/dl) was used as an index of dexamethasone efficacy in both tests. The long PCR technique described by Jonsson et al. (14) was used to detect the chimeric CYP11B1/CYP11B2 gene. The amplification reactions were carried out using the XL PCR Kit from Perkin-Elmer Corp. (Branchburg, NJ). We used four patients with the classical chimeric gene as controls in each reaction. The clinical and biochemical characteristics of patients are shown in Table 1Go.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical and laboratory findings for patients with positive and negative tests for the chimeric CYP11B1/ CYP11B2 gene

 
Methods

To determine whether gene conversions of CYP11B2 are present in the coding regions of CYP11B1, we amplified exons 3–9 by PCR, and the products were sequenced in an automatic fluorescent DNA sequencer (ABI Prism model 310). The PCR amplification was performed for exons 3–5 and 6–9 using the primers and conditions described previously by White et al. (15). To determine recombinant events of CYP11B1 in the promoter regions of CYP11B2, we amplified a specific region of CYP11B2 localized between nucleotides -138 to -284 using the following primers: sense (A), CAGGGGGTACGTGGACATTT (-440 to -420); and antisense (B), CAGGAACCTGCTCTGGAAAC (-67 to -47). The conditions of reactions were denaturing at 95 C for 40 sec, annealing at 56 C for 30 sec, and extension at 72 C for 45 sec for 35 cycles. The PCR products were sequenced as previously described. Serum 18-OHF was measured using a biotin-avidin enzyme-linked assay as previously described (16), and the levels were compared with those of 4 patients with a positive chimeric CYP11B1/CYP11B2 gene. The 18-OHF value in a nonhypertensive control population composed of 200 subjects was 2.68 ± 1.38 nmol/liter (our unpublished data).

Statistical analysis

The t test and Wilcoxon test were performed for compared variables between different groups.

Results

None of our 8 cases with IHA, positive DST, and negative genetic test for the chimeric CYP11B1/CYP11B2 gene showed nucleotide abnormalities in exons 3–9 of the CYP11B1 gene. In this region the sequence of CYP11B1 and CYP11B2 differ by 22 residues, which were identified and were specific for the CYP11B1 gene. In particular, we did not find the substitutions Ser288Gly and Val320Ala, disproving a gene conversion phenomenon. We found no nucleotide changes in the CYP11B1 gene that could generate new mutations.

A fragment of 393 bp corresponding to a specific region of the promoter of CYP11B2 gene was amplified by PCR in all patients. The equivalent region in CYP11B1 is approximately 100 bp shorter and was not found in any patient. The sequence of the PCR product did not have any nucleotide changes compared with the normal promoter sequence of the CYP11B2 gene.

The plasma 18-OHF level in the eight patients was 3.89 ± 2.32 nmol/liter, and the level in the four patients positive for the chimeric CYP11B1/CYP11B2 gene was 21.85 ± 3.46 nmol/liter, a difference that was statistically significant (P < 0.01). As shown in Table 1Go, other clinical and laboratory findings were not significantly different between those with a positive or negative test for the chimeric CYP11B1/CYP11B2 gene.

The 5-d DST performed in six IHA patients confirmed the results of the 2-d test; aldosterone remained suppressed below 4 ng/dl. The average aldosterone value for the longer test was 2.70 ± 0.78 ng/dl, and that for the shorter test was 2.36 ± 0.53 ng/dl (not significant). Blood pressure decreased in all patients during the short and longer DST. After 5 d of dexamethasone, systolic blood pressure decreased from 153 ± 15 to 142 ± 14 mm Hg (not significant), and diastolic from 103 ± 10 to 85 ± 7 mm Hg (P < 0.05).

Discussion

We were unable to demonstrate other genetic alterations in IHA patients without the classical chimeric CYP11B1/CYP11B2 gene explaining the suppression of aldosterone levels with dexamethasone. In particular, we did not find the substitutions Ser288Gly and Val320Ala, disproving a gene conversion phenomenon. These results suggest that the DST could erroneously establish the diagnosis of GRA.

Gene conversions or point mutations affecting the exonic regions of CYP11B1 or the promoter regions of CYP11B2 could explain the positive DST in IHA patients without the chimeric gene (13). However, this hypothesis seems unlikely after we demonstrated a normal nucleotide sequence in the coding regions of CYP11B1 and a normal specific region of the CYP11B2 promoter. Because we did not sequence the entire promoter or intronic regions of CYP11B2 we cannot exclude the presence of abnormal regulatory elements for ACTH at these levels. However, a high frequency of intronic CYP11B2 gene conversions had been detected by our group in healthy individuals (unpublished) and in patients with hypoaldosteronism (17), suggesting that gene conversion in intronic region of CYP11B2 is very common and probably does not affect normal gene regulation.

The detection of normal levels of 18-OHF is another important difference between our patients and those with the classical genetics for GRA. In GRA the high levels of 18-OHF are produced by the abnormal expression of the chimeric CYP11B1/CYP11B2 gene resulting in aldosterone synthase activity in the zona fasciculata. Recent transfection studies using different recombinant CYP11B constructs have demonstrated that the encoded hybrid enzyme has the 11ß-hydroxylase, 18-hydroxylase, and 18-oxidase activities required for the conversion of 11-deoxycortisol to cortisol, 18-OHF, and 18-oxocortisol (13). In contrast, transfection experiments using CYP11B1 constructs result in very high levels of 11ß-hydroxylase activity, but very little 18-hydroxylase and virtually no 18-oxidase activity, thus impairing the synthesis of aldosterone and C18 oxygenated steroids (15, 18). Thus, the absence of high levels of 18-OHF is another argument against an abnormal regulatory pattern of aldosterone synthesis and makes unlikely the presence of genetic alterations similar to those seen in GRA patients.

The positive DST in patients without the classical genetic GRA might be attributed to mishandling when carrying out the test. However, Mulatero et al. found a similar high frequency of false positives even when using a more stringent criterion (2 ng/dl) for the aldosterone levels (10). We also evaluated our patients with a more prolonged DST. The results of a 5-d DST did not differ from those of the shorter 2-d suppression test previously described (11). This peculiar response to the DST in patients with primary aldosteronism has been attributed to transient dependency of aldosterone secretion to ACTH. The aldosterone secretion in aldosterone-producing adenoma is dependent at least in part on ACTH (19, 20). Moreover, an increase in the expression of the ACTH receptor was found in some patients with adenoma (21). Less dependency of aldosterone secretion on ACTH has been reported in patients with IHA (22, 23), suggesting that they would not respond by suppression of aldosterone when treated with dexamethasone. Our results suggest that patients with IHA are heterogeneous, and some show ACTH dependency similar to patients with adenomas. Adrenal suppression by dexamethasone in primary adrenal hyperplasia has been described, but the mechanism is unknown (24).

We conclude that the DST could lead to an incorrect diagnosis of GRA. Chronic dexamethasone administration can have deleterious effects if administered for long periods of time to patients with primary aldosteronism (25). For those reasons, we suggest that any IHA patient with an elevated level of 18-OHF and a positive DST is likely to have GRA. However, the diagnosis must be confirmed with the definitive genetic test for CYP11B1/CYP11B2 gene.

Acknowledgments

We acknowledge Dr. Elise Gómez-Sanchez from Mississippi University for her expert editorial assistance.

Footnotes

This work was supported by Chilean Grant Fondecyt 1980 999 and 1011035 (to C.E.F.), medical research funds from the Department of Veteran Affairs (to C.G.-S.), and NIH Grant HL-27255 from the NHLBI (to C.G.-S.).

Abbreviations: DST, Dexamethasone suppression test; GRA, glucocorticoid-remediable aldosteronism; IHA, idiopathic hyperaldosteronism; 17-OHF, 18-hydroxycortisol; SA, serum aldosterone.

Received December 27, 2000.

Accepted June 13, 2001.

References

  1. Sutherland DJ, Ruse JL, Laidlaw JC 1966 Hypertension, increased aldosterone secretion, and low plasma renin activity relieved by dexamethasone. Can Med Assoc J 95:1109–1119[Medline]
  2. Fallo F, Mantero F 1990 dexamethasone-suppressible hyperaldosteronism In: Biglieri EG, Melby JC, eds. Endocrine hypertension. Comprehensive endocrinology, revised series. New York: Raven Press; 87–92
  3. Chu MD, Ulick SJ 1982 Isolation and identification of 18-hydroxycortisol from the urine of patients with primary aldosteronism. J Biol Chem 257:2218–2224[Free Full Text]
  4. Ulick SJ, Chu MD, Land MJ 1983 Biosynthesis of 18-oxocortisol by aldosterone-producing adrenal tissue. J Biol Chem 258:5498–5502[Abstract/Free Full Text]
  5. Gomez-Sanchez CE, Montgomery M, Ganguly A, et al. 1984 Elevated urinary excretion of 18-oxocortisol in glucocorticoid-remediable aldosteronism. J Clin Endocrinol Metab 59: 1022–1024
  6. Ulick SJ, Chan CK, Gill GR, et al. 1990 Defective fasciculata zone function as the mechanism of glucocorticoid-remediable aldosteronism. J Clin Endocrinol Metab 71:1151–1157[Abstract/Free Full Text]
  7. Lifton R, Dluhy RG, Powers M, et al. 1992 A chimaeric 11ß-hydroxylase/aldosterone synthase gene causes glucocorticoid-remediable aldosteronism and human hypertension. Nature 335:262–265
  8. Pascoe L, Curnow K, Slutsker L, et al. 1992 Glucocorticoid-suppressible hyperaldosteronism results from hybrid genes created by unequal crossover between CYP11B1 and CYP11B2. Proc Natl Acad Sci USA 89:8327–8331[Abstract/Free Full Text]
  9. Lichfield W, New M 1997 Evaluation of The dexamethasone suppression test for the diagnosis of glucocorticoid-remediable aldosteronism. J Clin Endocrinol Metab 82:3570–3573[Abstract/Free Full Text]
  10. Mulatero P, Veglio F, Pilon C, et al. 1998 Diagnosis of glucocorticoid-remediable aldosteronism in primary aldosteronism: aldosterone response to dexamethasone and long polymerase chain reaction for chimeric gene. J Clin Endocrinol Metab 83:2573–2575[Abstract/Free Full Text]
  11. Fardella C, Mosso L, Gómez-Sánchez C, et al. 2000 Primary hyperaldosteronism in essential hypertensives: prevalence, biochemical profile, and molecular biology. J Clin Endocrinol Metab 85:1863–1867[Abstract/Free Full Text]
  12. Curnow K, Mulatero P, Emeric-Blanchouin N, Aupetit-Faisant B, Corvol P, Pascoe L 1997 The aminoacid substitutions Ser288Gly and Val320Ala convert the cortisol producing enzyme, CYP11B1, into an aldosterone producing enzyme. Nat Struct Biol 4:32–35[CrossRef][Medline]
  13. Mulatero P, Curnow KM, Aupetit-Faisant B, et al. 1998 Recombinant CYP11B genes encode enzymes that can catalyze conversion of 11-deoxycortisol to cortisol, 18-hydroxycortisol, and 18-oxocortisol. J Clin Endocrinol Metab 83:3996–4001[Abstract/Free Full Text]
  14. Jonsson J, Klemm S, Tunny T, Stowasser M, Gordon R 1995 A new genetic test for familial hyperaldosteronism type I aids in the detection of curable hypertension. Biochem Biophys Res Commun 207:565–571[CrossRef][Medline]
  15. White PC, Dupont J, New MI, Lieberman E, Hochberg Z, Rósler A 1991 A mutation in CYP11B1 (Arg 448->His) associated with steroid 11ß-hydroxylase deficiency in Jews of Moroccan origin. J Clin Invest 87:1664–1667
  16. Gómez-Sánchez C, León L, Gómez-Sánchez E 1992 Biotin-hydrazide derivatives for the development of steroid enzyme-linked inmunoassays. J Steroid Biochem Mol Biol 43:523–527[CrossRef][Medline]
  17. Fardella C, Hum DW, Rodriguez H, et al. 1996 Gene conversion in the CYP11B2 gene encoding P450c11AS is associated with, but does not cause, the syndrome of corticosterone methyloxidase II deficiency. J Clin Endocrinol Metab 81:321–326[Abstract]
  18. Zhang G, Rodriguez H, Fardella CE, Harris DA, Miller WL 1995 Mutation T318M in P450c11AS causes corticosterone methyl oxidase II deficiency. Am J Hum Genet 57:1037–1043[Medline]
  19. Ganguly A, Chavarri M, Luetscher JA, Dowdy AJ 1977 Transient fall and subsequent return of high aldosterone secretion by adrenal adenoma during continued dexamethasone administration. J Clin Endocrinol Metab 44:775–779[Abstract/Free Full Text]
  20. Wenting GJ, Man In’t Veld AJ, Derkx FH, Brummelen PV, Schalekamp MA 1978 ACTH-dependent aldosterone excess due to adrenocortical adenoma: a variant of primary aldosteronism. J Clin Endocrinol Metab 46:326–335[Abstract/Free Full Text]
  21. Reincke M, Beuschlein F, Latronico AC, Arlt W, Chrousos GP, Allolio B 1997 Expression of adrenocorticotrophic hormone receptor mRNA in human adrenocortical neoplasmas: correlation with P450scc expression. Clin Endocrinol (Oxf) 46:619–626[CrossRef][Medline]
  22. Kem DC, Weinberger MH, Gomez-Sanchez C, Higgins JR, Kramer NJ 1976 The role of ACTH in the episodic release of aldosterone in patients with idiopathic adrenal hyperplasia, hypertension, and hyperaldosteronism. J Lab Clin Med 88:261–270[Medline]
  23. Schambelan M, Brust NL, Chang BCF, Slater KL, Biglieri EG 1976 Circadian rhythm and effect of posture on plasma aldosterone in primary aldosteronism. J Clin Endocrinol Metab 43:115–131[Abstract/Free Full Text]
  24. Irony I, Kater CE, Biglieri EG, Shackleton CH 1990 Correctable subsets of primary aldosteronism. Primary adrenal hyperplasia and renin responsive adenoma. Am J Hypertens 3:576–582[Medline]
  25. Hoefnagels WHL, Kloppenborg PWC 1982 Hazards of long-term dexamethasone treatment in primary aldosteronism. N Engl J Med 306:427[Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
J. W. Funder, R. M. Carey, C. Fardella, C. E. Gomez-Sanchez, F. Mantero, M. Stowasser, W. F. Young Jr., and V. M. Montori
Case Detection, Diagnosis, and Treatment of Patients with Primary Aldosteronism: An Endocrine Society Clinical Practice Guideline
J. Clin. Endocrinol. Metab., September 1, 2008; 93(9): 3266 - 3281.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. Mulatero
A New Form of Hereditary Primary Aldosteronism: Familial Hyperaldosteronism Type III
J. Clin. Endocrinol. Metab., August 1, 2008; 93(8): 2972 - 2974.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fardella, C. E.
Right arrow Articles by Montero, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fardella, C. E.
Right arrow Articles by Montero, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals