help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vilain, C.
Right arrow Articles by Vassart, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vilain, C.
Right arrow Articles by Vassart, G.
The Journal of Clinical Endocrinology & Metabolism Vol. 86, No. 1 234-238
Copyright © 2001 by The Endocrine Society


Original Studies

Autosomal Dominant Transmission of Congenital Thyroid Hypoplasia Due to Loss-of-Function Mutation of PAX81

Catheline Vilain2, Catherine Rydlewski, Laurence Duprez, Claudine Heinrichs, Marc Abramowicz, Paul Malvaux, Benoît Renneboog, Jasmine Parma, Sabine Costagliola and Gilbert Vassart

Institut de Recherche Interdisciplinaire en Biologie Humaine et Nucléaire, Faculté de Médecine (C.V., L.D., B.R., S.C., G.V.), Université Libre de Bruxelles, B-1070 Brussels; Department of Medical Genetics, Erasme Hospital, Faculté de Médecine (C.R., M.A., J.P., G.V.), Université Libre de Bruxelles, B-1070 Brussels; Department of Pediatric Endocrinology, Hôpital Universitaire des Enfants Reine Fabiola (C.H.), Université Libre de Bruxelles, B-1020 Brussels; and Department of Pediatrics, Cliniques Universitaires Saint Luc (P.M.), Université Catholique de Louvain, B-1200 Bruxelles, Belgium

Address correspondence and requests for reprints to: Gilbert Vassart, Institut de Recherche Interdisciplinaire en Biologie Humaine et Nucléaire, Free University of Brussels, 808 route de Lennik, B-1070 Brussels, Belgium. E-mail: gvassart{at}ulb.ac.be


    Abstract
 Top
 Abstract
 Introduction
 Experimental subjects
 Materials and Methods
 Results
 Discussion
 References
 
Congenital hypothyroidism (CH) is a relatively frequent and potentially severe disease. It is classically subdivided into: 1) thyroid dysgenesis (TD), a defect in the organogenesis of the gland leading to hypoplastic, ectopic, or absent thyroid gland; or 2) thyroid dyshormonogenesis, a defect in one of the biochemical mechanisms responsible for thyroid hormone synthesis. Most cases of TD are sporadic, although familial occurrences have occasionally been described. Recently, several genes have been implicated in a small proportion of TD, but, in the majority of the cases, the etiology remains unknown. PAX8 is a transcription factor involved in thyroid development. So far, three loss-of-function mutations of PAX8 have been described, two in sporadic cases and one in familial thyroid hypoplasia. Here, we describe a novel mutation of PAX8 causing autosomal dominant transmission of CH with thyroid hypoplasia. The mutation consists of the substitution of a tyrosine for cysteine 57 in the paired domain of PAX8. When tested in cotransfection experiments with a thyroid peroxidasse promoter construct, the mutant allele was unable to exert its normal transactivation effect on transcription. Our results give further evidence that, contrary to the situation in knockout mice, haplo-insufficiency of PAX8 is a cause of CH in humans.


    Introduction
 Top
 Abstract
 Introduction
 Experimental subjects
 Materials and Methods
 Results
 Discussion
 References
 
WITH AN INCIDENCE of 1 in 3000–4000, congenital hypothyroidism (CH) is not a rare condition. In the absence of early substitutive treatment, it leads to severe and irreversible mental retardation. In 85% of the cases, CH is secondary to developmental anomalies of the thyroid gland, leading to thyroid dysgenesis (TD): in 35–40% of these, the gland is not visualized; in 30–45% it is small and located ectopically; and in 5% the gland is hypoplastic (1). In thyroid ectopia, the sex ratio is significantly in favor of girls (2). In the remaining 15%, CH is associated with congenital goiter and results from dyshormonogenesis, a defect in one of the biochemical mechanisms responsible for thyroid hormone synthesis (3). In these cases, the disease is transmitted on the autosomal recessive mode and a wide spectrum of mutations have been identified, affecting a total of four genes: thyroglobulin (TG) (4), thyroperoxidase (TPO) (5), sodium/iodide symporter (NIS) (6), and Pendrin (PDS) (7). Loss-of-function mutations of the TSH receptor are responsible for recessively inherited CH with hypoplastic gland (8). Other candidate genes have been identified from the study of thyroid-specific transcription factors expressed during the development of the gland: mutations in genes coding for transcription factors TTF1 (thyroid transcription factor 1 or Nkx2–1) (9), TTF2 (thyroid transcription factor 2 or Fkhl15) (10, 11), and PAX8 (1, 12) have been implicated in TD, in knockout mice, and/or human diseases.

In the mouse, Ttf1 is important for the development of lungs, thyroid, and some areas of the brain (9). No mutation in the TITF1 gene has been identified in humans so far, despite screening of several series of patients with CH (13, 14). From knockout mice studies Ttf 2 has been shown to be important for thyroid migration during embryogenesis and for closure of the palate (11). Mutation in the TITF 2 gene was found in two related patients with Bamforth syndrome (congenital hypothyroidism, cleft palate, choanal atresia, and kinky hair) (10). PAX8 is a member of the large Pax protein family that recognizes DNA via a highly conserved paired domain. It maps to human chromosome 2q12-q14 and consists of at least 10 exons (15). It is expressed from the beginning of thyroid development, when the thyroid bud evaginates from the floor of the pharynx (day 8.5 postcoïtum in mouse) (16). PAX8 is still expressed in the adult thyroid, where it has been shown to activate transcription of TG, TPO (17), and NIS (18).

Homozygous Pax8 knockout mice die shortly after weaning, presumably from severe hypothyroidism. Their thyroids are small and composed almost exclusively of parafollicular calcitonin-secreting cells (12). In man, a loss-of-function mutation of PAX8 has been reported in a familial case of CH, with three affected members (1), showing autosomal dominant inheritance and varying degrees in severity of thyroid hypoplasia. In the same study, two additional mutations (a point mutation and a nonsense mutation) have been found in two sporadic cases out of 145 patients with CH, by single-strand conformational polymorphism analysis. The corresponding phenotypes were thyroid ectopy and hypoplasia, respectively.

Here, we describe a novel PAX8 mutation in a mother and daughter, presenting with CH due to thyroid hypoplasia. The mutation, which was not found in 49 other patients with CH, results in the substitution of tyrosine for a highly conserved cysteine at codon 57 in the paired domain of PAX8. The mutated allele has no detectable functional activity when tested for its ability to transactivate the TPO promoter in cotransfection experiments. Our results strengthen the notion that haplo-insufficiency secondary to PAX8 mutation is a cause of CH, accounting for a small proportion of sporadic and familial cases.


    Experimental subjects
 Top
 Abstract
 Introduction
 Experimental subjects
 Materials and Methods
 Results
 Discussion
 References
 
Case reports. Patient 1 was diagnosed in the frame of neonatal screening for CH by displaying a TSH level of about 200 mU/mL. The girl, the second child of a nonconsanguineous couple, was born 41 weeks after conception, following uncomplicated pregnancy and delivery (birth weight, 2.8 kg; birth length, 47.5 cm). The immediate postnatal period was uneventful, except for persistent jaundice. At day 32, the TSH level was still above 100 mU/L, with very low free T4 [2.8 pmol/L; normal valve (N), 10–23] and free T3 (1.5 pmol/L; N, 3.4–7.5); thyroglobulin was at 2.8 µg/L (N, <25). 99mTc scintigraphy showed a very hypoplastic gland in normal cervical position.

Patient 2, the mother of patient 1, aged 23 yr, was diagnosed as "athyreotic" at the age of 9 months, at a time when no systematic neonatal screening was performed. She has been on L-thyroxine therapy since then and is otherwise in good health, except for deafness, an after-effect of meningitis at the age of 4 yr. Although not investigated by specific tests, she does not show obvious signs of mental retardation. Ultrasonography, performed recently under L-thyroxine treatment, showed severe thyroid hypoplasia with cystic thyroid rudiments. Ultrasounds of the kidneys were normal in both patients.

Blood samples from 59 patients with CH (28 with thyroid ectopy and 31 with thyroid hypoplasia) and from 17 normal patients were collected, and genomic DNA was extracted from peripheral blood lymphocytes using the phenol-chloroform extraction method (19).


    Materials and Methods
 Top
 Abstract
 Introduction
 Experimental subjects
 Materials and Methods
 Results
 Discussion
 References
 
Direct sequencing

Specific primers were designed to sequence human PAX8 promoter and exons 1–10. Exons 3–10 were amplified by primers described elsewhere (1). Primers 5'-GGCTCTAAGGGTGTGAACGC-3' and 5'-GCCTAGCCTAGCTCAACAGG-3', 5'-CTGAGTCCACTCAGCCATGTC-3'and GCCTAGCCTAGCTCAACAGG-3', and 5'-GCACTCCCAATCCTTGATC-3' and 5'-CTCGGGGACCTGACCACACC-3' were used to sequence the promoter and exons 1 and 2, respectively. For promoter, PCR was performed in the PE 2400 equipment (PE Applied Biosystems, Foster City, CA) in 20 µL with 200 ng genomic DNA, 1 U Amplitaq Gold (PE Applied Biosystems), in 1x buffer II supplemented with 1 mM MgCI2, 200 µM dNTP, and 2 pmol of the primers. The following conditions were used: initial denaturation at 95 C for 12 min, then 30 cycles of 95 C–1 min, 52 C–1 min, and 72 C–1 min. For exons 1–10 PCR was performed in 20 µL with 200 ng genomic DNA, 1 U Taq DNA polymerase (Life Technologies, Inc., Merelbeke, Belgium) supplemented with 200 µM dNTP, 3 pmol of the primers, with MgC12 concentrations varying from 1–2 mM, and 0–10% DMSO in the PE 2400 equipment. The PCR conditions were as described above, except for annealing temperature: 50 C for exon 1, 52 C for exon 2, and as described previously (1) for exons 3–10. PCR products were purified with the Qiaquick PCR purification kit (QIAGEN, Wetsburg, The Netherlands) and sequenced using the ABI PRISM Dye Terminator cycle sequencing Ready Reaction kit (PE Applied Biosystems) according to the manufacturer’s instructions. Sequences were analyzed with Sequence Navigator Software (PE Applied Biosystems). Direct sequencing was performed on patients 1 and 2 and on 10 patients with isolated sporadic CH (6 with thyroid ectopy and 4 with thyroid hypoplasia).

MaeII digestion

We performed MaeII digestion of the PCR products of the third exon in 49 patients with CH (22 with ectopy and 27 with hypoplasia or athyreosis) and in 17 normal individuals. MaeII digestion produces a fragment of 290 bp from the wild type and two fragments of 232 bp and 58 bp from the mutant allele. Fragments were separated on a 3% agarose gel, stained by ethidium bromide, and visualized under ultraviolet lamp.

Functional analysis of the mutant

Expression vector and reporter gene constructs. The full coding sequence of human PAX8 was produced by PCR from Human thyroid marathon ready cDNA library (CLONTECH Laboratories, Inc., Palo Alto, CA) using 5'ATATGGTACCATGCCGCACAACTCCATC3' and 5'ATATTCTAGACTACAGATGGTCAAAGGC3' primers. The PCR product was cloned in pCDNA3 using KpnI and XbaI restriction sites introduced in the primers to obtain hPAX8WT-pCDNA3. The C57Y mutant was obtained by PCR with 5'CTCCCGCCAGCTCCGAGTCAGCCATGGCTATGTCAGCAAG3' and 5'GACTCGGAGCTGGCGGGAGATGTCACAGGGCCTCACGCCC3' primers, as described by Ansaldi et al. (20). The PCR product was digested with Dpn1 (New England Biolabs, Inc., Beverly, MA) to eliminate template Dam-methylated DNA, while the PCR-synthesized (unmethylated) molecules remained intact. The 5' 405-bp fragment containing the mutaiton was subcloned by KpnI and BspE1 in hPAX8WT-pCDNA3, to avoid interfering spontaneous mutations.

A 416-bp fragment of the human TPO promoter going from -366 to +50 was generated by PCR from genomic DNA using 5'CTGCTCGAGGAGCTGCACCCAACCCAAT3' and 5'CAAGAATTCAGTAATTTTCACGGCTGT3' primers. This fragment was cloned in pSEAP2basic (CLONTECH Laboratories, Inc.) (using EcoRI and XhoI restriction sites introduced in the primers) to obtain a vector encoding a secreted thermoresistant form of alkaline phosphatase under the control of the TPO promoter (hTPOprom-SEAP). All constructs were verified by direct sequencing.

Cell culture, transffection, and chemiluminescence SEAP (the secreted form of placental alkaline phosphatase) assays. HeLa cells were grown in DMEM (Life Technologies, Inc.) supplemented with 10% FCS. Cells (3 x 105) were plated per 30-mm diameter culture dish 24 h before transfection. Transfections were carried out with Fugene (Roche Diagnostic, Brussels, Belgium) following the manufacturer’s instructions. hTPOprom-SEAP (0.5 µg) was cotransfected together with 0.5 µg of either hPAX8WT-pCDNA3, hPAX8C57Y-pCDNA3, or the empty pCDNA3 vector, with 3 µL Fugene. Forskoline (5 µM) was added 6 h after transfection. For Western blot, 1 µg hPAX8WT-pCDNA3 and 1 µg hPAX8C57Y-pCDNA3 were used for transfection.

Transfections with 1 µg pSEAP2-control (SV40 early promoter) and 1.5 µg pCDNA3 vector containing the cDNA encoding Enhanced Green Fluorescent Protein (CLONTECH Laboratories, Inc.) were used to assess the efficiency of transfection.

Chemiluminescence SEAP assays were performed on 15 µL of the cultured medium following the manufacturer’s instructions (CLONTECH Laboratories, Inc.).

Western blot analysis. Cells were plated and transfected as described above. Forty-eight hours after transfection, they were washed twice with PBS, detached from the plates with PBS-5 mM EDTA/5 mM EGTA, and pelleted 5 min at 14500 x g at 4 C. The pellet was resuspended in 100 µL Laemmli buffer, submitted to three cycles of freeze-thaw, and boiled. Proteins were quantified according to the Minamide and Bamburg method (21); 15 µg of total proteins were loaded on a 10% SDS-PAGE. Western blotting was performed with a rabbit anti-PAX8 antibody (22) used at a 1:1000 dilution, and horseradish peroxidase-labeled donkey antirabbit antibody (Amersham Pharmacia Biotech, Piscataway, NJ) as a second antibody. Bound antibody was revealed with a chemiluminescence kit (RPN2108; Amersham Pharmacia Biotech).


    Results
 Top
 Abstract
 Introduction
 Experimental subjects
 Materials and Methods
 Results
 Discussion
 References
 
Mutation identified in PAX8

In the frame of a systematic screen for mutations in candidate genes in patients with CH, we sequenced exons 1–10 of the PAX8 gene in 12 patients with TD. Two related patients, a mother and her daughter, both affected with congenital thyroid hypoplasia, were shown to harbor a G->A transition in the heterozygous state in exon 3 of the gene (Fig. 1Go). The mutation resulted in the substitution of a cysteine at position 57 by a tyrosine residue (C57Y PAX8 mutant) (Fig. 2aGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Direct sequencing of PAX8 showing a G to A substitution in codon 57 in one allele.

 


View larger version (81K):
[in this window]
[in a new window]
 
Figure 2. a, Position of the homologue of cysteine 57 in the crystal structure of the paired domain of PAX6. Cysteine 57 molecule is represented by spherical structures. b, Paired domains and their DNA-binding sites: alignment of DNA binding sites of the Drosophila paired domain (Prd) and paired domains of various human PAX proteins. Cysteine residues corresponding to codon 57 of human PAX8 are boxed. [Fig. 2aGo was created with RasMol software from file PDB:6Pax (from Xu et al., Ref. 24 )].

 
The G->A transition at codon 57 created an additional site for the restriction enzyme MaeII in PAX8 gene sequence. This was exploited to search for the mutation in a cohort of 49 patients with CH (27 with ectopy and 22 with hypoplasia or athyreosis), as well as in 17 normal individuals. None of these 49 patients or the 17 control individuals carried the mutation (data not shown). The second daughter of the family described above was asymptomatic and did not carry the mutation.

Functional activity of the C57Y mutant

To evaluate the functional relevance of the mutation we relied on the capacity of PAX8 to activate transcription from the TPO promoter (17). We investigated the ability of the C57Y PAX8 mutant to activate transcription of a reporter gene under the control of the human TPO promoter. HeLa cells were transfected with expression vector constructs encoding wild-type or mutant PAX8, together with a reporter gene construct containing the -366 to +50 region of the human TPO promoter, placed upstream of the coding sequence of a secreted thermoresistant form of alkaline phosphatase (SEAP).

In agreement with previous results (1), wild-type PAX8 stimulated transcription of the SEAP gene up to 20-fold (Fig. 3Go). In contrast, no activation was detected with the C57Y PAX8 mutant (Fig. 3Go), despite the fact that both proteins were well expressed, as demonstrated by Western blotting (Fig. 4Go). Cotransfection of the mutant with the wild-type PAX8 construct led to only minimal decreased of the TPO promoter transactivation (20%). There was, thus, no evidence of a dominant negative effect of the mutant, in agreement with the notion that PAX8 binds to DNA as a monomer (23).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 3. Failure of the mutant PAX8 to activate reporter gene transcription. Expression vectors encoding wild-type PAX8 (WT), mutant PAX8 (C57Y), and the empty pcDNA3 vector (TPOprom alone) were transiently transfected into HeLa cells together with the hTPOprom-SEAP reporter gene. Basal level corresponds to the basal chemiluminescence measured from mock-transfected cells. SEAP is quantitatively detected by chemiluminescence assay. Results are expressed in relative light units (RLU). When the activity observed with the empty vector is subtracted, the WT PAX8 allele stimulates transcription from hTPOprom-SEAP construct about 20-fold. Results are from duplicate plates (± range) from one representative out of four experiments giving similar results.

 


View larger version (108K):
[in this window]
[in a new window]
 
Figure 4. Expression of the wild-type and the mutant PAX8 in transfected HeLa cells. Western blot analysis was performed on HeLa cell extracts 48 h after transfection with pCDNA3 (CTRL, lane 1), hPAX8C57Y-pCDNA3 (C57Y, lane 2), or hPAX8WT-pCDNA3 (WT, lane 3). The blot was assayed with a rabbit anti-PAX8 antibody (22 ). The gray arrow shows the band corresponding to the expected size of the pax 8 protein.

 

    Discussion
 Top
 Abstract
 Introduction
 Experimental subjects
 Materials and Methods
 Results
 Discussion
 References
 
We have identified a novel loss-of-function mutation in transcription factor PAX8 in a familial, dominantly inherited, congenital thyroid hypoplasia. The patients, a mother and her second daughter, had CH with severe thyroid hypoplasia. The mutation, a G->A transition in codon 57, results in the substitution of a cysteine by a tyrosine (C57Y). Cysteine 57 (the homologue of cysteine 49 in the crystal structure of PAX6 paired domain; Ref. 24) is highly conserved among paired domains of all PAX proteins (Fig. 2bGo). It is located in the third {alpha}-helix of the N-terminal extremity of the paired domain, the PAI subdomain (25). This third helix is the "recognition" helix (26), which fits into the major groove of DNA and contacts base pairs 4–8 of the binding site. According to studies by Xu et al. (24) on the crystal structure of the paired domain of PAX6, cysteine 57 makes van der Waals contact with a thymidine and hydrogen bond with a guanine at base pairs 7 and 8 of the DNA binding site, respectively. It is likely that substitution of a cysteine residue by a tyrosine would severely interfere with the recognition phenomenon and, hence, abrogate transactivation. This provides a structural basis to our observation that the mutation completely abolishes transcription stimulation by PAX8 on a reporter gene placed under the control of the TPO promoter.

During embryogenesis, PAX8 is implicated in the early development of the thyroid gland (16), whereas in the adult it is involved in the regulation of expression of thyroid-specific genes (17, 18). Knockout mice homozygous for a null allele of Pax8 display severe thyroid hypoplasia, whereas heterozygotes were described as unaffected (12). The present cases, together with three other mutants described in a previous study (1), demonstrate that, in man, loss-of-function mutations of PAX8 are symptomatic in heterozygotes, leading to variable degrees of thyroid hypoplasia. In the two familial cases, transmission was clearly autosomal dominant (present study and Ref. 1). The discrepancy between the phenotypes observed in mouse and man can be attributed to a variety of causes: 1) it may be related to the inbred background of the mouse lines used in transgenic studies; 2) it could reflect species differences in the activity or affinity of the transcription factor for cis regulatory sequence(s) of (a) key developmental gene(s) under PAX8 control; and 3) it could be secondary to monoallelic expression of the PAX8 gene in human, whether associated or not with imprinting. Interestingly, monoallelic expression of another member of the PAX gene family (PAX5) (27) has recently been identified. However, to account for the dominant effect of loss-of-function mutations in the absence of parental imprinting, monoallelic expression should be associated with preferential expression of the mutant gene (allelic skewing). A similar difference between the consequences of loss-of-function mutations in man and mouse has been observed recently with the Nkx-2.5 gene. Whereas heterozygous knockout mice have no reported phenotype, mutation of a single allele in man is associated with cardiac malformation and/or conduction defects (28).

Loss-of-function mutations of PAX8 do not seem to be a major cause of CH secondary to TD. In a previous study (1), three mutations were found in a total of 145 patients by single-strand conformational polymorphism analysis, whereas we found one (not counting the mother) in 11 unrelated patients. Together with mutations of the TSH receptor gene and the very rare TITF2 mutations, they probably account for less than 10% of TD. However, current data indicate that in familial cases with either recessive or dominant transmission of thyroid hypoplasia, mutations of the TSH receptor or PAX8 genes should be considered, respectively. The cause of the bulk of sporadic cases of TD poses a challenge to geneticists. With the identification of new genes implicated in the development of the thyroid gland, and characterization of their functions, it will be possible to progress in the understanding of TD and evaluate the respective roles of genetic, epigenetic, and environmental factors.


    Acknowledgments
 
We thank Daniel Christophe and Pierre Vanrenterghem for discussions and a gift of anti-PAX8 antibody and Muriel Nguyen for technical assistance.


    Footnotes
 
1 Supported by the Belgian State, Prime Minister’s office, Service for Sciences, Technology and Culture; and by grants from the Fonds National de la Recherche Scientifique, Fond de la Recherche Scientifique Medicale, The Francqui Foundation, and BRAHMS Diagnostica. Back

2 "Aspirant" at the Belgian Fonds National de la Recherche Scientifique. Back

Received May 5, 2000.

Revised August 21, 2000.

Accepted September 11, 2000.


    References
 Top
 Abstract
 Introduction
 Experimental subjects
 Materials and Methods
 Results
 Discussion
 References
 

  1. Macchia PE, Lapi P, Krude H, et al. 1998 PAX8 mutations associated with congenital hypothroidism caused by thyroid dysgenesis. Nat Genet. 19:83–86.[CrossRef][Medline]
  2. Devos H, Rodd C, Gagne N, Laframboise R, Van Vliet G. 1999 A search for the possible molecular mechanisms of thyroid dysgenesis: sex ratios and associated malformations. J Clin Endocrinol Metab. 84:2502–2506.[Abstract/Free Full Text]
  3. Vassart G, Dumont JE, Refetoff S. 1995 The metabolic and molecular bases of inherited disease. Thyroid disorders, ed 7. London, New York, Tokyo: McGraw-Hill.
  4. Medeiros-Neto G, Targovnik HM, Vassart G. 1993 Defective thyroglobulin synthesis and secretion causing goiter and hypothyroidism. Endocr Rev. 14:165–183.[Abstract/Free Full Text]
  5. Abramowicz MJ, Targovnik HM, Varela V, et al. 1991 Identification of a mutation in the coding sequence of the human thyroid peroxidase gene causing congenital goiter. J Clin Invest. 90:1200–1204.
  6. Pohlenz J, Medeiros-Neto G, Gross JL, Silveiro SP, Knobel M, Refetoff S. 1997 Hypothyroidism in a Brazilian kindred due to iodide trapping defect caused by a homozygous mutation in the sodium/iodide symporter gene. Biochem Biophys Res Commun. 240:488–491.[CrossRef][Medline]
  7. Everett LA, Glaser B, Beck JC, et al. 1997 Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nat Genet. 17:411–422.[CrossRef][Medline]
  8. Abramowicz MJ, Duprez L, Parma J, Vassart G, Heinrichs C. 1997 Familial congenital hypothyroidism due to inactivating mutation of the thyrotropin receptor causing profound hypoplasia of the thyroid gland. J Clin Invest. 99:3018–3024.[Medline]
  9. Kimura S, Hara Y, Pineau T, et al. 1996 The T/ebp null mouse: thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, ventral forebrain, and pituitary. Genes Dev. 10:60–69.[Abstract/Free Full Text]
  10. Clifton-Bligh RJ, Wentworth JM, Heinz P, et al. 1998 Mutation of the gene encoding human TTF-2 associated with thyroid agenesis, cleft palate and choanal atresia. Nat Genet. 19:399–401.[CrossRef][Medline]
  11. De Felice M, Ovitt C, Biffali E, et al. 1998 A mouse model for hereditary thyroid dysgenesis and cleft palate. Nat Genet. 19:395–398.[CrossRef][Medline]
  12. Mansouri A, Chowdhury K, Gruss P. 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nat Genet. 19:87–90.[CrossRef][Medline]
  13. Lapi P, Macchia PE, Chiovato L, et al. 1997 Mutations in the gene encoding thyroid transcription factor-1 (TTF-1) are not a frequent cause of congenital hypothroidism (CH) with thyroid dysgenesis. Thyroid. 7:383–387.[Medline]
  14. Perna MG, Civitareale D, De Filippis V, Sacco M, Cisternino C, Tassi V. 1997 Absence of mutations in the gene encoding thyroid transcription factor-1 (TTF-1) in patients with thyroid dysgenesis. Thyroid. 7:377–381.[Medline]
  15. Kozmik Z, Kurzbauer R, Dorfler P, Busslinger M. 1993 Alternative splicing of Pax-8 gene transcripts is developmentally regulated and generates isoforms with different transactivation properties. Mol Cell Biol. 13:6024–6035.[Abstract/Free Full Text]
  16. Plachov D, Chowdhury K, Walther C, Simon D, Guenet JL, Gruss P. 1990 Pax8, a murine paired box gene expressed in the developing excretory system and thyroid gland. Development. 110:643–651.[Abstract/Free Full Text]
  17. Zannini M, Francis-Lang H, Plachov D, Di Lauro R. 1992 Pax-8, a paired domain-containing protein, binds to a sequence overlapping the recognition site of a homeodomain and activates transcription from two thyroid-specific promoters. Mol Cell Biol. 12:4230–4241.[Abstract/Free Full Text]
  18. Ohno M, Zannini M, Levy O, Carrasco N, Di Lauro R. 1999 The paired-domain transcription factor Pax8 binds to the upstream enhancer of the rat sodium/iodide symporter gene and participates in both thyroid-specific and cyclic-AMP-dependent transcription. Mol Cell Biol. 19:2051–2060.[Abstract/Free Full Text]
  19. Sambrook J, Fritsch EF, Maniatis T. 1989 Molecular cloning: a laboratory manual, ed 2. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
  20. Ansaldi M, Lepelletier M, Mejean V. 1996 Site-specific mutagenesis by using an accurate recombinant polymerase chain reaction method. Anal Biochem. 234:110–111.[CrossRef][Medline]
  21. Minamide LS, Bamburg JR. 1990 A filter paper dye-binding assay for quantitative determination of protein without interference from reducing agents or detergents. Anal Biochem. 190:66–70.[CrossRef][Medline]
  22. Van Renterghem P, Vassart G, Christophe D. 1996 Pax 8 expressoin in primary cultured dog thyrocyte is increased by cyclic AMP. Biochim Biophys Acta. 1307:97–103.[Medline]
  23. Pellizzari L, Tell G, Damante G. 1999 Cooperation between the PAI and RED subdomains of Pax-8 in the interaction with the thyroglobulin promoter. Biochem J. 337:253–262.
  24. Xu HE, Rould MA, Xu W, Epstein JA, Maas RL, Pabo CO. 1999 Crystal structure of the human Pax6 paired domain-DNA complex reveals specific roles for the linker region and carboxy-terminal subdomain in DNA binding. Genes Dev. 13:1263–1275.[Abstract/Free Full Text]
  25. Jun S, Desplan C. 1996 Cooperative interactions between paired domain and homeodomain. Development. 122:2639–2650.[Abstract]
  26. Xu W, Rould MA, Jun S, Desplan C, Pabo CO. 1995 Crystal structure of a paired domain-DNA complex at 2.5 A resolution reveals structural basis for Pax developmental mutations. Cell. 80:639–650.[CrossRef][Medline]
  27. Nutt SL, Vambrie S, Steinlein P, Weight A, Busslinger M. 1997 Abstract book of mouse molecular genetics. Heidleberg: EMBL Press.
  28. Schott JJ, Benson DW, Basson CT, et al. 1998 Congenital heart disease caused by mutations in the transcription factor NKX2–5. Science. 281:108–111.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
L. Codutti, H. van Ingen, C. Vascotto, F. Fogolari, A. Corazza, G. Tell, F. Quadrifoglio, P. Viglino, R. Boelens, and G. Esposito
The Solution Structure of DNA-free Pax-8 Paired Box Domain Accounts for Redox Regulation of Transcriptional Activity in the Pax Protein Family
J. Biol. Chem., November 28, 2008; 283(48): 33321 - 33328.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
E. Al Taji, H. Biebermann, Z. Limanova, O. Hnikova, J. Zikmund, C. Dame, A. Gruters, J. Lebl, and H. Krude
Screening for mutations in transcription factors in a Czech cohort of 170 patients with congenital and early-onset hypothyroidism: identification of a novel PAX8 mutation in dominantly inherited early-onset non-autoimmune hypothyroidism
Eur. J. Endocrinol., May 1, 2007; 156(5): 521 - 529.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Mittag, E. Winterhager, K. Bauer, and R. Grummer
Congenital Hypothyroid Female Pax8-Deficient Mice Are Infertile Despite Thyroid Hormone Replacement Therapy
Endocrinology, February 1, 2007; 148(2): 719 - 725.
[Abstract] [Full Text] [PDF]


Home page
Eur J EndocrinolHome page
S M Ng, S C Wong, D M Isherwood, and M Didi
Biochemical severity of thyroid ectopia in congenital hypothyroidism demonstrates sexual dimorphism
Eur. J. Endocrinol., January 1, 2007; 156(1): 49 - 53.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Baris, A. E. Arisoy, A. Smith, M. Agostini, C. S. Mitchell, S. M. Park, A. M. Halefoglu, E. Zengin, V. K. Chatterjee, and E. Battaloglu
A Novel Missense Mutation in Human TTF-2 (FKHL15) Gene Associated with Congenital Hypothyroidism But Not Athyreosis
J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4183 - 4187.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. M. Moya, G. Perez de Nanclares, L. Castano, N. Potau, J. R. Bilbao, A. Carrascosa, M. Bargada, R. Coya, P. Martul, E. Vicens-Calvet, et al.
Functional Study of a Novel Single Deletion in the TITF1/NKX2.1 Homeobox Gene That Produces Congenital Hypothyroidism and Benign Chorea But Not Pulmonary Distress
J. Clin. Endocrinol. Metab., May 1, 2006; 91(5): 1832 - 1841.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
V. Varela, C. M. Rivolta, S. A. Esperante, L. Gruneiro-Papendieck, A. Chiesa, and H. M. Targovnik
Three Mutations (p.Q36H, p.G418fsX482, and g.IVS19-2A>C) in the Dual Oxidase 2 Gene Responsible for Congenital Goiter and Iodide Organification Defect
Clin. Chem., February 1, 2006; 52(2): 182 - 191.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Y. M. Au, C. McBride, K. G. Wilhelm Jr., R. J. Koenig, B. Speller, L. Cheung, M. Messina, J. Wentworth, V. Tasevski, D. Learoyd, et al.
PAX8-Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Disrupts Normal PAX8 or PPAR{gamma} Transcriptional Function and Stimulates Follicular Thyroid Cell Growth
Endocrinology, January 1, 2006; 147(1): 367 - 376.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
G. Vassart and J. E. Dumont
Thyroid Dysgenesis: Multigenic or Epigenetic ... or Both?
Endocrinology, December 1, 2005; 146(12): 5035 - 5037.
[Full Text] [PDF]


Home page
EndocrinologyHome page
E. Amendola, P. De Luca, P. E. Macchia, D. Terracciano, A. Rosica, G. Chiappetta, S. Kimura, A. Mansouri, A. Affuso, C. Arra, et al.
A Mouse Model Demonstrates a Multigenic Origin of Congenital Hypothyroidism
Endocrinology, December 1, 2005; 146(12): 5038 - 5047.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Cao, F. Kambe, X. Lu, N. Kobayashi, S. Ohmori, and H. Seo
Glutathionylation of Two Cysteine Residues in Paired Domain Regulates DNA Binding Activity of Pax-8
J. Biol. Chem., July 8, 2005; 280(27): 25901 - 25906.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Grasberger, U. Ringkananont, P. LeFrancois, M. Abramowicz, G. Vassart, and S. Refetoff
Thyroid Transcription Factor 1 Rescues PAX8/p300 Synergism Impaired by a Natural PAX8 Paired Domain Mutation with Dominant Negative Activity
Mol. Endocrinol., July 1, 2005; 19(7): 1779 - 1791.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S M Park and V K K Chatterjee
Genetics of congenital hypothyroidism
J. Med. Genet., May 1, 2005; 42(5): 379 - 389.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. de Sanctis, A. Corrias, D. Romagnolo, T. DI Palma, A. Biava, G. Borgarello, P. Gianino, L. Silvestro, M. Zannini, and I. Dianzani
Familial PAX8 Small Deletion (c.989_992delACCC) Associated with Extreme Phenotype Variability
J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5669 - 5674.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. De Felice and R. Di Lauro
Thyroid Development and Its Disorders: Genetics and Molecular Mechanisms
Endocr. Rev., October 1, 2004; 25(5): 722 - 746.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Meeus, B. Gilbert, C. Rydlewski, J. Parma, A. L. Roussie, M. Abramowicz, C. Vilain, D. Christophe, S. Costagliola, and G. Vassart
Characterization of a Novel Loss of Function Mutation of PAX8 in a Familial Case of Congenital Hypothyroidism with In-Place, Normal-Sized Thyroid
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4285 - 4291.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
V. J. Gutnisky, C. M. Moya, C. M. Rivolta, S. Domene, V. Varela, J. V. Toniolo, G. Medeiros-Neto, and H. M. Targovnik
Two Distinct Compound Heterozygous Constellations (R277X/IVS34-1G>C and R277X/R1511X) in the Thyroglobulin (TG) Gene in Affected Individuals of a Brazilian Kindred with Congenital Goiter and Defective TG Synthesis
J. Clin. Endocrinol. Metab., February 1, 2004; 89(2): 646 - 657.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. Marinovic, C. Garel, P. Czernichow, and J. Leger
Additional Phenotypic Abnormalities with Presence of Cysts within the Empty Thyroid Area in Patients with Congenital Hypothyroidism with Thyroid Dysgenesis
J. Clin. Endocrinol. Metab., March 1, 2003; 88(3): 1212 - 1216.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Di Palma, R. Nitsch, A. Mascia, L. Nitsch, R. Di Lauro, and M. Zannini
The Paired Domain-containing Factor Pax8 and the Homeodomain-containing Factor TTF-1 Directly Interact and Synergistically Activate Transcription
J. Biol. Chem., January 24, 2003; 278(5): 3395 - 3402.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
P. Kopp
Perspective: Genetic Defects in the Etiology of Congenital Hypothyroidism
Endocrinology, June 1, 2002; 143(6): 2019 - 2024.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Leger, D. Marinovic, C. Garel, C. Bonaiti-Pellie, M. Polak, and P. Czernichow
Thyroid Developmental Anomalies in First Degree Relatives of Children with Congenital Hypothyroidism
J. Clin. Endocrinol. Metab., February 1, 2002; 87(2): 575 - 580.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
T. Congdon, L. Q. Nguyen, C. R. Nogueira, R. L. Habiby, G. Medeiros-Neto, and P. Kopp
A Novel Mutation (Q40P) in PAX8 Associated with Congenital Hypothyroidism and Thyroid Hypoplasia: Evidence for Phenotypic Variability in Mother and Child
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3962 - 3967.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vilain, C.
Right arrow Articles by Vassart, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vilain, C.
Right arrow Articles by Vassart, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals