help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maheshwari, H. G.
Right arrow Articles by Melmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maheshwari, H. G.
Right arrow Articles by Melmed, S.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 9 3409-3416
Copyright © 2000 by The Endocrine Society


Original Studies

Long-Acting Peptidomimergic Control of Gigantism Caused by Pituitary Acidophilic Stem Cell Adenoma1

Hiralal G. Maheshwari, Toni R. Prezant, Vivien Herman-Bonert, Hrayr Shahinian, Kalman Kovacs and Shlomo Melmed

Pituitary Center (H.G.M., T.R.P., V.H.-B., H.S., S.M.), Cedars-Sinai Research Institute, UCLA School of Medicine, Los Angeles, California 90048; and Department of Pathology (K.K.), St. Michael’s Hospital, University of Toronto, Ontario, M5B 1W8 Canada

Address correspondence and requests for reprints to: Shlomo Melmed, M.D., Academic Affairs, 2015, Cedars-Sinai Medical Center, 8700 Beverly Boulevard, Los Angeles, California 90048. E-mail: Melmed{at}csmc.edu


    Abstract
 Top
 Abstract
 Introduction
 Subject and Methods
 Results
 Discussion
 References
 
Gigantism is caused by GH hypersecretion occurring before epiphyseal long bone closure and usually is associated with pituitary adenoma. A 15-yr-old female patient presented with accelerated growth due to a large pituitary tumor that was surgically resected to relieve pressure effects. Second surgery to remove residual tumor tissue was followed by administration of octreotide LAR, a long-acting depot somatostatin analog, together with long-acting cabergoline. Height was over the 95th percentile, with evidence of a recent growth spurt. Serum GH levels were more than 60 ng/mL (normal, <10 ng/mL) with no suppression to 75 g oral glucose, and serum PRL (>8000 ng/mL; normal, <23 ng/mL) and insulin-like growth factor I levels (845 ng/mL; age-matched normal, 242–660 ng/mL) were elevated. Histology, immunostaining, and electron microscopy demonstrated a pituitary acidophil stem cell adenoma. Tumor tissue expressed both somatostatin receptor type 2 and dopamine receptor type 2. The Gs {alpha} subunit, GHRH receptor, and MEN1 genes were intact, and tumor tissue abundantly expressed pituitary tumor transforming gene (PTTG). Serum GH and PRL levels were controlled after two surgeries, and with continued cabergoline and octreotide LAR GH, PRL, and insulin-like growth factor I levels were normalized. In conclusion, administration of long-acting somatostatin analog every 4 weeks in combination with a long-acting dopamine agonist biweekly controlled biochemical parameters and accelerated growth in a patient with gigantism caused by a rare pituitary acidophil stem cell adenoma.


    Introduction
 Top
 Abstract
 Introduction
 Subject and Methods
 Results
 Discussion
 References
 
GIGANTISM characterized by excessive height and body proportions is rarely encountered and is caused by increased GH secretion occurring before epiphyseal fusion. GH hypersecretion in these patients can be due to either a somatotroph pituitary adenoma (1), a mammosomatotroph adenoma arising during childhood or puberty (1), or mammosomatotroph hyperplasia (2). Gigantism is associated with increased morbidity, and biochemical control of serum GH and insulin-like growth factor I (IGF-I) levels is rarely attained (1). Until recently, therapeutic options available for children harboring GH-secreting pituitary tumors were limited to surgery or radiation. Recent introduction of long-acting dopamine agonists and depot preparations of somatostatin analogs has provided novel long-term therapeutic options (3, 4, 5). Here, we report a 15-yr-old female patient with accelerated growth due to a massive pituitary acidophil stem cell adenoma. The tumor expressed both dopamine D2 and somatostatin SSTR2 receptors, thus allowing for effective treatment with cabergoline, a long-acting dopamine agonist, and octreotide LAR, a depot somatostatin analog, with resultant normalization of endocrinological parameters.


    Subject and Methods
 Top
 Abstract
 Introduction
 Subject and Methods
 Results
 Discussion
 References
 
Clinical studies

A 15-yr-old adopted girl was referred for evaluation of a sellar mass discovered on magnetic resonance imaging (MRI) scan performed after removal of a large nasal polyp. She complained of daily headaches, blurred vision, mild diplopia, generalized tiredness, daytime sleepiness, and loss of interest in school. She had noticed increased height of nearly three inches over the previous year and believed that she was still growing. She required size 101/2 shoes, her feet were still enlarging, finger rings had become tight and no longer fit, and she required braces over the upper and lower teeth. The patient had primary amenorrhea, with no history of vaginal spotting, breast discharge, or oral contraceptives ingestion.

Biochemical and hormone assays

SMA 20 profile was determined by a standard procedure; serum GH, PRL, FSH, LH, {alpha} subunit, T4, cortisol, and testosterone by RIAs; and TSH by immunoradiometric assay. Serum GHRH and IGF-I levels were measured at Quest Diagnostics Inc. (Teterboro, NJ).

Molecular analysis

RT-PCR. Total RNA was prepared from the homogenized tumor using TRIZOL reagent (BRL). Two micrograms of total RNA were treated with amplification-grade DNase I (Life Technologies, Inc., Rockville, MD), annealed with oligo (dT), and treated with (+RT) or without (-RT) SuperScript II (Life Technologies, Inc.). Fifty nanograms of cDNA or RNA (-RT reaction) were amplified in 40 cycles of 94 C, 15 sec, 62 C, 30 sec, and 68 C, 2 min in reactions containing 0.2 mM dNTPs, 0.3 mM primers, 1x buffer with 1.5 mM MgCl2, and 3.5 U Expand High Fidelity PCR system (Roche Molecular Biochemicals, Indianapolis, IN). AmpliTaq Gold and its corresponding buffer (Applied Biosystems, Foster City, CA) were used for some PCR reactions, with a 10-min 94 C pretreatment to activate the enzyme.

PCR. Genomic DNA (150 ng) isolated with the QIAamp (QIAGEN Inc., Valencia, CA) was amplified with GHRHR primer pairs.

Sequence analysis. gsp cDNA and GHRH receptor (GHRHR) genomic DNA products were sequenced with ThermoSequenase, 33P-ddNTPs and dITP mix (Amersham Pharmacia Biotechnologies Inc., Piscataway, NJ), electrophoresed in 6% acrylamide/8.3 M urea gel (SequaGel; National Diagnostics Inc., Atlanta, GA), and autoradiographed on Kodak BioMax MR film. gsp cDNA was sequenced with gsp7F primer, and GHRHR PCR products were sequenced with GHRHR-9iF or GHRHR-10iF and GHRHR-1182R primers.

PTTG expression. PTTG expression was assayed as reported previously (6).

Primers (Life Technologies, Inc. The following primers were used for PCR amplification and sequence analysis: SSTR1-F 5', AAATGCGTCCCAGAACGGGACCT; SSTR1-R 5', CAGGTTCTCAGGTTGGAAGTCTT; SSTR2-F 5', TGACCTCAATGGCTCTGTGGTG; SSTR2-R 5', TCTCCTCCACTTGGCCGACTT; SSTR3-F 5', ATCATCGGTGTCCACGACCTCA; SSTR3-R 5', GAACTGGTTGATGCCATCCACC; SSTR4-F 5', GCATGGTCGCTATCCAGTGCA; SSTR4-R 5', GTGAGACAGAAGACGCTGGTG; SSTR5-F 5', AACACGCTGGTCATCTACGTGGT; SSTR5-R 5', AGACACTGGTGAACTGGTTGAC; DRD2-F 5', GTCCTGTCCTTCACCATCTCCTG; DRD2-R 5', TGCCCATTCTTCTCTGGTTTGGC; gsp7F 5', GTGATCAAGCAGGCTGACTATGTG; gsp10R 5', GCTGCTGGCCACCACGAAGATGAT; GHRHR-9iF 5', CCTTGTCTTCCACCTTCCTATGC; GHRHR-10iF 5', CCCAGTCTTGGGAGCCTAGGA; GHRHR-10iR 5', CTTTCCCAGTATCCCCAGACAC; GHRHR-1182R 5', GCAGTAGAGGATGGCAACAATGAA; GHRHR-261F 5', TGGCGAGTGGGTCACCCTCC; GHRHR-631R 5', GGTCAGTGTCGTCGCTGTGG; PTTG-150a 5', CGATGCCCCACCAGCCTTACC; PTTG-466b 5', CAAGCTCTCTCTCCTCGTCAAGG; actin-60F 5', GCGCTCGTCGTCGACAACGG; actin-1196R 5', GTGTAACGCAACTAAGTCATAGTC; men1-966F 5', CTAGAGGAGCTGGAGCCCACC; and men1-8090R 5', CCCCACAAGCGGTCCGAAGTC.


    Results
 Top
 Abstract
 Introduction
 Subject and Methods
 Results
 Discussion
 References
 
Patient characteristics

Physical examination revealed a 179-cm (5 feet, 101/2 inches) female patient, weighing 64.5 kg (142 lb.), with normal blood pressure (110/75 mm Hg). Growth (Fig. 1Go) had accelerated between 141/2 and 151/2 yr of age, well above the 95th percentile. There was no acne, hypo- or hyper-pigmentation, skin tags, or detectable visual abnormalities. Mild jaw prognathism with a mild overbite was evident, and tooth braces were present with a 1 to 2-mm gap between the upper incisors. Breasts and pubic hair were Tanner stage II, with a normal female escutcheon and no evidence for galactorrhea.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. a, The patient’s growth and weight chart (•) with normal growth and weight curves (solid lines, 5th, 50th, 75th, and 95th percentile). ({circ}) Measurements subsequent to therapeutic intervention. b, The extent of tumor invasion as visualized with coronal and lateral MRI views and their outlines.

 
Biochemical findings

Endocrine laboratory testing revealed serum PRL levels of 8700 ng/mL (normal, <23 ng/mL). Baseline serum GH was 64 ng/mL (normal, <10 ng/mL; glucose level 95 mg%), and remained elevated (71 ng/mL) 2 h after ingestion of 75 g oral glucose (glucose level, 83 mg%); serum IGF-I levels were 845 ng/mL (age-matched reference range, 242–660 ng/mL); GHRH, 21 pg/mL (normal, <50 pg/mL); {alpha} subunit, 3.7 ng/mL (normal, <1.2 ng/mL); TSH, 1.8 mU/L; total T4, 6.5 ug/dL; LH, 0.07 IU/L; and FSH, 0.1 IU/L. Baseline cortisol concentration of 3.7 ug/dL (normal, 4–16 ug/dL) rose to 19 ug/dL (16–35 ug/dL) 1 h after cosyntropin administration.

Radiological examination

MRI scan (Fig. 1Go) revealed a very large confluent mass occupying the paranasal sinuses, as well as the entire sella displacing the posterior clinoid process posteriorly. Tumor tissue surrounded both internal carotid arteries and involved the posterior orbits, extending into the superior orbital fissures with displacement of the optic nerves. MRI scans of the chest and abdomen were normal. Left wrist x-ray indicated a 26-month delayed bone age (TW2 method).

Treatment plans

In view of the presence of a large invasive macroadenoma, it was decided to initially debulk the tumor by trans-sphenoidal resection and to obtain tumor histology. Cabergoline therapy was then initiated, followed by second surgery for resection of residual tumor mass. Following second surgery, a depot slow-release somatostatin analog (LAR) was added in addition to cabergoline.

Pathology

Tumor tissue was processed for histologic and immunocytological examination. Light microscopy showed a partly chromophobic partly acidophilic pituitary adenoma with a diffuse growth pattern and mild cellular and nuclear pleomorphism. On electron microscopy (Fig. 2Go), the main feature of the adenoma was the variability in cellularity, nuclear size, and cytoplasmic organization. Nuclei were irregular, with prominent nucleoli and substantial heterochromatin. Three cell types were apparent: the dominant cell type had eccentric, tightly packed pleomorphic nuclei, well-organized rough endoplasmic reticulum (RER), suggestive of a pleurihormonal acidophil stem cell. Some cells displayed oncocytic changes. The second cell type possessed masses of well organized lamellar RER and large Golgi area, with few small secretory granules, representing PRL cells with high secretory activity. The third cell type showed foci of varying sizes and consisted of small to middle-sized ovoid or polyhydral closely apposed densely granulated cells. These cells have lesser quantities of peripheral RER and numerous dense secretory granules measuring up to 400 nm. These ultrastructural appearances were consistent with densely granulated GH cells. All three cell types were intermingled, representing an atypical plurimorphous acidophil stem cell adenoma of the pituitary.



View larger version (96K):
[in this window]
[in a new window]
 
Figure 2. Electron microscopy, immunostaining, and molecular studies of tumor tissue. a–c, Electron micrographs. a, Tumor cells having irregular nucleus, parallel arrays of RER as both fibrous body (*), and exocytosis (->), a hallmark of acidophil adenoma (x12760). b, Small, atypical tumor cells possessing markedly irregular nucleus, poorly developed membranous organelles minute >100 nm) secretory granules and loosely built fibrous body ({blacktriangleright}). These cells represent acidophil stem cell or sparse granulated GH cells (x8700). c, Electron micrograph demonstrates a mixed population of sparsely granulated small granular cells as well as larger cells ({blacktriangleright}) consistent with densely granulated GH cells (x8700). d, RT-PCR and restriction analyses. Lanes 1, 2, and 3 show negative RT, RT-PCR of SSTR2 (408 bp), and its restriction digestion with HincII producing two bands each of 384 bp and 24 bp in size. Lanes 4, 5, and 6 show the negative RT, RT-PCR of SSTR5 (210 bp), and its restriction digestion with Hinc II producing 192 and 18 bp size products, respectively; lanes 7, 8, and 9 show negative RT, RT-PCR of DRD2 (508 bp), and its restriction with Bg1II resulting into 356 and 152 size products; lanes 10, 11, and 12 show negative RT, RT-PCR of SSTR1 (990 bp), and its restriction with SacII (468-, 444-, and 78-bp size products), respectively; and lanes 13, 14, and 15 show the similar pattern of GHRHR, RT-PCR product size 370 bp, and restriction with PvuII generated 292- and 78-bp size products. Results of immunostaining using the streptavadin-biotin-peroxidase complex method for GH (e), PRL (f), and {alpha}-subunit (g), whereas immunostaining with MIB-1 is shown in panel h.

 
Streptavadin-biotin-peroxidase staining (Fig. 2Go) revealed strong PRL, GH, and {alpha} subunit immunoreactivity in the adenoma cell cytoplasm. Immunostaining was negative for ACTH, ß TSH, ß FSH, and ß LH. Immunostaining with MIB-1, a cell proliferation marker, showed a high labeling index (5%), indicating a rapid proliferation rate.

Molecular studies

RT-PCR of tumor tissue revealed appropriate gene expression for somatostatin receptor types 1, 2, 3, and 5, dopamine receptor type 2 (DRD2), GHRHR, MEN1, and Gs {alpha}. Identity of PCR products was confirmed by appropriate restriction digestion, and representative restriction products of somatostatin receptors, DRD2, and GHRH receptor are shown in Fig. 2Go. The genomic sequence of GHRHR in its transmembrane domain (TM) 5, intracytoplasmic loop 3, TM6, and part of TM7 was intact. The Gs {alpha} cDNA sequence was normal between nt 644-79, thus excluding heterozygous or homozygous changes in codons 201 or 227, characteristic of the gsp oncogene. The PTTG to cyclophilin A ratio was 5.2-fold higher than obtained in five normal pituitary controls.

Treatment and post surgical follow-up

The biochemical profile shown in Fig. 3Go depicts declining postoperative serum PRL (3874 ng/mL from >8000 ng/mL) and unchanged serum GH and IGF-I levels. Serum GH levels were 70 ng/mL 2 h postoral glucose administration, and IGF-I levels (1272 ng/mL) were persistently elevated, as were {alpha} subunit levels (1.2 ng/mL). Cabergoline, 0.5 mg biweekly, was initiated, and, 1 month later, PRL levels had decreased to 1228 ng/mL. Five months after the first transsphenoidal surgery, serum PRL (1623 ng/mL), IGF-I (816 ng/mL), and GH (48 and 58 ng/mL, baseline and 2-h postoral glucose) remained elevated, despite continuous cabergoline treatment (up to 0.75 mg biweekly). A second surgery was performed via fronto-pterional craniotomy to resect the large residual tumor mass. Postoperatively, serum PRL levels were 901 ng/mL, GH was 17 ng/mL (baseline) and 14 ng/mL (2-h postoral glucose), and IGF-I levels were 1171 ng/mL. Serum {alpha} subunit levels were normalized (0.7 ng/mL). Octreotide LAR depot, 20 mg every 4 weeks, was initiated, and the dose increased to 30 mg every 4 weeks. Combination of octreotide LAR (administered every 4 weeks) with cabergoline normalized serum GH and IGF-I levels (Fig. 3Go). Growth rate decreased to nearly 2.5 cm/yr from 12 cm/yr after treatment initiation (Fig. 1Go, top).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Biochemical response to management: arrows indicate the time of surgeries, and horizontal bars show start, duration, and doses of cabergoline and octreotide during therapeutic follow-up. The dotted line in each panel indicates upper normal level of the corresponding hormone.

 

    Discussion
 Top
 Abstract
 Introduction
 Subject and Methods
 Results
 Discussion
 References
 
This tumor exhibits the characteristic features of a pleurihormonal acidophilic stem cell adenoma, evidenced by immunohistochemistry and electron microscopy. Very high serum PRL and GH levels were associated with tumor tissue composed of a mixture of immature cells, and GH and PRL cells. Acidophil stem cell adenomas are rarely encountered. Horvath et al. (7) reported a 4.3% prevalence of such tumors of 347 surgically removed pituitary tumors. The duration of clinical history ranged from a few months to 5 yr in patients harboring these tumors (7). These bihormonal adenomas, producing GH and PRL, may be associated with gigantism, as reported in a 21/4 yr-old boy (8), a 41/2 yr-old girl (9), and more recently in a 8-yr-old boy (10). Gigantism can also be attributed to pituitary mammosomatotroph hyperplasia (2); McCune-Albright syndrome associated with a pituitary adenoma, occasionally with a mutation of Gs {alpha} subunit (11); or "chromophobic" pituitary adenoma (12, 13) (Table 1GoGo). The tumor in this patient was aggressive, as evidenced by accelerated clinical symptoms, and high MIB-1 labeling index. Pituitary adenomas with a MIB-1 labeling index of greater than 3% are nearly always grossly invasive lesions, compared with an index of less than 1% in normal pituitary tissue (14).


View this table:
[in this window]
[in a new window]
 
Table 1. Therapeutic outcome of reported cases of gigantism

 

View this table:
[in this window]
[in a new window]
 
Table 1A. Continued

 
Tumors causing gigantism can be treated by surgery, radiation, and primary or adjuvant pharmacotherapy. Somatostatin analog octreotide was administered sc after surgery to achieve biochemical control of a bihormonal pituitary adenoma in a 21/4 yr-old boy (8) and as a continuous sc infusion in a pubertal boy with presumable diffuse somatotroph hyperplasia (24). A 4-yr-old girl with mamosomatotroph hyperplasia was treated with combined surgery, dopaminergic analog, and octreotide sc infusion (2). Although long-acting depot preparations of somatostatin analog (octreotide LAR) have been used to treat pituitary tumors (5, 25, 26, 27), this is the first report where postoperative biochemical control of an acidophilic tumor of the pituitary in an adolescent patient with gigantism was sustained by using a long-acting dopamine agonist together with a depot somatostatin analog. These two agents are safe and well tolerated, and the patient has no evidence of echogenic gallbladder lesions.

Although the etiology of pituitary tumors is not fully elucidated, several molecular alterations may be involved in their pathogenesis. Normal serum GHRH levels, and normal chest and abdomen MRI and computed tomography scans excluded the presence of a GHRH-producing ectopic tumor causing pituitary enlargement. Circulating GHRH levels are elevated in patients with ectopic GHRH production and somatotroph hyperplasia (28). About 40% of somatotroph tumors (29, 30) and some mammosomatotroph tumors (31) harbor an activating mutation of the {alpha} chain of Gs protein gsp. Some pituitary tumors exhibit GHRHR gene splice site mutations (32), and, in some familial tumors, MEN1 gene mutations have been described (33, 34, 35), but not in sporadic pituitary tumors (36). This tumor tissue was shown to express intact GHRHR and MEN1 genes. The finding of elevated PTTG gene expression in tumor tissue is consistent with recent reports of increased PTTG expression in pituitary tumors (6). Thus, this aggressive pituitary macroadenoma had no loss of MEN1, no evidence of gsp mutation, and intact GHRH, dopamine, and somatostatin receptor expression.

The two major inhibitory peptides controlling GH and PRL secretion are somatostatin and dopamine, respectively. Whereas dopamine agonists (bromocriptine and cabergoline) act through the DRD2 (37), the inhibitory effect of somatostatin is mediated via receptor (SSTR) subtypes 2 and 5 (38), expressed on pituitary tumor cells. Up to five specific SSTR subtypes are described (39). This tumor was shown to express SSTR subtypes 1, 2, 3, 5, and dopamine receptor type D2. Expression of both receptor types provided strong rationale for using dopamine receptor agonists and SRIF analogs and correlated well with biochemical response to these agents. The initial debulking surgery with subsequent administration of long-acting dopamine agonist, cabergoline failed to achieve complete biochemical control. Although PRL levels decreased markedly, GH levels were not normalized and circulating IGF-I levels remained elevated. Octreotide LAR injections controlled GH and IGF-I levels within 6 months.

In summary, hormone hypersecretion in this adolescent patient harboring a large aggressive pituitary acidophil stem cell adenoma was effectively biochemically controlled by combined therapy with a dopamine agonist and a long-acting depot somatostatin analog. Thus, sustained suppression of tumoral hypersecretion and accelerated growth were achieved with a relatively convenient and safe regimen of long-acting peptidomergic therapy. Whether or not long-term tumor regrowth will be controlled remains to be determined.


    Footnotes
 
1 Supported by NIH Grant CA-75979 and the Doris Factor Molecular Endocrinology Laboratory. Back

Received December 29, 1999.

Revised March 1, 2000.

Revised May 19, 2000.

Accepted June 7, 2000.


    References
 Top
 Abstract
 Introduction
 Subject and Methods
 Results
 Discussion
 References
 

  1. Daughaday WH. 1992 Pituitary gigantism. Endocrinol Metab Clin North Am. 21:633–647.[Medline]
  2. Moran A, Asa SL, Kovacs K, et al. 1990 Gigantism due to pituitary mammosomatotroph hyperplasia. N Eng J Med. 323:322–326.[Medline]
  3. Muratori M, Arosio M, Gambino G, Romano C, Biella O, Faglia G. 1997 Use of cabergoline in the treatment of hyperprolactinemic and acromegalic patients. J Endocrinol Invest. 20:537–546.[Medline]
  4. Abs R, Verhelst J, Maiter D, et al. 1998 Cabergoline in the treatment of acromegaly: a study in 64 patients. J Clin Endocrinol Metab. 83:374–378.[Abstract/Free Full Text]
  5. Newman CB, Melmed S, George A, et al. 1998 Octreotide as primary treatment of acromegaly. J Clin Endocrinol Metab. 83:3034–3040.[Abstract/Free Full Text]
  6. Zhang X, Horwitz GA, Heaney AP, et al. 1999 Pituitary tumor transforming gene (PTTG) expression in pituitary adenomas. J Clin Endocrinol Metab. 84:761–767.[Abstract/Free Full Text]
  7. Horvath E, Kovacs K, Singer W, et al. 1981 Acidophil stem cell adenoma of the human pituitary: clinicopathologic analysis of 15 cases. Cancer. 47:761–771.[CrossRef][Medline]
  8. Gelber SJ, Heffez DS, Donohoue PA. 1992 Pituitary gigantism caused by growth hormone excess from infancy. J Pediatr. 120:931–934.[CrossRef][Medline]
  9. Fazekas I, Pasztor E, Slowik F, et al. 1993 Pathological and experimental investigation in a case of gigantism. Acta Neuropathol. 85:167–174.[Medline]
  10. Dubuis J-M, Deal CL, Drews RT, et al. 1995 Mammosomatotroph adenoma causing gigantism in an 8-year old boy: a possible pathogenetic mechanism. Clin Endocrinol. 42:539–549.[Medline]
  11. Dotsch J, Kiess JD, Hanze J, et al. 1996 Gs {alpha} mutation at codon 201 in pituitary adenoma causing gigantism in a 6-year-old boy with McCune-Albright syndrome. J Clin Endocrinol Metab. 81:3839–3842.[Free Full Text]
  12. Joishey SK, Morrow LB. 1976 McCune-Albright syndrome associated with a functioning pituitary chromophobe adenoma. J Pediatr. 89:73–75.[CrossRef][Medline]
  13. Yoshida T, Shimatsu A, Sakane N, Hizuka N, Horikawa R, Tanaka T. 1996 Growth hormone (GH) secretory dynamics in a case of acromegalic gigantism associated with hyperprolactinemia: nonpulsatile secretion of GH may induce elevated insulin-like growth factor-I (IGF-I) and IGF-binding protein-3 levels. J Clin Endocrinol Metab. 81:310–313.[Abstract]
  14. Thapar K, Kovacs K, Scheithauer BW, et al. 1996 Proliferative activity and invasiveness among pituitary adenomas and carcinomas: an analysis using the MIB-1 antibody. Neurosurgery. 38:99–107.[CrossRef][Medline]
  15. Fraiser SD, Kogut MD. 1967 Adolescent acromegaly: studies of growth-hormone and insulin metabolism. J Pediatr. 71:832–839.[CrossRef][Medline]
  16. Espiner EA, Carter TA, Abbott GD, Wrightson P. 1981 Pituitary gigantism in a 31 months old girl: endocrine studies and successful response to hypophysectomy. J Endocrinol Invest. 4:445–450.[Medline]
  17. Zampieri P, Scanarini M, Sicolo N. 1983 The acromegaly-gigantism syndrome. Report of four cases treated surgically. Surg Neurol. 20:498–503.[CrossRef][Medline]
  18. Von Werder K, Losa M, Muller OA, Schweiberer L, Fahlbusch R, del Pozo E. 1984 Treatment of metastasising GRF-producing tumor with a long-acting somatostatin analogue. Lancet. 2:282–283.[Medline]
  19. Ritzen EM, Wettrell G, Davies G, Grant DB. 1985 Management of pituitary gigantism. The role of bromocriptine and radiotherapy. Acta Paediatr Scand. 74:807–814.[Medline]
  20. Anniko M, Ritzen EM. 1986 Pituitary tumor causing gigantism. Morphology and in vitro hormone secretion. J Otorhinolargnol Relat Spec. 48:180–191.
  21. Blumberg DL, Sklar CA, David R, Rothenberg S, Bell J. 1989 Acromegaly in an infant. Pediatrics. 83:998–1002.[Abstract/Free Full Text]
  22. Lu PW, Silink M, Johnston I, Cowell CT, Jimenez M. 1992 Pituitary gigantism. Arch Dis Child. 67:1039–1041.[Abstract/Free Full Text]
  23. Zimmerman D, Young WF, Ebersold MJ, et al. 1993 Congenital gigantism due to growth hormone-releasing hormone excess and pituitary hyperplasia with adenomatous transformation. J Clin Endocrinol Metab. 76:216–222.[Abstract]
  24. Nanto-Salonen K, Koskinen P, Sonninen P, Toppari J. 1999 Suppression of GH secretion in pituitary gigantism by continuous subcutaneous octreotide infusions in a pubertal boy. Acta Paediatr. 88:29–33.[Medline]
  25. Drange MR, Melmed S. 1998 Long-acting lanreotide induces clinical and biochemical remission of acromegaly caused by disseminated growth hormone-releasing hormone-secreting carcinoid. J Clin Endocrinol Metab. 83:3104–3109.[Abstract/Free Full Text]
  26. Davies PH, Stewart SE, Lancranjan L, Sheppard MC, Stewart PM. 1998 Long-term therapy with long-acting octreotide (Sandostatin-LAR) for the management of acromegaly. Clin Endocrinol (Oxf.) 48:311–316.
  27. Suliman M, Jenkin R, Ross R, Powell T, Battersby R, Cullen DR. 1999 Long-term treatment of acromegaly with the somatostatin analogue SR-lantreotide. J Endocrinol Invest. 22:409–418.[Medline]
  28. Thorner MO, Perryman RL, Cronin MJ, et al. 1982 Somatotroph hyperplasia. Succuessful treatment of acromegaly by removal of a pancreatic islet tumor secreting a growth hormone-releasing factor. J Clin Invest. 70:965–977.
  29. Landis CA, Masters SB, Spada A, Pace AM, Bourne HR, Vallar L. 1989 GTPase inhibiting mutations activate the {alpha} chain of Gs and stimulate adenylyl cyclase in human pituitary tumors. Nature. 340:692–696.[CrossRef][Medline]
  30. Lyons J, Landis CA, Harsh G, et al. 1990 Two G protein oncogenes in human endocrine tumors. Science. 249:655–659.[Abstract/Free Full Text]
  31. Drews RT, Gravel RA, Collu R. 1992 Identification of G protein {alpha} subunit mutations in human growth hormone (GH)- and GH/prolactin-secreting pituitary tumors by single-strand conformation polymorphism (SSCP) analysis. Mol Cell Endocrinol. 87:125–129.[CrossRef][Medline]
  32. Hashimoto K, Koga M, Motomura T, et al. 1995 Identification of alternatively spliced messenger ribonucleic acid encoding truncated growth hormone-releasing hormone receptor in human pituitary adenomas. J Clin Endocrinol Metab. 80:2933–2939.[Abstract/Free Full Text]
  33. Bale AE, Norton JA, Wong EL, et al. 1991 Allelic loss on chromosome 11 in hereditary and sporadic tumors related to familial multiple endocrine neoplasia type 1. Cancer Res. 51:1154–1157.[Abstract/Free Full Text]
  34. Thakker RV, Pook MA, Wooding C, Boscaro M, Scanarini M, Clayton RN. 1993 Association of somatotrophinomas with loss of alleles on chromosome 11 and with gsp mutations. J Clin Invest. 91:2815–2821.
  35. Agarwal SK, Kester MB, Debelenko LV, et al. 1997 Germline mutations of the MEN1 gene in familial multiple endocrine neoplasia type 1 and related states. Hum Mol Genet. 6:1169–1175.[Abstract/Free Full Text]
  36. Prezant TR, Levine J, Melmed S. 1998 Molecular characterization of the men1 tumor suppressor gene in sporadic pituitary tumors. J Clin Endocrinol Metab. 83:1388–1391.[Abstract/Free Full Text]
  37. Jaffe CA, Barkan AL. 1992 Treatment of acromegaly with dopamine agonists. Endocrinol Metab Clin North Am. 21:712–735.
  38. Shimon I, Yan X, Taylor JE, Weiss MH, Culler MD, Melmed S. 1997 Somatostatin receptor (SSTR) subtypes-selective analogues differentially suppress in vitro growth hormone and prolactin in human pituitary adenomas. Novel potential therapy for functional pituitary tumors. J Clin Invest. 100:2386–2392.[Medline]
  39. Schonbrunn A. 1999 Somatostatin receptors present knowledge and future directions. Ann Oncol. 10(Suppl 2):S17–S21.



This article has been cited by other articles:


Home page
NEJMHome page
S. Melmed
Acromegaly
N. Engl. J. Med., December 14, 2006; 355(24): 2558 - 2573.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S.-G. Ren, S. Kim, J. Taylor, J. Dong, J.-P. Moreau, M. D. Culler, and S. Melmed
Suppression of Rat and Human Growth Hormone and Prolactin Secretion by a Novel Somatostatin/Dopaminergic Chimeric Ligand
J. Clin. Endocrinol. Metab., November 1, 2003; 88(11): 5414 - 5421.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maheshwari, H. G.
Right arrow Articles by Melmed, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maheshwari, H. G.
Right arrow Articles by Melmed, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals