| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Pathology, Brigham and Womens Hospital (G.L.M., M.-C.L., J.T.F.), Boston, Massachusetts 02115; Department of Adult Oncology, Dana Farber Cancer Institute (J.B.K.), Boston, Massachusetts 02115; Clinical Cancer Genetics and Human Cancer Genetics Programs, Ohio State University Comprehensive Cancer Center (J.B.K., C.E.), Columbus, Ohio 43210
Address all correspondence and requests for reprints to: George L. Mutter, M.D., Department of Pathology, Brigham and Womens Hospital, 75 Francis Street, Boston, Massachusetts 02115. E-mail: gmutter{at}rics.bwh.harvard.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
An intriguing feature common to many organs prone to develop somatic PTEN mutant tumors is steroid hormone responsiveness. In the case of sporadic endometrial adenocarcinomas, nonphysiological aberrations of sex hormone levels have been repeatedly defined by epidemiological studies as the major risk factor for this disease (11). Is there a relationship between PTEN expression and steroid hormone levels that might link the observed high PTEN mutational rate and hormonal endometrial risk factors? To date, there is no direct link between steroid hormone response and PTEN function. As a primary target organ for sex hormones, the endometrium is an exquisite barometer by which the hormonal environment can be measured. The morphological appearance of endometrium during the latter half of the cycle is sufficiently stereotypical that a trained pathologist can predict the actual menstrual date (±48 h) of a blinded histological specimen. It is thus possible to classify endometrial tissues by histological appearance and infer with a high level of confidence their menstrual age and ambient hormonal conditions.
We have selected normal endometrial tissues from throughout the normal cycle for PTEN expression analysis and interpreted our findings in light of the distinctive hormonal profiles that distinguish its phases. Immunohistochemistry permitted further resolution of which cell types contribute to the overall PTEN expression within this complex and dynamic tissue.
| Materials and Methods |
|---|
|
|
|---|
Snap-frozen endometrial samples were obtained as discarded materials from hysterectomies of women undergoing surgery for benign, nonendometrial, uterine disease (usually uterine prolapse or fibroids). Endometrial histology was evaluated by review of hematoxylin- and eosin-stained paraffin histological sections obtained at the time of tissue allocation. Endometria from four premenopausal (no exogenous hormone administration, age <50 yr) cycling women included two proliferative and two secretory endometria. An additional hysterectomy specimen from a postmenopausal patient with an atrophic endometrium was included along with myometrium as a control.
Paraffin blocks of histologically normal endometria were retrieved by diagnosis from the pathology files of Brigham and Womens Hospital. All patients were less than 50 yr old, clinically premenopausal, and without intrinsic endometrial disease or recent history of hormone administration. Histological sections were reviewed by a gynecological pathologist (G.L.M.) for assignment of menstrual date according to a standardized 28-day cycle (12). Day assignments of 40 accessioned normal endometria correspond to sequential hormonal and histological events beginning with the first day of menses as follows: menses, days 14 (n = 4); proliferative phase, days 515 (n = 8); early secretory endometrium, days 1618 (n = 7); midsecretory endometrium, days 1924 (n = 7); and late secretory endometrium, days 2528 (n = 15).
RT-PCR
RNA was isolated by lysis in guanidine isothiocyanate and selective precipitation with lithium chloride (13). RT of 10 µg total RNA with random hexamers and SuperScript reverse transcriptase (Life Technologies, Inc.\\g>-BRL, Gaithersburg, MD) was performed according to the manufacturers instructions. Identical RNA aliquots underwent parallel manipulation, except for the addition of reverse transcriptase. A constant quantity of resultant complementary DNAs or RNAs without RT was amplified by PCR for 27 PCR cycles at an annealing temperature of 50 C with one of three different PTEN primer sets and a control ß-actin primer (Research Genetics, Inc., Huntsville, AL; catalogue no. M502) (14). The number of PCR cycles was bracketed between 2232 to identify a linear range of amplification for the PCR conditions used; 27 cycles was the midlinear range for the primers used. PCR reactions were performed in a 50-µL reaction mix [10 mmol/L Tris (pH 8.4), 50 mmol/L KCl, 20 µg/ml gelatin, 1.5 mmol/L MgCl, oligonucleotide primers 0.1 µmol/L of each, 0.2 mmol/L deoxy (d)-ATP, 0.2 mmol/L dGTP, 0.2 mmol/L dCTP, 0.05 mmol/L TTP, and 50100 nmol/L [32P]TTP; model PTC-100 thermal cycler, MJ Research, Inc., Cambridge, MA). Oligonucleotide primers for the PTEN gene spanned exons 57 (PT5-a/b), 67 (PT6-a/b), and 89 (PT8-a/b). PCR primers are as follows: PT5a, TTTCTATGGGGAAGTAAGGA; PT5b, ACGGCTGAGGGAACTC; PT6a, GTCAGAGGCGCTATGTGTAT; PT6b, GTCTTCCCGTCGTGTG; PT8a, AATGTTTCACTTTTGGGTAA; and PT8b, CGGCTCCTCTACTGTTTTT. PCR products were electrophoresed in 0.4-mm thick polyacrylamide gels under nondenaturing conditions (200500 V in 8% polyacrylamide gel made in 45 mmol/L Tris-borate and 1 mmol/L ethylenediamine tetraacetate). Gels were dried, and autoradiography was performed using preflashed Kodak XAR film (Eastman Kodak Co., Rochester, NY) at -60 C. Autoradiogram optical density was measured with an EC model 910 optical densitometer (EC Apparatus Corp., St. Petersburg, FL), and the resultant plot was integrated using the GS365W Electrophoresis Data System, version 2.0 (Hoeffer Scientific, San Francisco, CA).
Immunocytochemistry
The monoclonal antibody 6H2.1 (3, 15, 16) raised against the last 100 C-terminal amino acids of PTEN, developed and supplied by Jacqueline Lees (Massachusetts Institute of Technology, Cambridge, MA), was used in all immunocytochemical analyses. The specificity of this antibody for PTEN has been documented previously (15).
Tissue samples were fixed by immersion in buffered formalin and embedded in paraffin following standard histological practices. Four- to 5-mm sections were cut and mounted on SuperFrost Plus slides (Fisher Scientific, Pittsburgh, PA). Immunostaining was performed essentially as previously described (15). In summary, the sections were deparaffinized and rehydrated. Hydrated tissue underwent antigen retrieval for 20 min at 98 C in 0.01 mol/L sodium citrate buffer, pH 6.4, in a microwave oven. Endogenous peroxidase activity was blocked by incubation in 0.3% hydrogen peroxide for 30 min. After blocking for 30 min in 0.75% normal serum, the sections were incubated with 6H2.1 (dilution, 1:100) for 1 h at room temperature. Negative control slides received buffer only at this step. The sections were washed in phosphate-buffered saline and then incubated with biotinylated horse antimouse IgG followed by avidin peroxidase using the Vectastain ABC elite kit (Vector Laboratories, Inc., Burlingame, CA). The chromogenic reaction was carried out with 3,3'-diaminobenzidine using copper sulfate amplification, which gives a brown reaction product. After counterstaining with methyl green, the slides were evaluated under a light microscope. The intensity of staining was classified separately for the nucleus/nuclear membrane and the cytoplasm and was graded by two independent observers as strong (+++), moderate (++), weak (+), or absent (-).
| Results |
|---|
|
|
|---|
|
|
The endometrium functionalis expresses PTEN protein in both
stromal and glandular epithelial cells, with systematic changes in
intensity and subcellular localization during the menstrual cycle
(Table 2
). Beginning with menstrual
endometrium, shed tissue aggregates have nuclear signal in stromal
cells, but none in epithelium (Fig. 2A
).
As the functionalis regenerates during the proliferative phase
PTEN signal becomes widespread in epithelial and stromal
compartments (Fig. 2B
). In the early secretory phase, newly formed
basal secretory vacuoles exclude PTEN protein, which is
present only in the apical aspect of glandular epithelial cells (Fig. 2C
). At this time, the stromal cells maintain PTEN
expression in a pattern similar to that of the earlier proliferative
phase. In the mid- and late secretory phases, glands are essentially
depleted of PTEN protein (Fig. 2D
). A progesterone-induced
change in midsecretory stromal cells, decidualization, corresponds to
expansion of the cytoplasmic volume and continues through the later
secretory interval (12). Nuclear signal in decidualized stromal cells
at this stage becomes increasingly intense (Fig. 2D
), and the
cytoplasmic staining becomes somewhat variable relative to that in
earlier secretory endometrium.
|
|
| Discussion |
|---|
|
|
|---|
Changes in PTEN expression correspond to those endometrial zones that respond to hormonal fluctuation by changes in specialized cellular functions. Areas of endometrium sheltered from cyclical hormone-driven changes have low or absent PTEN levels, which remain stable throughout the cycle. This is evident in the endometrial basalis, which does not undergo stromal decidualization or secretory change as seen in more superficial regions (12).
The observation that epithelial PTEN expression levels decline in secretory endometrium is unexpected, especially because increasing levels of progesterone are widely known to have antineoplastic effects in this tissue. If PTEN had a direct effect on the antitumorigenic properties of progestins, the opposite would be predicted. Two alternate models are worth considering, but will require additional experimentation to evaluate. One is that the PTEN effect on endometrial glands is mediated by the adjacent stromal cells. Alternatively, the functional requirement for PTEN-mediated tumor suppressor activity might be specific to a highly mitotic estrogenic environment and negated under progestin-dominated conditions that reduce cell division. If this were the case, PTEN mutation under unopposed estrogen conditions would result in a high risk of developing carcinoma. This is exactly the combination of circumstances that is known to increase cancer risk: protracted unopposed estrogen exposure (11, 17) and development of a premalignant lesion, many of which we now recognize as having PTEN mutations (3). In another study we have shown that endometria stimulated for abnormally long intervals with estrogens begin to display clonal outgrowth of PTEN-depleted epithelium, which eventually assumes a physical configuration diagnostic of a precancerous state (3). Correspondingly, pharmacological administration of progestins to patients with endometrial precancers is often effective in causing their ablation, and in primates may increase the expression of tumor suppressor genes such as DMBT1 (18).
A physiological function of PTEN exclusive of its postulated role in tumorigenesis is expected. It is essential for complete development, as complete inactivation in knockout mice produces embryonic lethality (7). PTEN expression in normal mice is widespread before organogenesis, becoming more restricted thereafter (19), when high levels are seen in skin, breast, thyroid, and brain. These are the very tissues prone to development of neoplasia in adults with acquired or inherited PTEN mutations.
Changes in endometrial PTEN subcellular localization coincide to shifts in mitotic activity. Mitotically active epithelial and stromal cells have PTEN protein in both cytoplasm and nucleus. A relative increase in nuclear localization is seen in nondividing decidualized late stromal cells and apoptotic menstrual stromal cells. To date, PTEN has been shown to play some role in cell cycle arrest at the G1 phase via unknown mediators, apoptosis probably through the PI3K-Akt pathway and cell adhesion via the focal adhesion kinase pathway (20, 21, 22, 23, 24). Each of these processes may require PTEN to be in specific subcellular localizations. For example, PTEN might better regulate cell adhesion and migration through dephosphorylation of focal adhesion kinases in the cytoplasmic compartment (25). If PTEN indeed serves to check uncontrolled mitotic division and initiate apoptosis, the fact that these functions are not effective throughout the menstrual cycle requires that PTEN expression be coordinated carefully throughout.
In conclusion, PTEN expression in normal endometrium is ubiquitous in the estrogenic proliferative phase, but undergoes cell type-specific changes in response to progesterone. Epithelial cells lose PTEN protein in the secretory phase, whereas stromal cells increase PTEN expression, especially in the cytoplasmic compartment. Epithelial PTEN function is probably restricted to the mitotically active glandular epithelium, where its loss by mutation under protracted estrogenic conditions may initiate genesis of a precancerous lesion.
| Footnotes |
|---|
Received December 2, 1999.
Revised February 25, 2000.
Accepted March 17, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Fouladkou, T. Landry, H. Kawabe, A. Neeb, C. Lu, N. Brose, V. Stambolic, and D. Rotin The ubiquitin ligase Nedd4-1 is dispensable for the regulation of PTEN stability and localization PNAS, June 24, 2008; 105(25): 8585 - 8590. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-J. Chang, D. J. Mulholland, B. Valamehr, S. Mosessian, W. R. Sellers, and H. Wu PTEN Nuclear Localization Is Regulated by Oxidative Stress and Mediates p53-Dependent Tumor Suppression Mol. Cell. Biol., May 15, 2008; 28(10): 3281 - 3289. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Horne and D. L. Blithe Progesterone receptor modulators and the endometrium: changes and consequences Hum. Reprod. Update, November 1, 2007; 13(6): 567 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Treloar, Z. Z. Zhao, L. Le, K. T. Zondervan, N. G. Martin, S. Kennedy, D. R. Nyholt, and G. W. Montgomery Variants in EMX2 and PTEN do not contribute to risk of endometriosis Mol. Hum. Reprod., August 1, 2007; 13(8): 587 - 594. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Moreno-Bueno, P. J. Fernandez-Marcos, M. Collado, M. J. Tendero, S. M. Rodriguez-Pinilla, I. Garcia-Cao, D. Hardisson, M. T. Diaz-Meco, J. Moscat, M. Serrano, et al. Inactivation of the Candidate Tumor Suppressor Par-4 in Endometrial Cancer Cancer Res., March 1, 2007; 67(5): 1927 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.E. Gargett Uterine stem cells: What is the evidence? Hum. Reprod. Update, January 1, 2007; 13(1): 87 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Hecht and G. L. Mutter Molecular and Pathologic Aspects of Endometrial Carcinogenesis J. Clin. Oncol., October 10, 2006; 24(29): 4783 - 4791. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Orbo, C. E. Rise, and G. L. Mutter Regression of Latent Endometrial Precancers by Progestin Infiltrated Intrauterine Device Cancer Res., June 1, 2006; 66(11): 5613 - 5617. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Pohnke, T. Schneider-Merck, J. Fahnenstich, R. Kempf, M. Christian, K. Milde-Langosch, J. J. Brosens, and B. Gellersen Wild-Type p53 Protein Is Up-Regulated upon Cyclic Adenosine Monophosphate-Induced Differentiation of Human Endometrial Stromal Cells J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5233 - 5244. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Moorehead, C. V. Hojilla, I. De Belle, G. A. Wood, J. E. Fata, E. D. Adamson, K. L. M. Watson, D. R. Edwards, and R. Khokha Insulin-like Growth Factor-II Regulates PTEN Expression in the Mammary Gland J. Biol. Chem., December 12, 2003; 278(50): 50422 - 50427. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Guzeloglu-Kayisli, U. A. Kayisli, R. Al-Rejjal, W. Zheng, G. Luleci, and A. Arici Regulation of PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10) Expression by Estradiol and Progesterone in Human Endometrium J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 5017 - 5026. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Yoshino, Y. Osuga, Y. Hirota, K. Koga, T. Yano, O. Tsutsumi, and Y. Taketani Akt as a possible intracellular mediator for decidualization in human endometrial stromal cells Mol. Hum. Reprod., May 1, 2003; 9(5): 265 - 269. [Abstract] [Full Text] [PDF] |
||||
![]() |
G L Mutter Diagnosis of premalignant endometrial disease J. Clin. Pathol., May 1, 2002; 55(5): 326 - 331. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Mutter, T. A. Ince, J. P. A. Baak, G. A. Kust, X.-P. Zhou, and C. Eng Molecular Identification of Latent Precancers in Histologically Normal Endometrium Cancer Res., June 1, 2001; 61(11): 4311 - 4314. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhu, C.-H. Kwon, P. W. Schlosshauer, L. H. Ellenson, and S. J. Baker PTEN Induces G1 Cell Cycle Arrest and Decreases Cyclin D3 Levels in Endometrial Carcinoma Cells Cancer Res., June 1, 2001; 61(11): 4569 - 4575. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Mutter PTEN, a Protean Tumor Suppressor Am. J. Pathol., June 1, 2001; 158(6): 1895 - 1898. [Full Text] [PDF] |
||||
![]() |
K. M. Yamada and M. Araki Tumor suppressor PTEN: modulator of cell signaling, growth, migration and apoptosis J. Cell Sci., January 7, 2001; 114(13): 2375 - 2382. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |