help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mutter, G. L.
Right arrow Articles by Eng, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mutter, G. L.
Right arrow Articles by Eng, C.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 6 2334-2338
Copyright © 2000 by The Endocrine Society


Original Studies

Changes in Endometrial PTEN Expression throughout the Human Menstrual Cycle1

George L. Mutter, Ming-Chieh Lin, Jeffrey T. Fitzgerald, Jennifer B. Kum and Charis Eng

Department of Pathology, Brigham and Women’s Hospital (G.L.M., M.-C.L., J.T.F.), Boston, Massachusetts 02115; Department of Adult Oncology, Dana Farber Cancer Institute (J.B.K.), Boston, Massachusetts 02115; Clinical Cancer Genetics and Human Cancer Genetics Programs, Ohio State University Comprehensive Cancer Center (J.B.K., C.E.), Columbus, Ohio 43210

Address all correspondence and requests for reprints to: George L. Mutter, M.D., Department of Pathology, Brigham and Women’s Hospital, 75 Francis Street, Boston, Massachusetts 02115. E-mail: gmutter{at}rics.bwh.harvard.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Frequent mutation of the PTEN tumor suppressor gene in endometrial adenocarcinoma has led to the prediction that its product, a phosphatase that regulates the cell cycle, apoptosis, and possibly cell adhesion, is functionally active within normal endometrial tissues. We examined PTEN expression in normal human endometrium during response to changing physiological levels of steroid hormones. PTEN ribonucleic acid levels, assessed by RT-PCR, increase severalfold in secretory compared to proliferative endometrium. This suggested that progesterone, a known antineoplastic factor for endometrial adenocarcinoma, increases PTEN levels. Immunohistochemistry with an anti-PTEN monoclonal antibody displayed a complex pattern of coordinate stromal and epithelial expression. Early in the menstrual cycle under the dominant influence of estrogens, the proliferative endometrium shows ubiquitous cytoplasmic and nuclear PTEN expression. After 3–4 days of progesterone exposure, glandular epithelium of early secretory endometrium maintains cytoplasmic PTEN protein in an apical distribution offset by expanding PTEN-free basal secretory vacuoles. By the midsecretory phase, epithelial PTEN is exhausted, but increases dramatically in the cytoplasm of stromal cells undergoing decidual change. We conclude that stromal and epithelial compartments contribute to the hormone-driven changes in endometrial PTEN expression and infer that abnormal hormonal conditions may, in turn, disrupt normal patterns of PTEN expression in this tissue.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE PTEN TUMOR suppressor gene is mutated in 34–80% of endometrioid endometrial adenocarcinomas (1, 2, 3) and in up to half of premalignant endometrial lesions, atypical endometrial hyperplasias (3, 4, 5, 6). Its role in tumor suppression is confirmed by frequent endometrial abnormalities that develop in PTEN-deficient mice (7) and the high incidence of breast, thyroid, and endometrial cancers in humans with constitutive mutation of one PTEN allele, Cowden’s syndrome (8, 9, 10). Mutations in the PTEN gene have emerged as a primary cause of this most frequent of all gynecological cancers, endometrial adenocarcinoma.

An intriguing feature common to many organs prone to develop somatic PTEN mutant tumors is steroid hormone responsiveness. In the case of sporadic endometrial adenocarcinomas, nonphysiological aberrations of sex hormone levels have been repeatedly defined by epidemiological studies as the major risk factor for this disease (11). Is there a relationship between PTEN expression and steroid hormone levels that might link the observed high PTEN mutational rate and hormonal endometrial risk factors? To date, there is no direct link between steroid hormone response and PTEN function. As a primary target organ for sex hormones, the endometrium is an exquisite barometer by which the hormonal environment can be measured. The morphological appearance of endometrium during the latter half of the cycle is sufficiently stereotypical that a trained pathologist can predict the actual menstrual date (±48 h) of a blinded histological specimen. It is thus possible to classify endometrial tissues by histological appearance and infer with a high level of confidence their menstrual age and ambient hormonal conditions.

We have selected normal endometrial tissues from throughout the normal cycle for PTEN expression analysis and interpreted our findings in light of the distinctive hormonal profiles that distinguish its phases. Immunohistochemistry permitted further resolution of which cell types contribute to the overall PTEN expression within this complex and dynamic tissue.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue samples

Snap-frozen endometrial samples were obtained as discarded materials from hysterectomies of women undergoing surgery for benign, nonendometrial, uterine disease (usually uterine prolapse or fibroids). Endometrial histology was evaluated by review of hematoxylin- and eosin-stained paraffin histological sections obtained at the time of tissue allocation. Endometria from four premenopausal (no exogenous hormone administration, age <50 yr) cycling women included two proliferative and two secretory endometria. An additional hysterectomy specimen from a postmenopausal patient with an atrophic endometrium was included along with myometrium as a control.

Paraffin blocks of histologically normal endometria were retrieved by diagnosis from the pathology files of Brigham and Women’s Hospital. All patients were less than 50 yr old, clinically premenopausal, and without intrinsic endometrial disease or recent history of hormone administration. Histological sections were reviewed by a gynecological pathologist (G.L.M.) for assignment of menstrual date according to a standardized 28-day cycle (12). Day assignments of 40 accessioned normal endometria correspond to sequential hormonal and histological events beginning with the first day of menses as follows: menses, days 1–4 (n = 4); proliferative phase, days 5–15 (n = 8); early secretory endometrium, days 16–18 (n = 7); midsecretory endometrium, days 19–24 (n = 7); and late secretory endometrium, days 25–28 (n = 15).

RT-PCR

RNA was isolated by lysis in guanidine isothiocyanate and selective precipitation with lithium chloride (13). RT of 10 µg total RNA with random hexamers and SuperScript reverse transcriptase (Life Technologies, Inc.\\g>-BRL, Gaithersburg, MD) was performed according to the manufacturer’s instructions. Identical RNA aliquots underwent parallel manipulation, except for the addition of reverse transcriptase. A constant quantity of resultant complementary DNAs or RNAs without RT was amplified by PCR for 27 PCR cycles at an annealing temperature of 50 C with one of three different PTEN primer sets and a control ß-actin primer (Research Genetics, Inc., Huntsville, AL; catalogue no. M502) (14). The number of PCR cycles was bracketed between 22–32 to identify a linear range of amplification for the PCR conditions used; 27 cycles was the midlinear range for the primers used. PCR reactions were performed in a 50-µL reaction mix [10 mmol/L Tris (pH 8.4), 50 mmol/L KCl, 20 µg/ml gelatin, 1.5 mmol/L MgCl, oligonucleotide primers 0.1 µmol/L of each, 0.2 mmol/L deoxy (d)-ATP, 0.2 mmol/L dGTP, 0.2 mmol/L dCTP, 0.05 mmol/L TTP, and 50–100 nmol/L [32P]TTP; model PTC-100 thermal cycler, MJ Research, Inc., Cambridge, MA). Oligonucleotide primers for the PTEN gene spanned exons 5–7 (PT5-a/b), 6–7 (PT6-a/b), and 8–9 (PT8-a/b). PCR primers are as follows: PT5a, TTTCTATGGGGAAGTAAGGA; PT5b, ACGGCTGAGGGAACTC; PT6a, GTCAGAGGCGCTATGTGTAT; PT6b, GTCTTCCCGTCGTGTG; PT8a, AATGTTTCACTTTTGGGTAA; and PT8b, CGGCTCCTCTACTGTTTTT. PCR products were electrophoresed in 0.4-mm thick polyacrylamide gels under nondenaturing conditions (200–500 V in 8% polyacrylamide gel made in 45 mmol/L Tris-borate and 1 mmol/L ethylenediamine tetraacetate). Gels were dried, and autoradiography was performed using preflashed Kodak XAR film (Eastman Kodak Co., Rochester, NY) at -60 C. Autoradiogram optical density was measured with an EC model 910 optical densitometer (EC Apparatus Corp., St. Petersburg, FL), and the resultant plot was integrated using the GS365W Electrophoresis Data System, version 2.0 (Hoeffer Scientific, San Francisco, CA).

Immunocytochemistry

The monoclonal antibody 6H2.1 (3, 15, 16) raised against the last 100 C-terminal amino acids of PTEN, developed and supplied by Jacqueline Lees (Massachusetts Institute of Technology, Cambridge, MA), was used in all immunocytochemical analyses. The specificity of this antibody for PTEN has been documented previously (15).

Tissue samples were fixed by immersion in buffered formalin and embedded in paraffin following standard histological practices. Four- to 5-mm sections were cut and mounted on SuperFrost Plus slides (Fisher Scientific, Pittsburgh, PA). Immunostaining was performed essentially as previously described (15). In summary, the sections were deparaffinized and rehydrated. Hydrated tissue underwent antigen retrieval for 20 min at 98 C in 0.01 mol/L sodium citrate buffer, pH 6.4, in a microwave oven. Endogenous peroxidase activity was blocked by incubation in 0.3% hydrogen peroxide for 30 min. After blocking for 30 min in 0.75% normal serum, the sections were incubated with 6H2.1 (dilution, 1:100) for 1 h at room temperature. Negative control slides received buffer only at this step. The sections were washed in phosphate-buffered saline and then incubated with biotinylated horse antimouse IgG followed by avidin peroxidase using the Vectastain ABC elite kit (Vector Laboratories, Inc., Burlingame, CA). The chromogenic reaction was carried out with 3,3'-diaminobenzidine using copper sulfate amplification, which gives a brown reaction product. After counterstaining with methyl green, the slides were evaluated under a light microscope. The intensity of staining was classified separately for the nucleus/nuclear membrane and the cytoplasm and was graded by two independent observers as strong (+++), moderate (++), weak (+), or absent (-).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PTEN RNA abundance (Table 1Go) increased by a factor of 5 or more in the transition from proliferative to secretory endometrium, as assessed by three independent PCR assays (Fig. 1Go, assays PT5-a/b, PT6-a/b, and PT8-a/b).


View this table:
[in this window]
[in a new window]
 
Table 1. Increase in PTEN RNA in progesterone-exposed endometrium

 


View larger version (35K):
[in this window]
[in a new window]
 
Figure 1. Endometrial expression of PTEN RNA in a changing hormonal environment. PTEN expression throughout the normal menstrual cycle was studied by RT-PCR. Equal quantities of normal human endometrial RNA isolated from atrophic (lane 2), estrogen-primed proliferative (2 patients, lanes 3 and 4), and progesterone-exposed secretory (2 patients, lanes 5 and 6) endometria were reverse transcribed (+RT) with random hexamers, and the resultant complementary DNA was used as a PCR template. Myometrium from the postmenopausal patient with atrophic endometrium (lane 2) is included as lane 1. Three different PTEN primer sets were used in 27 PCR cycles, spanning exons 5–7 (PT5-a/b), 6–7 (PT6-a/b), and 8–9 (PT8-a/b). All show that PTEN RNA levels increased severalfold (see TableGo I) under progesterone influence (lanes 5 and 6) relative to the estrogenic proliferative phase (lanes 3 and 4) or in the hormonally depleted atrophic state (lane 1). Controls shown include identical RNAs without RT (-RT), genomic DNA, and the constitutively expressed gene ß-actin (26 ). Signal in the +RT lanes can be ascribed to a RNA source, as there is minimal contaminating genomic DNA background (-RT). Each row of data is from a single autoradiogram, with exposure intervals ranging from 4–12 h.

 
PTEN immunohistochemistry resolved the tissue-specific (e.g. endometrial epithelium, stroma, etc.) and subcellular localization of PTEN protein in cycling complex endometrial tissues. The distribution of PTEN immunohistochemical signal was confined primarily to the endometrium functionalis, the superficial or luminal portion of the endometrial thickness that undergoes dramatic morphological change in response to the changing hormonal conditions that define the menstrual cycle. The deeper endometrial basalis tended to have very faint PTEN staining regardless of cycle stage (not shown).

The endometrium functionalis expresses PTEN protein in both stromal and glandular epithelial cells, with systematic changes in intensity and subcellular localization during the menstrual cycle (Table 2Go). Beginning with menstrual endometrium, shed tissue aggregates have nuclear signal in stromal cells, but none in epithelium (Fig. 2AGo). As the functionalis regenerates during the proliferative phase PTEN signal becomes widespread in epithelial and stromal compartments (Fig. 2BGo). In the early secretory phase, newly formed basal secretory vacuoles exclude PTEN protein, which is present only in the apical aspect of glandular epithelial cells (Fig. 2CGo). At this time, the stromal cells maintain PTEN expression in a pattern similar to that of the earlier proliferative phase. In the mid- and late secretory phases, glands are essentially depleted of PTEN protein (Fig. 2DGo). A progesterone-induced change in midsecretory stromal cells, decidualization, corresponds to expansion of the cytoplasmic volume and continues through the later secretory interval (12). Nuclear signal in decidualized stromal cells at this stage becomes increasingly intense (Fig. 2DGo), and the cytoplasmic staining becomes somewhat variable relative to that in earlier secretory endometrium.


View this table:
[in this window]
[in a new window]
 
Table 2. PTEN immunohistochemistry in cycling endometrium functionalis

 


View larger version (124K):
[in this window]
[in a new window]
 
Figure 2. PTEN immunohistochemistry using antibody 6H2.1 displays signal as a brown product in sections of menstrual (A), proliferative (B), early secretory (day 17; C), and midsecretory (day 24; D) endometria. Scale bar, 100 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Endometrial expression of PTEN is not constant throughout the menstrual cycle, but changes in response to the hormonal environment. Our initial assessment of expression using whole tissue as a RNA source for PTEN RT-PCR suggested that the postovulatory secretory phase had increased PTEN expression relative to the estrogenic proliferative phase. Immunohistochemical localization of PTEN protein within endometrial tissues, however, showed a highly complex distribution in multiple cell types and subcellular locations that cannot be simply summarized by a change in total tissue abundance. The endometrial response to progestins is cell type specific and inverse between epithelial and stromal cells. Estrogen-driven, mitotically active, glandular and stromal cells have a high level of ubiquitous PTEN expression in both nuclear and cytoplasmic compartments. With the addition of progesterone, epithelial PTEN expression declines to a point where after 3–5 days (cycle days 18–19) this protein is completely extinguished to a level below the threshold of detection. The diminution of epithelial PTEN expression begins with a polarized loss of PTEN protein from the basal aspect of epithelial cells. At this same time, adjacent stromal cells undergoing cytoplasmic expansion as part of a decidualization process collect abundant nuclear and cytoplasmic PTEN protein.

Changes in PTEN expression correspond to those endometrial zones that respond to hormonal fluctuation by changes in specialized cellular functions. Areas of endometrium sheltered from cyclical hormone-driven changes have low or absent PTEN levels, which remain stable throughout the cycle. This is evident in the endometrial basalis, which does not undergo stromal decidualization or secretory change as seen in more superficial regions (12).

The observation that epithelial PTEN expression levels decline in secretory endometrium is unexpected, especially because increasing levels of progesterone are widely known to have antineoplastic effects in this tissue. If PTEN had a direct effect on the antitumorigenic properties of progestins, the opposite would be predicted. Two alternate models are worth considering, but will require additional experimentation to evaluate. One is that the PTEN effect on endometrial glands is mediated by the adjacent stromal cells. Alternatively, the functional requirement for PTEN-mediated tumor suppressor activity might be specific to a highly mitotic estrogenic environment and negated under progestin-dominated conditions that reduce cell division. If this were the case, PTEN mutation under unopposed estrogen conditions would result in a high risk of developing carcinoma. This is exactly the combination of circumstances that is known to increase cancer risk: protracted unopposed estrogen exposure (11, 17) and development of a premalignant lesion, many of which we now recognize as having PTEN mutations (3). In another study we have shown that endometria stimulated for abnormally long intervals with estrogens begin to display clonal outgrowth of PTEN-depleted epithelium, which eventually assumes a physical configuration diagnostic of a precancerous state (3). Correspondingly, pharmacological administration of progestins to patients with endometrial precancers is often effective in causing their ablation, and in primates may increase the expression of tumor suppressor genes such as DMBT1 (18).

A physiological function of PTEN exclusive of its postulated role in tumorigenesis is expected. It is essential for complete development, as complete inactivation in knockout mice produces embryonic lethality (7). PTEN expression in normal mice is widespread before organogenesis, becoming more restricted thereafter (19), when high levels are seen in skin, breast, thyroid, and brain. These are the very tissues prone to development of neoplasia in adults with acquired or inherited PTEN mutations.

Changes in endometrial PTEN subcellular localization coincide to shifts in mitotic activity. Mitotically active epithelial and stromal cells have PTEN protein in both cytoplasm and nucleus. A relative increase in nuclear localization is seen in nondividing decidualized late stromal cells and apoptotic menstrual stromal cells. To date, PTEN has been shown to play some role in cell cycle arrest at the G1 phase via unknown mediators, apoptosis probably through the PI3K-Akt pathway and cell adhesion via the focal adhesion kinase pathway (20, 21, 22, 23, 24). Each of these processes may require PTEN to be in specific subcellular localizations. For example, PTEN might better regulate cell adhesion and migration through dephosphorylation of focal adhesion kinases in the cytoplasmic compartment (25). If PTEN indeed serves to check uncontrolled mitotic division and initiate apoptosis, the fact that these functions are not effective throughout the menstrual cycle requires that PTEN expression be coordinated carefully throughout.

In conclusion, PTEN expression in normal endometrium is ubiquitous in the estrogenic proliferative phase, but undergoes cell type-specific changes in response to progesterone. Epithelial cells lose PTEN protein in the secretory phase, whereas stromal cells increase PTEN expression, especially in the cytoplasmic compartment. Epithelial PTEN function is probably restricted to the mitotically active glandular epithelium, where its loss by mutation under protracted estrogenic conditions may initiate genesis of a precancerous lesion.


    Footnotes
 
1 This work was supported in part by Grants RPG-98-211-01-CCE from the American Cancer Society (to C.E.), DAMD17-98-1-8058 from the U.S. Army Breast Cancer Research Program (to C.E.), and P30CA16058 from the NCI (to Ohio State University Comprehensive Cancer Center). Back

Received December 2, 1999.

Revised February 25, 2000.

Accepted March 17, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Risinger JI, Hayes AK, Berchuck A, Barrett JC. 1997 PTEN/MMAC1 mutations in endometrial cancers. Cancer Res. 57:4736–4738.[Abstract/Free Full Text]
  2. Tashiro H, Blazes MS, Wu R, et al. 1997 Mutations in PTEN are frequent in endometrial carcinoma but rare in other common gynecological malignancies. Cancer Res. 57:3935–3940.[Abstract/Free Full Text]
  3. Mutter GL, Lin MC, Fitzgerald JT, et al. 2000 Altered PTEN expression as a diagnostic marker for the earliest endometrial precancers. J Natl Cancer Inst. In press.
  4. Levine RL, Cargile CB, Blazes MS, Van Rees B, Kurman RJ, Ellenson LH. 1998 PTEN mutations and microsatellite instability in complex atypical hyperplasia, a precursor lesion to uterine endometrioid carcinoma. Cancer Res. 58:3254–3258.[Abstract/Free Full Text]
  5. Maxwell G, Risinger J, Gumbs C, et al. 1998 Mutation of the PTEN tumor supressor gene in endometrial hyperplasias. Cancer Res. 58:2500–2503.[Abstract/Free Full Text]
  6. Yoshinaga K, Sasano H, Furukawa T, et al. 1998 The PTEN, BAX, and IGFIIR genes are mutated in endometrial atypical hyperplasia. Jpn J Cancer Res. 89:985–990.[CrossRef][Medline]
  7. Di Cristofano A, Pesce B, Cordon-Cardo C, Pandolfi PP. 1998 Pten is essential for embryonic development and tumour suppression. Nat Genet. 19:348–355.[CrossRef][Medline]
  8. Eng C. 1997 Cowden syndrome. J Genet Counsel. 6:181–191.[CrossRef]
  9. Liaw D, Marsh DJ, Li J, et al. 1997 Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet. 16:64–67.[CrossRef][Medline]
  10. Marsh D, Coulon V, Lunetta K, et al. 1998 Mutation spectrum and genotype-phenotype analyses in Cowden disease and Bannayan-Zonana syndrome, 2 hamartoma syndromes with germline PTEN mutation. Hum Mol Genet. 7:507–515.[Abstract/Free Full Text]
  11. Grimes DA, Economy KE. 1995 Primary prevention of gynecologic cancers. Am J Obstet Gynecol. 172:227–235.[CrossRef][Medline]
  12. Ferenczy A. 1987 Anatomy and histology of the uterine corpus. In: Kurman R, ed. Blaustein’s pathology of the female genital tract. New York: Springer-Verlag; 257–291.
  13. Cathala G, Savouret J-F, Mendez B, et al. 1983 A method for isolation of intact, transcriptionally active ribonucleic acid. DNA. 2:329–335.[Medline]
  14. du Breuil, Patel JM, Mendelow BV. 1993 Quantitation of beta-actin specific mRNA transcripts using xeno-competitive PCR. PCR Methods Applications. 3:57–59.
  15. Perren A, Weng L, Boag A, et al. 1999 Immunocytochemical evidence of loss of PTEN expression in primary ductal adenocarcinomas of the breast. Am J Pathol. 155:1253–1260.[Abstract/Free Full Text]
  16. Gimm O, Peren A, Liang-Ping W, et al. Differential nuclear and cytoplasmic expression of PTEN in normal, benign, and malignant epithelial thyroid tumors. Am J Pathol. In press.
  17. Parazzini F, La Vecchia C, Bocciolone L, Franceschi S. 1991 The epidemiology of endometrial cancer. Gynecol Oncol. 41:1–16.[CrossRef][Medline]
  18. Ace CI, Okulicz WC. 1998 A progesterone-induced endometrial homolog of a new candidate tumor suppressor, DMBT1. J Clin Endocrinol Metab. 83:3569–3573.[Abstract/Free Full Text]
  19. Luukko K, Ylikorkala A, Tiainen M, Makela TP. 1999 Expression of LKB1 and PTEN tumor suppressor genes during mouse embryonic development. Mech Dev. 83:187–190.[CrossRef][Medline]
  20. Stambolic V, Suzuki A, de la Pompa JL, et al. 1998 Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95:29–39.
  21. Furnari FB, Lin H, Huang HS, Cavenee WK. 1997 Growth suppression of glioma cells by PTEN requires a functional phosphatase catalytic domain. Proc Natl Acad Sci USA94 :12479–12484.
  22. Li J, Yen C, Liaw D, et al. 1997 PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275:1943–1947.
  23. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM. 1998 Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 280:1614–1617.
  24. Weng LP, Smith WM, Dahia P, Ziebold U, Lees J, Eng C. 1999 PTEN supresses breast cancer cell growth by phosphatase activity-dependent G1 arrest followed by cell death. Cancer Res. 59:5808–5814.[Abstract/Free Full Text]
  25. Tamura M, Gu J, Takino T, Yamada KM. 1999 Tumor suppressor PTEN inhibition of cell invasion, migration, and growth: differential involvement of focal adhesion kinase and p130Cas. Cancer Res. 59:442–449.[Abstract/Free Full Text]
  26. Ace CI, Okulicz WC. 1995 Differential gene regulation by estrogen and progesterone in the primate endometrium. Mol Cell Endocrinol. 115:95–103.[CrossRef][Medline]



This article has been cited by other articles:


Home page
ReproductionHome page
M. Goto, A. Iwase, T. Harata, S. Takigawa, K. Suzuki, S. Manabe, and F. Kikkawa
IGF1-induced AKT phosphorylation and cell proliferation are suppressed with the increase in PTEN during luteinization in human granulosa cells
Reproduction, May 1, 2009; 137(5): 835 - 842.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Fouladkou, T. Landry, H. Kawabe, A. Neeb, C. Lu, N. Brose, V. Stambolic, and D. Rotin
The ubiquitin ligase Nedd4-1 is dispensable for the regulation of PTEN stability and localization
PNAS, June 24, 2008; 105(25): 8585 - 8590.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C.-J. Chang, D. J. Mulholland, B. Valamehr, S. Mosessian, W. R. Sellers, and H. Wu
PTEN Nuclear Localization Is Regulated by Oxidative Stress and Mediates p53-Dependent Tumor Suppression
Mol. Cell. Biol., May 15, 2008; 28(10): 3281 - 3289.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
J. N. Bakkum-Gamez, J. Gonzalez-Bosquet, N. N. Laack, A. Mariani, and S. C. Dowdy
Current Issues in the Management of Endometrial Cancer
Mayo Clin. Proc., January 1, 2008; 83(1): 97 - 112.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
F. M. Horne and D. L. Blithe
Progesterone receptor modulators and the endometrium: changes and consequences
Hum. Reprod. Update, November 1, 2007; 13(6): 567 - 580.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. A. Treloar, Z. Z. Zhao, L. Le, K. T. Zondervan, N. G. Martin, S. Kennedy, D. R. Nyholt, and G. W. Montgomery
Variants in EMX2 and PTEN do not contribute to risk of endometriosis
Mol. Hum. Reprod., August 1, 2007; 13(8): 587 - 594.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Moreno-Bueno, P. J. Fernandez-Marcos, M. Collado, M. J. Tendero, S. M. Rodriguez-Pinilla, I. Garcia-Cao, D. Hardisson, M. T. Diaz-Meco, J. Moscat, M. Serrano, et al.
Inactivation of the Candidate Tumor Suppressor Par-4 in Endometrial Cancer
Cancer Res., March 1, 2007; 67(5): 1927 - 1934.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
C.E. Gargett
Uterine stem cells: What is the evidence?
Hum. Reprod. Update, January 1, 2007; 13(1): 87 - 101.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. L. Hecht and G. L. Mutter
Molecular and Pathologic Aspects of Endometrial Carcinogenesis
J. Clin. Oncol., October 10, 2006; 24(29): 4783 - 4791.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Orbo, C. E. Rise, and G. L. Mutter
Regression of Latent Endometrial Precancers by Progestin Infiltrated Intrauterine Device
Cancer Res., June 1, 2006; 66(11): 5613 - 5617.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
Y. Pohnke, T. Schneider-Merck, J. Fahnenstich, R. Kempf, M. Christian, K. Milde-Langosch, J. J. Brosens, and B. Gellersen
Wild-Type p53 Protein Is Up-Regulated upon Cyclic Adenosine Monophosphate-Induced Differentiation of Human Endometrial Stromal Cells
J. Clin. Endocrinol. Metab., October 1, 2004; 89(10): 5233 - 5244.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. A. Moorehead, C. V. Hojilla, I. De Belle, G. A. Wood, J. E. Fata, E. D. Adamson, K. L. M. Watson, D. R. Edwards, and R. Khokha
Insulin-like Growth Factor-II Regulates PTEN Expression in the Mammary Gland
J. Biol. Chem., December 12, 2003; 278(50): 50422 - 50427.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
O. Guzeloglu-Kayisli, U. A. Kayisli, R. Al-Rejjal, W. Zheng, G. Luleci, and A. Arici
Regulation of PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10) Expression by Estradiol and Progesterone in Human Endometrium
J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 5017 - 5026.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
O. Yoshino, Y. Osuga, Y. Hirota, K. Koga, T. Yano, O. Tsutsumi, and Y. Taketani
Akt as a possible intracellular mediator for decidualization in human endometrial stromal cells
Mol. Hum. Reprod., May 1, 2003; 9(5): 265 - 269.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
G L Mutter
Diagnosis of premalignant endometrial disease
J. Clin. Pathol., May 1, 2002; 55(5): 326 - 331.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. L. Mutter, T. A. Ince, J. P. A. Baak, G. A. Kust, X.-P. Zhou, and C. Eng
Molecular Identification of Latent Precancers in Histologically Normal Endometrium
Cancer Res., June 1, 2001; 61(11): 4311 - 4314.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Zhu, C.-H. Kwon, P. W. Schlosshauer, L. H. Ellenson, and S. J. Baker
PTEN Induces G1 Cell Cycle Arrest and Decreases Cyclin D3 Levels in Endometrial Carcinoma Cells
Cancer Res., June 1, 2001; 61(11): 4569 - 4575.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. L. Mutter
PTEN, a Protean Tumor Suppressor
Am. J. Pathol., June 1, 2001; 158(6): 1895 - 1898.
[Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. M. Yamada and M. Araki
Tumor suppressor PTEN: modulator of cell signaling, growth, migration and apoptosis
J. Cell Sci., January 7, 2001; 114(13): 2375 - 2382.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mutter, G. L.
Right arrow Articles by Eng, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mutter, G. L.
Right arrow Articles by Eng, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals