| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
in Human Endometrial Stromal Cells1
Department of Cellular and Molecular Pathology and the Women’s Reproductive Health Research Center, Department of Obstetrics and Gynecology, Vanderbilt University School of Medicine, Nashville, Tennessee 37232
Address all correspondence and requests for reprints to: Kevin G. Osteen, Ph.D., Women’s Reproductive Health Research Center, B-1100 Medical Center North, Vanderbilt University School of Medicine, Nashville, Tennessee 37232. E-mail: kevin.osteen{at}mcmail.vanderbilt.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(IL-1), can
oppose progesterone suppression of MMPs in the human endometrium.
Furthermore, we have recently demonstrated colocalization of epithelial
cell IL-1 and MMP-7 expression at sites of ectopic pregnancy. The
current study extends these findings, revealing a previously
unrecognized interrelationship between progesterone and IL-1 in
regulation of MMP-3. Although IL-1 is a potent stimulator of MMP-3
in proliferative phase endometrium in organ culture, we demonstrate
that progesterone exposure in vivo reduces IL-1
stimulation of MMP-3 in secretory phase tissue. This loss of
sensitivity to IL-1 was duplicated in isolated stromal cells treated
with progesterone in vitro, and IL-1 stimulation of
MMP-3 returned in a dose-dependent manner with progesterone withdrawal.
The antiprogestin, onapristone, partially blocked the ability of
progesterone to prevent stimulation of MMP-3 by IL-1. These data
suggest a novel mechanism by which progesterone may preserve tissue
integrity during the establishment and maintenance of pregnancy by
limiting stimulation of MMPs by inflammatory cytokines such as IL-1. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Providing nourishment within a protective environment is the primary function of the hemochorial placenta, a unique structure dependent upon stable and predictable interactions between cells of diverse origin. Development of this transient organ, however, involves invasive events that are facilitated by potentially destructive proteolytic enzymes (9). The secretion of cell-specific matrix metalloproteinases (MMPs), including MMP-9 and MMP-2, mediate trophoblast cell invasion through the extracellular matrix of the endometrial stroma and subsequent fusion with the maternal vasculature (10, 11). However, maintaining uterine tissue integrity during the disruptive events of implantation and placentation requires that the expression of MMPs by maternal cells be limited (12, 13, 14). The cellular and molecular mechanisms by which steroids and cytokines act together to promote the selective expression of specific MMPs while limiting the actions of others during the establishment of pregnancy are not well understood. Several laboratories, including ours, have focused efforts on understanding the interactions of steroids and cytokines in the endometrium, with particular regard to the regulation of MMP expression by progesterone (15, 16, 17, 18, 19, 20, 21). Numerous cytokines are known to work in concert with progesterone to regulate MMP expression in various reproductive processes (22, 23). For example, the suppression of stromal-specific MMP-3 and epithelial-specific MMP-7 expression during the secretory phase of the menstrual cycle requires both progesterone and transforming growth factor-ß (16, 24).
In contrast to cytokines that work cooperatively with progesterone to
limit MMP expression, inflammatory cytokines may act in opposition to
progesterone to stimulate MMP expression. Among such cytokines
expressed at the maternal-fetal interface, members of the interleukin-1
(IL-1) family are known to regulate MMP expression (25) and appear to
play an important role in cellular interactions during the
establishment of pregnancy (7, 26). For example, IL-1 expression
appears to be linked to elevated levels of MMP-7 messenger ribonucleic
acid (mRNA) found in epithelial cells at sites of ectopic pregnancy
(27). Additionally, several laboratories have shown that IL-1 can
oppose progesterone-dependent differentiation of the specialized
endometrial stroma. Using in vitro models of
decidualization, studies show that IL-1 can prevent progestin-mediated
suppression of MMP-3 (17, 20), morphological decidualization (28), and
decidual endocrine function (29).
Clinical observations have demonstrated the importance of adequate
progesterone levels for normal maturation of the endometrial stroma in
forming the decidua of pregnancy (4, 14, 30, 31). And, although the
IL-1 family appears to play a positive role in implantation (7, 26),
these cytokines are also elevated in association with endometrial
breakdown during menstruation (18, 19, 20, 32, 33) and at the time of
parturition (34, 35, 36, 37). Therefore, the ability of inflammatory cytokines
to oppose progesterone action has broad and potentially negative
ramifications clinically with regard to the successful establishment
and maintenance of pregnancy and may play a role in the pathogenesis of
other aspects of human infertility as well. Studies to date indicate
that a delicate balance exists in steroid-sensitive tissues that serves
to regulate tissue responsiveness to inflammatory cytokines, especially
cytokines such as IL-1, which have the potential to stimulate MMP
expression. In the present study we examined the in vivo and
in vitro ability of progesterone to regulate endometrial
stromal cell secretion of MMP-3 in response to IL-1 challenge. Our
results show that endometrial exposure to progesterone, either in
vivo or in vitro, induces an insensitivity to IL-1,
as determined by stromal cell expression of MMP-3 protein and mRNA.
This rapid, progesterone-mediated decrease in IL-1 sensitivity may
ensure the structural integrity of the endometrium and developing
placenta despite the invasive events that take place during the
establishment of normal pregnancy.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Endometrial tissues were obtained from a normal donor population of women (aged 21–45 yr) exhibiting regular menstrual cycles. Endometrial thickness of 9 mm or more was determined by pelvic ultrasound before proceeding with biopsy of the uterine fundus using a Pipelle curette (Unimar, Inc., Wilton, CT). Serum progesterone values were determined by immunoassay (38), with less than 1.5 ng/mL defining the proliferative phase and 1.5 ng/mL or more representing the secretory phase. Tissue was immediately placed in cold phenol red-free DMEM/Ham’s F-12 medium (DME/F-12; Sigma, St. Louis, MO), and washed to remove residual blood and mucus. The use of human tissues was approved by the Vanderbilt University institutional review board and committee for the protection of human subjects.
Experimental media and general culture conditions
All cultures were maintained for the first 24 h in DME/F-12
with 5% charcoal-stripped calf serum (HyClone Laboratories, Inc., Logan, UT) and estradiol (E; 10-9
mol/L), and all media were supplemented with 1%
insulin-transferrin-selenium-X (Life Technologies, Inc.,
Gaithersburg, MD), 0.1% Pentex Ex-Cyte III (Bayer Corp.,
Kankakee, IL), and an antibiotic/antimycotic solution (Hybri-Max,
Sigma). Specific experimental medium components are listed
in detail below. Cultures were incubated at 37 C in a humidified
chamber with 95% air/5% CO2. Stock solutions of
ß-estradiol, progesterone (Sigma), and onapristone
(Schering AG, Berlin, Germany) were prepared in absolute
ethanol and further diluted in experimental medium. The concentrations
of additives, unless otherwise noted, were: E alone,
10-8 mol/L; estradiol plus progesterone, (EP;
E = 10-9 mol/L; P, 5 x
10-7 mol/L), onapristone (Ona; 5 x
10-6 mol/L), and recombinant human IL-1 (100
pg/mL; R&D Systems, Inc., Minneapolis MN).
Organ culture of endometrial tissue
After removal of residual blood and mucus, tissue was sectioned
into uniform 2 x 2-mm3 fragments, divided
equally, and placed in tissue culture inserts (Millipore Corp., Bedford, MA) as previously described (16). After the
initial 24-h adjustment period, tissue was treated with steroids alone
in DME/F-12 medium for 24 h, with IL-1 added subsequently to
designated groups for an additional 24 h. During radiolabeling of
secreted proteins, tissue was changed to methionine-free medium, and
experimental treatments were continued throughout the labeling period
for a total cytokine exposure of 48 h.
Isolation and culture of endometrial stromal cells
Tissue was enzymatically digested as described previously (39)
with minor modification. Briefly, tissue fragments were incubated in
medium containing 0.4% type IV collagenase (Worthington Biochemical Corp., Freehold, NJ), 0.02% deoxyribonuclease I,
and 2% chicken serum (Sigma) for 1 h at 37 C.
Stromal cells were separated from epithelial gland fragments by
consecutive filtrations through nylon mesh (Small Parts, Inc., Miami
Lakes, FL) of 85 and 20 µm pore size. Cell purity was assessed by
immunolocalization of cytokeratins; less than 5% contamination by
epithelial cells was routinely observed. Stromal cells (2 x
105/well) were plated on a dry film of type IV
mouse collagen (Becton Dickinson and Co., Bedford MA) in
48-well tissue culture plates (Falcon, Lincoln Park NJ), with duplicate
treatment groups or were grown to confluence in
75-cm2 tissue culture flasks for total RNA
isolation as described below. After the initial 24-h adjustment period,
experimental treatments with steroids proceeded for 2–6 days as
indicated in DME/F-12 medium with 3% charcoal-stripped calf serum.
Designated experimental groups were challenged with IL-1 and
continued for 24 h. During radiolabeling of secreted proteins,
cells were changed to methionine-free medium, and experimental
treatments were continued throughout the labeling period, for a total
cytokine exposure of 48 h. Medium changes occurred every 2–3 days
for all experimental treatment groups, as appropriate.
Metabolic labeling and analysis of MMP secretion in vitro
Secretion of pro-MMP-3 was analyzed after [35S]methionine labeling (100 µCi/mL) for the last 22 h of culture at 37 C in DMEM/methionine-free medium (ICN Biomedicals, Inc., Aurora, OH) as previously described (16). Briefly, radiolabeled proteins were quantitated by trichloroacetic acid precipitation, and equivalent trichloroacetic acid-precipitable counts (2 x 105 cpm) were immunoprecipitated with a polyclonal antibody directed against a synthetic peptide corresponding to a deduced sequence in the carboxyl-terminus of human pro-MMP-3 (Research Genetics, Inc., Huntsville, AL) that recognizes both the proenzyme and activated forms of MMP-3. The resulting complexes were removed with protein A-Sepharose (Sigma) and identified by SDS-PAGE and autoradiography. Samples from the same experiment were analyzed simultaneously on a single electrophoresis apparatus, with each gel containing positive and negative controls, i.e. E plus IL-1 and EP, respectively.
RNA extraction from cultured endometrial stromal cells
Total RNA was extracted from stromal cells grown to confluence in 75-cm2 tissue culture flasks for RT-PCR. After culture and treatment, cells were washed twice with phosphate-buffered saline and removed by enzymatic digestion with 0.05% trypsin/0.02% ethylenediamine tetraacetate (Life Technologies, Inc., Grand Island, NY). Cells were suspended in 5% charcoal-stripped calf serum to neutralize enzymatic action and centrifuged. RNA was recovered by the single step method of Chomzynski and Sacchi (40, 41) with slight modification. Briefly, the stromal cell pellet was lysed in Tri-Reagent (Molecular Research Center, Inc., Cincinnati, OH), and the homogenate was separated into aqueous and organic phases by the addition of chloroform and centrifugation. RNA is precipitated from the aqueous phase with isopropanol, washed with ethanol, and solubilized in nuclease-free H2O (Promega Corp., Madison, WI). Extracted RNA was quantitated by its absorbance at 260 nm.
RT-PCR
Expression of MMP-3 mRNA and the constitutively expressed mitochondrial gene, cytochrome c oxidase subunit I (CO-I) mRNA (42) was analyzed. RT-PCR was carried out with the use of a reagent kit (Access RT-PCR System, Promega Corp., Madison, WI) and a thermal cycler (model PTC-100, MJ Research, Inc., Watertown, MA). Equal amounts of total RNA (50 and 5 ng for MMP-3 and CO-I, respectively) were reverse transcribed per reaction. The sense primer for MMP-3 was ATTTATTTCTCGTTGCTGCTCATGA, and the antisense primer was TATGTTTTGTTCTTTTCCTTATCAG, producing a product of 573 bp (43). MMP-3 RNA was reverse transcribed at 48 C for 45 min, followed by 2.5 min at 94 C to inactivate the enzyme. Second strand complementary DNA synthesis and PCR amplification were carried out for 38 cycles as follows: 1 min at 54 C, 3 min at 68 C, and a final extension step at 68 C for 3 min. Amplification of CO-I was performed in a companion tube to comparatively determine the quantity of the PCR products and confirm the integrity of the RNA. The sense primer for CO-I was CGTCACAGCCCATGCATTTG, and the antisense primer was GGTTAGGTCTACGGAGGCTC, producing a product of 268 bp (42). The number of PCR cycles was within the linear logarithmic phase of the amplification curve. CO-I RNA was reverse transcribed for 45 min at 48 C, followed by inactivation at 94 C for 2.5 min. PCR amplification was carried out for 21 cycles as follows: 1 min at 57 C, 30 s at 70 C, and a final extension step at 70 C for 3 min. DNA contamination was excluded using an amplification mixture containing all reagents except the reverse transcriptase (negative control). In addition, RNA and primers provided with the RT-PCR kit were included in each assay as a positive control. Gel analysis was performed with 18 µL of each MMP-3 product and 9 µL CO-I product, separated by electrophoresis on a 2% agarose-Tris-borate-ethylenediamine tetraacetate gel, and visualized with the use of ethidium bromide. The sizes of amplified products were compared with molecular weight markers run in parallel. The PCR products were photographed using a Polaroid (Cambridge, MA) system, and exposed films were scanned and analyzed by optometric scanner (model GS-700, Bio-Rad Laboratories, Inc., Hercules, CA), and the integrated optical density in arbitrary units was determined using the Molecular Analyst software (Bio-Rad Laboratories, Inc.). The levels of MMP-3, normalized to the CO-I control value, were calculated, and the results were expressed as relative amounts of mRNA.
Statistical analysis
Analysis of stromal cell data was performed on results obtained from three to eight experiments, as indicated, performed in duplicate and are expressed as the mean ± SEM. Immunoprecipitated protein was quantified by excision of each protein band from the polyacrylamide gel and determination of total counts by scintillation detection. Statistical analysis was performed by paired t test (44). P < 0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In a previous study we demonstrated that the simultaneous addition
of IL-1 to organ cultures of proliferative phase human endometrium
treated with either E or EP, resulted in stimulation of MMP-3
expression (45). We proposed that a stimulation of local endometrial
MMP expression by this inflammatory cytokine at the site of
implantation could destabilize the endometrium and interfere with the
establishment of a normal pregnancy. Therefore, the goal of the current
study was to determine whether prior progesterone exposure in
vivo or in vitro might influence the subsequent impact
of IL-1 on MMP-3 expression. In preliminary experiments we exposed
proliferative phase endometrial tissue to EP for 24 h in organ
culture before challenge with IL-1. As shown in Fig. 1A
, exposure of this tissue to IL-1
resulted in increased MMP-3 secretion despite the presence of
progesterone preceding the cytokine challenge (compare lanes 1 and 2).
This finding supports our previous study (45) and indicates that short
term exposure to progesterone is not able to prevent IL-1-mediated
stimulation of MMP-3 expression in organ cultures established from
proliferative phase endometrial tissue. However, in contrast to a high
degree of IL-1 sensitivity in proliferative phase endometrium, we
observed that responsiveness to this cytokine was dramatically
diminished in tissue obtained during the secretory phase of the cycle.
As shown in Fig. 1B, endometrial tissue obtained during the early
secretory phase (serum progesterone values > 1.5 ng/mL) and
placed in an identical organ culture system was unresponsive to IL-1
stimulation of MMP-3 (compare lanes 1 and 2). In further support of
this finding, 11 of 13 additional endometrial samples examined
throughout the early and midsecretory phase of the cycle (serum
progesterone values of 1.6–28.5 ng/mL) showed a consistent absence of
responsiveness to IL-1, as determined by the loss of MMP-3
stimulation (data not shown). Together these results indicate that
although proliferative phase endometrium remains sensitive to IL-1
after short term exposure of organ cultures to progesterone, in
vivo exposure to this steroid in the secretory phase of the cycle
appears to substantially reduce tissue sensitivity to IL-1.
|
in isolated stromal cells is
progesterone dependent
Results from our organ culture study clearly demonstrated that
progesterone exposure in vivo resulted in a loss of IL-1
responsiveness relative to MMP-3 secretion. However, short term organ
culture of proliferative endometrium in the presence of progesterone
did not induce a loss of sensitivity to IL-1. Although we interpret
this finding to indicate that a longer exposure to progesterone may be
required to alter responsiveness to IL-1, it is also likely that
interactions among multiple cell types in the organ culture system may
complicate this experimental approach. Several laboratories, including
ours, have used isolated endometrial stromal cells to demonstrate that
progesterone suppression of MMP-3 mRNA and protein expression in
vitro can be antagonized by IL-1 or IL-ß (17, 20, 27, 45, 46). Therefore, to circumvent the potential limitation of using short
term organ cultures of endometrial tissue, we investigated progesterone
regulation of cytokine action further in isolated stromal cells. In
these experiments, stromal cells were purified from proliferative phase
biopsies to eliminate prior exposure to progesterone in
vivo. As shown in Fig. 2, A and B,
without steroid support in vitro (steroid free), MMP-3
levels remain low, while addition of IL-1 induces the maximum
increase in MMP-3 secretion observed in this culture system. Although a
high stimulation of MMP-3 secretion was obtained under steroid-free
conditions, the absence of steroids does not reflect the normal steroid
physiology of the secretory endometrium but, rather, correlates with
conditions found during menstruation (32, 46). As maintenance of
stromal cells in E alone results in expression of MMP-3 similar to that
found in the steroid-free group, we chose the stimulation index
observed in the E group vs. the E plus IL-1 (E+IL-1)
group as the positive control for our model system. Reflective of data
obtained in organ culture of proliferative phase tissue, IL-1
treatment of isolated stromal cells in the presence of E (E+IL-1)
stimulates the secretion of MMP-3 approximately 2-fold. However, in
contrast to results obtained with organ cultures of proliferative
endometrium, the addition of progesterone (EP) to isolated stromal
cells both suppressed MMP-3 expression (E vs. EP groups) and
significantly inhibited (P = 0.02) the ability of
IL-1 (EP+IL-1) to stimulate the expression of MMP-3 (E+IL-1
vs. EP +IL-1 groups). The ability of progesterone to
suppress IL-1 stimulation of MMP-3 in isolated stromal cells was
also demonstrated at the level of messenger RNA expression. As shown in
Fig. 2, C and D, MMP-3 mRNA expression by stromal cells cultured under
comparable conditions parallels that of protein secretion. More
specifically, stromal cells treated with E alone exhibit elevated
levels of MMP-3 mRNA expression compared to treatment with EP, which
shows total suppression, and subsequent treatment of either group with
IL-1 (E+IL-1 vs. EP+IL-1) did not alter the pattern of
MMP-3 mRNA expression.
|
stimulation of MMP-3 during
the secretory phase of the menstrual cycle. Therefore, to explore the
temporal boundaries of IL-1 loss of sensitivity, cells were treated
with EP for 2, 4, or 6 days, followed by IL-1 challenge. The results
shown in Fig. 3, A and B, demonstrate
that a reduction in IL-1 responsiveness can be induced in purified
stromal cells in as little as 2 days and maintained in vitro
for a minimum of 6 days compared to the positive control (E+IL-1). To
determine whether the loss of sensitivity to IL-1 requires the
binding of progesterone to the progesterone receptor, stromal cells
were treated with the progesterone antagonist, onapristone, at the time
of IL-1 challenge. Onapristone has been shown by other investigators
to antagonize progesterone action in isolated endometrial cells (32, 47). The results of these experiments are shown in Fig. 4, A and B, and indicate that blocking
the progesterone receptor with onapristone partially reduces the
ability of progesterone to decrease stromal cell sensitivity to
IL-1.
|
|
responsiveness in
endometrial stromal cells. Clinically, reduced ovarian progesterone
production, as found in luteal phase defect (48, 49), has been linked
to pregnancy loss (4, 50), whereas the overexpression of inflammatory
cytokines, including IL-1, has been implicated in preterm labor (36).
Therefore, we next examined the concentration-dependent nature of
progesterone and IL-1 regulation of MMP-3 expression. As shown in
Fig. 5, A and B, treatment of stromal
cells with decreasing progesterone concentrations (5 x
10-7–10-9 mol/L)
resulted in a return of IL-1 sensitivity, as indicated by increasing
MMP-3 secretion. In contrast to the results obtained by varying
progesterone concentrations, stromal cells exposed to increasing levels
of IL-1 (100 pg/ml to 30 ng/ml) showed no increase in MMP-3
secretion as long as a constant level of progesterone was maintained
(5 x 10-7 mol/L; data not shown). These
results suggest that endometrial responsiveness to IL-1 stimulation
of MMP-3 is more sensitive to fluctuating progesterone levels than to
changes in cytokine exposure. Although IL-1 has been shown to
antagonize progesterone regulation of MMPs by a number of laboratories
(17, 20, 27, 45, 46), the current results demonstrate that prior
progesterone exposure may prevent stimulation of MMPs by inflammatory
cytokines in the normal secretory endometrium.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although locally produced cytokines often act cooperatively with
steroids to regulate specific endometrial functions (5, 6, 21),
inflammatory cytokines have been shown to oppose progesterone action.
For example, IL-1 or TNF- can prevent the decidualized stromal cell
release of prolactin (28, 54, 55) and renin (29) in vitro.
Several laboratories, including our group, have demonstrated the
ability of IL-1 to oppose progesterone regulation of endometrial MMPs,
(16, 17, 19, 20, 45, 56). However, the present study reveals that a
novel and temporally ordered interrelationship exists, by which prior
steroid exposure can limit the response of endometrial stromal cells to
IL-1. We find that progesterone exposure in vivo greatly
reduces the subsequent responsiveness of endometrial tissue to
IL-1-stimulated MMP-3 expression in organ culture, essentially
blocking stimulation of MMP-3 in response to this cytokine.
Furthermore, our in vitro model using isolated cells
demonstrates that progesterone can act directly on stromal cells to
reduce cellular sensitivity to IL-1. Human stromal cells isolated
during the proliferative phase of the menstrual cycle and exposed to
progesterone in vitro developed a resistance to subsequent
IL-1 stimulation of MMP-3 secretion. This acquired loss of stromal
cell sensitivity to IL-1 occurred very rapidly in vitro,
requiring as little as 2-day exposure to progesterone, and could be
blocked by treatment with onapristone, a progesterone receptor
antagonist. In addition to effects on MMP-3 protein secretion,
progesterone suppression of MMP-3 mRNA stimulation by IL-1 was
demonstrated, suggesting that steroid regulation occurs at the level of
transcription. Given these results, it is reasonable to speculate that
progesterone mediates a local loss of sensitivity to IL-1
stimulation of MMP-3 in the endometrium during the midsecretory phase
of the cycle when the endometrium is most receptive to embryo
implantation.
It is important to note that implantation normally occurs when levels
of IL-1 and the IL-1 type I receptor are elevated in endometrial
glandular epithelium (57, 58). Furthermore, some investigators have
suggested that members of the IL-1 family are essential for normal
maternal-fetal interactions (7), and successful implantation has been
linked to the release of IL-1 by human embryos in vitro
(26). It appears somewhat paradoxical that local IL-1 expression is
elevated at this time, yet this cytokine has the ability to oppose
progesterone-mediated stromal cell decidualization (28, 54, 55).
However, the results of the current study address this contradiction,
as progesterone levels are normally elevated for 5–7 days before the
local embryonic or epithelial cell release of IL-1. Furthermore, at the
time of implantation, a decrease in progesterone receptor concentration
has been identified in the luminal and glandular epithelium of multiple
species, including humans (59, 60, 61, 62, 63). It is possible that a transient
decrease in progesterone receptor concentration in luminal epithelial
cells may be necessary to allow focal MMP stimulation by IL-1 or other
paracrine mediators during initial endometrial penetration by
trophoblast cells. Whether IL-1 acts to stimulate MMP-3, MMP-7, or
other maternal MMPs during the establishment of normal human pregnancy
is not entirely clear at this juncture, although our laboratory has
found that MMP-7 mRNA is elevated in association with IL-1
expression at ectopic sites of pregnancy (27). Interestingly, the
antiprogestins onapristone and RU-486 are ineffective in the treatment
of ectopic pregnancy (64), possibly due to reduced stromal cell
decidualization at ectopic sites (65, 66). More relevant, however, is
that the results reported here are consistent with the ability of
antiprogestins to interfere with progesterone suppression of MMP-3 and
MMP-9 (32, 47), and represent a mechanism for pregnancy termination by
progestin antagonists. The presence of members of the IL-1 family at
the maternal-fetal interface suggests a potentially rapid mechanism for
broad MMP expression, resulting in pregnancy termination and expulsion
of the products of conception in the event of a failed pregnancy. In
support of this possibility, our study demonstrates that reducing
stromal cell sensitivity to IL-1 with progesterone is a
dose-dependent process, requiring constant steroid support in
vitro. The ability of IL-1 to stimulate MMP-3 was progressively
greater as progesterone levels were decreased in vitro below
those representative of the mid-secretory phase of the menstrual cycle
and early pregnancy (5 x
10-7–10-9 mol/L).
In summary, the current study suggests an important
progesterone-dependent mechanism to limit the expression of endometrial
MMPs in response to inflammatory cytokines such as IL-1. As
illustrated in Fig. 6, IL-1 may be
released by endometrial epithelium, immune cells, or invasive
trophoblasts and is capable of stimulating MMP-3 in proliferative phase
stromal cells. After exposure to progesterone, however, differentiated
stromal cells become insensitive to cytokine-mediated MMP-3
stimulation. Although this response can be observed after progesterone
exposure either in vivo or in vitro, the precise
mechanisms controlling the expression of specific MMPs at the
maternal-fetal interface, which contains both stimulators and
suppressors of these enzymes, remain to be elucidated. Future studies
are needed to reveal the downstream effectors that mediate the
responses of differentiated stromal cells to both progesterone and IL-1
relative to MMP-3 expression. Nevertheless, the loss of sensitivity
demonstrated by endometrial stromal cells to inflammatory cytokines
that participate in the normal maternal-fetal communication of
pregnancy would probably contribute to the stability of the uterine
environment during implantation and placentation. A shift in the
equilibrium during pregnancy failure due to inadequate progesterone
action may promote increased inflammatory cytokine responsiveness and
provide a mechanism for the up-regulation of MMP expression, resulting
in placental breakdown and detachment. A better understanding of how
the endometrium acts to minimize MMP expression during the
establishment of pregnancy may potentially contribute to improved
treatments for infertility, placental defects, and pregnancy loss.
|
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Supported by a minority supplement to Grant HD-28128.
Received July 1, 1999.
Revised November 24, 1999.
Accepted December 15, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and tumor
necrosis factor-. J Clin Endocrinol Metab. 79:530–536.[Abstract]
and
its dual block by ovarian steroids. Proc Natl Acad Sci USA. 94:10341–10345. opposes progesterone-mediated suppression of MMP-7: a
possible role of this cytokine during implantation. Ann NY Acad Sci. 828:137–145.[Medline]
and interleukin-1ß inhibit the synthesis and
release of renin from human decidual cells. J Clin Endocrinol
Metab. 80:195–199.[Abstract]
release in
vitro by human gestational tissues. J Endocrinol. 150:515–522.
(TNF-) in human endometrium and uterine secretion: an evaluation by
immunohistochemistry, ELISA and semiquantitative RT-PCR. Mol Hum
Reprod. 5:146–152. opposes suppression of human endometrial matrix
metalloproteinases by progesterone in a model of experimental
endometriosis. In: Lemay A, Maheux R, eds. Understanding and managing
endometriosis. New York: Parthenon; 123–130.
This article has been cited by other articles:
 |
|
 |
|
  C. M. Pretto, H. P. Gaide Chevronnay, P. B. Cornet, C. Galant, D. Delvaux, P. J. Courtoy, E. Marbaix, and P. Henriet Production of Interleukin-1{alpha} by Human Endometrial Stromal Cells Is Triggered during Menses and Dysfunctional Bleeding and Is Induced in Culture by Epithelial Interleukin-1{alpha} Released upon Ovarian Steroids Withdrawal J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 4126 - 4134. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Bruner-Tran, Z. Zhang, E. Eisenberg, R. C. Winneker, and K. G. Osteen Down-Regulation of Endometrial Matrix Metalloproteinase-3 and -7 Expression in Vitro and Therapeutic Regression of Experimental Endometriosis in Vivo by a Novel Nonsteroidal Progesterone Receptor Agonist, Tanaproget J. Clin. Endocrinol. Metab., April 1, 2006; 91(4): 1554 - 1560. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Lockwood, P. Toti, F. Arcuri, M. Paidas, L. Buchwalder, G. Krikun, and F. Schatz Mechanisms of Abruption-Induced Premature Rupture of the Fetal Membranes: Thrombin-Enhanced Interleukin-8 Expression in Term Decidua Am. J. Pathol., November 1, 2005; 167(5): 1443 - 1449. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Hudelist, H. Lass, J. Keckstein, I. Walter, F. Wieser, R. Wenzl, R. Mueller, K. Czerwenka, E. Kubista, and C.F. Singer Interleukin 1{alpha} and tissue-lytic matrix metalloproteinase-1 are elevated in ectopic endometrium of patients with endometriosis Hum. Reprod., June 1, 2005; 20(6): 1695 - 1701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Strakova, M. Szmidt, S. Srisuparp, and A. T. Fazleabas Inhibition of Matrix Metalloproteinases Prevents the Synthesis of Insulin-Like Growth Factor Binding Protein-1 during Decidualization in the Baboon Endocrinology, December 1, 2003; 144(12): 5339 - 5346. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. B Jones, D. C Sane, and D. M Herrington Matrix metalloproteinases: A review of their structure and role in acute coronary syndrome Cardiovasc Res, October 1, 2003; 59(4): 812 - 823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. E. Curry Jr. and K. G. Osteen The Matrix Metalloproteinase System: Changes, Regulation, and Impact throughout the Ovarian and Uterine Reproductive Cycle Endocr. Rev., August 1, 2003; 24(4): 428 - 465. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Pilka, C. Whatling, H. Domanski, S. Hansson, P. Eriksson, and B. Casslen Epithelial expression of matrix metalloproteinase-26 is elevated at mid-cycle in the human endometrium Mol. Hum. Reprod., May 1, 2003; 9(5): 271 - 277. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jayachandran, W. G. Owen, and V. M. Miller Effects of ovariectomy on aggregation, secretion, and metalloproteinases in porcine platelets Am J Physiol Heart Circ Physiol, May 1, 2003; 284(5): H1679 - H1685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. L. Bruner-Tran, E. Eisenberg, G. R. Yeaman, T. A. Anderson, J. McBean, and K. G. Osteen Steroid and Cytokine Regulation of Matrix Metalloproteinase Expression in Endometriosis and the Establishment of Experimental Endometriosis in Nude Mice J. Clin. Endocrinol. Metab., October 1, 2002; 87(10): 4782 - 4791. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. E. Curry Jr and K. G. Osteen Cyclic Changes in the Matrix Metalloproteinase System in the Ovary and Uterus Biol Reprod, May 1, 2001; 64(5): 1285 - 1296. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
