| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Wallenberg Laboratory, Department of Endocrinology, University of Lund, Malmo 20502, Sweden
Address all correspondence and requests for reprints to: Dr. Xudong Huang, Wallenberg Laboratory, Department of Endocrinology, University of Lund, MAS 46 P 3, Malmo 20502, Sweden. E-mail: xudong.huang{at}endo.mas.lu.se
 |
Abstract |
|---|
 Top Abstract IntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The exact mechanism behind impaired glycogen synthase gene expression in skeletal muscle of type 2 diabetes is not known, particularly because there is little, if any, information available on the regulation of GYS1 gene expression by insulin. In addition to a genetic component, it has been proposed that hyperglycemia per se can contribute to impaired glycogen synthesis in patients with type 2 diabetes. In keeping with this hypothesis, chronic exposure of cultured human skeletal muscle cells from normal subjects to high insulin and/or glucose resulted in impaired glycogen synthase activity (11). The relative contributions of inherited and acquired defects to impaired skeletal muscle glycogen synthase activity are difficult to study in vivo in humans, as it would require study of the effect of hyperglycemia on an identical genetic background. We have taken advantage of our unique access to monozygotic twins by examining GYS1 gene expression and enzyme activity in muscle biopsies taken before and after an insulin clamp from 12 monozygotic twin pairs discordant for type 2 diabetes and from 12 control subjects (12, 13). Glycogen synthase protein concentrations were also measured in skeletal muscle from diabetic and nondiabetic subjects.
|
Subjects and Methods |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Twelve Caucasian monozygotic twin pairs discordant for type 2
diabetes and 12 healthy subjects without family history of diabetes
participated in the study. Type 2 diabetes had been diagnosed after the
age of 40 yr based upon a standardized 75-g oral glucose tolerance test
(14). The control subjects were matched to the nondiabetic twins for
age, sex, and body mass index (Table 1
).
Monozygosity of the twins was confirmed by genetic markers (13).
Insulin sensitivity was measured by a 3-h euglycemic hyperinsulinemic
clamp with prior infusion of insulin (15). Muscle biopsies were
obtained in the basal state (0 min) approximately 150 min after the
prior insulin infusion was stopped and at the end of the clamp (+180
min); samples were frozen immediately in liquid nitrogen and stored at
-80 C until analyzed. Informed consent was obtained from all subjects.
The protocol was approved by the regional ethics committee, and the
study was conducted according to the principles of the Declaration of
Helsinki. Insulin clamp data in the twins have been published
previously (13).
|
Extraction of muscle samples and assays for glycogen synthase were performed using a modified method of Thomas et al. (5). Briefly, glycogen synthase activity was measured in the presence of a near-physiological concentration of 0.1 mmol/L glucose-6-phosphate and in the presence of a high concentration of 10 mmol/L glucose-6-phosphate. The total concentration of uridine diphosphate glucose ([14C]UDPG and cold UDPG) was 0.31 mmol/L in the reaction. Fractional velocities were calculated as the ratio between glycogen synthase activities at 0.1 mmol/L glucose-6-phosphate and 10 mmol/L glucose-6-phosphate (FV 0.1). Total glycogen synthase activities were estimated as the activities at a glucose-6-phosphate concentration of 10 mmol/L and a total UDPG concentration of 5 mmol/L. Glycogen synthase activity was expressed as nanomoles of UDPG incorporated into glycogen per min/mg extract of protein. Data for GYS1 enzyme activity in the twins have been published previously (12).
Glycogen synthase messenger ribonucleic acid (mRNA)
The RNA expression of glycogen synthase was examined using a modified "primer-dropping" RT-PCR method (16). Total RNA was isolated from the muscle biopsies by the acid guanidinium thiocyanate method (17). Four hundred nanograms of total RNA from each sample were then reverse transcribed in a 40-µL reaction with a 5 µmol/L oligo(deoxythymidine)18 primer in the presence of 200 U Superscript II reverse transcriptase (Life Technologies, Inc., Glasgow, Scotland) and 25 µmol/L deoxy-NTP for 60 min at 37 C according to the manufacturer’s instruction. After heat inactivation of the reverse transcriptase at 95 C for 5 min, 2 µL of the RT reaction were added to 18 µL PCR mixture containing 16 mmol/L (NH4)2SO4, 67 mmol/L Tris base, 0.01% Tween-20, 0.2 mmol/L deoxy-NTP, 1.5 mmol/L MgCl2, 7.5% dimethylsulfoxide, 0.5 U Taq polymerase, 0.2 µmol/L primers for the GYS1 gene (GSF and GSR), and 0.6 µmol/L primers for the cyclophilin gene (cycloF and cycloR) as the reference. The GYS1 primer pairs (from 5' to 3') were TTCTGGACTGGAAATACCTAGGCCGG (GSF) and CTCTGCATCCTCTCTCTGGAGCAGAG (GSR). The cyclophilin primer pairs were GTCTCCTTTGAGCTGTTTGC (cycloF) and TGGCCTCCACAATATTCATGC (cycloR). To avoid genomic DNA amplification, the glycogen synthase primers define a region spanning introns 14 and 15 of the GYS1 gene (18), whereas cyclophilin primers define the intron-exon borders of the gene structure (GenBank accession no. X52851). The PCR was run for 40 cycles (96 C, 30 s; 62 C, 30 s; 72 C, 30 s) and was followed by a final extension at 72 C for 10 min. The PCR condition was optimized according to the primer-dropping method (16) to maintain coamplification within the exponential phase. Selection of the cyclophilin gene as a reference was based upon its unaffected expression in the insulin-resistant and diabetic state (19). Validation of this method has been described in a previous study (20). PCR products were separated on a 2% agarose gel containing ethidium bromide, photographed with UPP-110HA printing paper (Sony, Tokyo, Japan), and quantitated using Personal Densitometer SI scanner together with ImageQuant software (Molecular Dynamics, Sunnyvale, CA). The mRNA signals were expressed relative to that of cyclophilin.
Glycogen synthase protein
The glycogen synthase protein was measured in muscle biopsies taken from the twins with type 2 diabetes and control subjects after the insulin clamp. Muscle samples were homogenized in 20 mmol/L HEPES, 1 mmol/L ethylenediamine tetraacetate, and 250 mmol/L sucrose, pH 7.4. Total protein levels in muscle extract were measured using the Pierce Chemical Co. bicinchoninic acid protein assay (Pierce Chemical Co., Rockford, IL) according to the manufacturer’s instruction. Equal amounts of total protein (20 µg) from each sample were run in SDS-PAGE, transferred to nitrocellulose membranes, and blotted against an antibody raised in rabbit against a COOH-terminal 12-amino acid oligopeptide of human muscle glycogen synthase, as previously described (6). The blots was then incubated with a horseradish peroxidase- conjugated antirabbit IgG (Sigma, St. Louis, MO), and the signal was detected with the ECL Western Blot Detection Kit (Amersham Pharmacia Biotech, Aylesbury, UK). The amount of glycogen synthase protein was quantitated by scanning densitometry (Molecular Dynamics, Inc., Sunnyvale, CA) and expressed relative to the amount of total protein.
Analytical measurements
Plasma glucose was determined with an automated glucose oxidase method (Glucose Analyzer 2, Beckman Coulter, Inc., Fullerton, CA). Plasma insulin was measured using a double antibody RIA (Pharmacia Biotech, Uppsala, Sweden) and hemoglobin A1c (HbA1c) was measured by high pressure liquid chromatography (12, 13).
Statistical analysis
Data are expressed as the mean ± SEM. Statistical analysis was performed using an NCSS 6.0.21 statistical package (NCSS Statistical Software, Kaysville, UT). The significance of difference within or between groups was tested by Wilcoxon or Mann-Whitney rank tests. The relationship between various variables was analyzed by Spearman correlations.
|
Results |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
Fasting plasma glucose and HbA1c levels were
higher in the diabetic and the nondiabetic twins than in the control
subjects (Table 1
). Seven of the nondiabetic twins had impaired glucose
tolerance. Plasma insulin concentrations in the basal state and during
the clamp were similar in the diabetic (9.7 ± 2.3 and 73.6
± 7.2 µU/mL) and the nondiabetic (7.1 ± 0.9 and 69.4 ±
5.7 µU/mL) twins and the control subjects (6.4 ± 0.7 and
78.0 ± 4.5 µU/mL). Plasma glucose concentrations in the basal
state were only slightly higher in the diabetic twins compared with
those in the nondiabetic twins (7.0 ± 0.2 vs. 5.5
± 0.2 mmol/L; P < 0.001) and control subjects
(7.0 ± 0.2 vs. 5.4 ± 0.2 mmol/L;
P < 0.001). The diabetic twins had 55% lower rates of
insulin-stimulated glucose uptake (P < 0.01), 63%
lower rates of glucose storage (P < 0.01), and 37%
lower rates of glucose oxidation (P < 0.01) compared
with the control subjects (Table 1). The nondiabetic monozygotic
cotwins also had a 25% lower rate of insulin-stimulated glucose uptake
(8.5 ± 0.8 vs. 11.4 ± 0.9 mg/kg fat-free
mass·min; P < 0.03), which was due to a 37%
decrease in the rate of glucose storage (4.8 ± 0.6 vs.
7.6 ± 0.9 mg/kg fat-free mass ·min; P <
0.02) compared with that in the control subjects (Table 1).
Glycogen synthase activity
Insulin infusion increased GYS1 fractional activity in all
subjects, with no significant difference between the groups. However,
when expressed as the increment (
FV 0.1) over basal, GYS1 fractional
activity was significantly impaired in the diabetic twins compared with
the control subjects (P < 0.01; Fig. 1). Of note, FV 0.1 was not
significantly impaired in the nondiabetic twins compared with that in
the control subjects (Fig. 1). The GYS1 FV 0.1 activity correlated
with the rate of insulin-mediated glucose uptake (r = 0.62;
P < 0.001) and glucose storage (r = 0.57;
P < 0.001). There was a weaker correlation between the
absolute insulin-stimulated GYS1 FV 0.1 values and rates of glucose
uptake (r = 0.39; P = 0.01) and storage (r =
0.34; P = 0.04). Total GYS1 activity after the clamp
was not different among the three groups (Table 1).
|
Insulin infusion increased GYS1 mRNA expression 12-fold in the
control subjects (from 0.14 ± 0.02 to 1.74 ± 0.10 relative
units; P < 0.01) and 8-fold in the nondiabetic twins
(from 0.24 ± 0.05 to 1.81 ± 0.16 relative units;
P < 0.01), but only 5-fold (from 0.20 ± 0.07 to
1.08 ± 0.14 relative units; P < 0.01; Fig. 2) in the diabetic twins. Therefore,
stimulation of GYS1 mRNA expression by insulin was impaired in the
diabetic (P = 0.002), but not in the nondiabetic,
cotwins compared with that in the control subjects (Fig. 2). When the
nondiabetic twins were divided into subgroups of normal glucose
tolerance (NGT) and impaired glucose tolerance (IGT), both subgroups
showed a similar insulin-induced increase in GYS1 mRNA expression
[NGT, from 0.28 ± 0.10 to 1.71 ± 0.23 relative units
(P < 0.05; n = 5); IGT, from 0.19 ± 0.01 to
1.95 ± 0.24 relative units (P = 0.06; n =
4)] compared with that in the control subjects. There was no
significant correlation between postclamp GYS1 mRNA levels and
postclamp GYS1 fractional activity when expressed as either absolute
(r = 0.20; P = NS) or incremental (r = 0.29;
P = 0.11) values, nor was there any correlation between
the postclamp GYS1 mRNA level and the postclamp GYS1 total activity
(r = 0.10; P = NS). However, the level of
insulin-stimulated GYS1 mRNA expression showed a strong inverse
correlation with the HbA1c concentration (r
= -0.61; P < 0.001; Fig. 3). There was also an inverse correlation
between the incremental GYS1 fractional activity and the
HbA1c concentration (r = -0.46;
P < 0.01).
|
|
The postclamp GYS1 protein levels did not significantly differ
between the diabetic twins and the control subjects (2.10 ± 0.46
and 2.10 ± 0.34 relative units; P = NS; Fig. 4). In the control subjects, the
postclamp GYS1 protein concentrations correlated strongly with the
total GYS1 activity (r = 0.72; P = 0.03; n =
9), but not with the fractional GYS1 activity (r = 0.22;
P = NS). No such correlation was seen in the diabetic
twins, nor was there any significant correlation between postclamp GYS1
protein and mRNA concentrations (r = 0.29; P =
NS).
|
|
Discussion |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
The lack of correlation between GYS1 mRNA and fractional activity is
more difficult to explain. Insulin increases GYS1 activity through
dephosphorylation and allosteric modification by glucose-6-phosphate.
Insulin also regulates expression of a number of genes involved in
glucose metabolism and insulin action, such as phosphoenolpyruvate
carboxykinase, Rad, the p85
subunit of PI3-kinase, Glut4,
HKII (23, 24, 25, 26), and the mitochondria-encoded oxidative phosphorylation
genes (20). However, insulin regulation of GYS1 gene expression is
poorly known. In partial contrast to our findings, longer clamping for
4 h had no significant effect on GYS1 mRNA (21, 27) and protein
levels (10, 21, 27) in either control or diabetic subjects. Despite
this, in the control subjects in these studies, GYS1 mRNA expression
relative to total RNA tended to increase after insulin infusion (21, 27). Although differences in study subjects and/or experimental
methods, e.g. the age of studies, the internal RNA
reference, etc., could provide potential explanations for
this variation, the possible time course of the insulin effect should
also be considered. In support of this, GYS1 mRNA levels increased
after 1 h of exposure of cultured human skeletal muscle cells to
33 nmol/L insulin without significant changes in GYS1 mRNA and its
protein expression after 4 days of exposure (11). Similarly, Okubo
et al. showed an initial increase in glycogen synthase mRNA
expression 1 h after exposure of hepatoma H4 cells to insulin,
with a subsequent decline (28). In keeping with these findings we
observed a temporary increase in glycogen synthase gene expression in
skeletal muscle from rats exposed to 36 h of insulin infusion
(unpublished data). In the present study we observed a significant
increase in GYS1 mRNA expression not only in the control subjects but
also in the diabetic subjects after 3 h of insulin infusion. The
precise nature by which insulin influences GYS1 gene expression is not
known. We did not find any core sequences of the known insulin response
elements (IREs) in a promoter region 1.7 kb upstream of the translation
start site of the GYS1 gene (29) by searching sequence similarity with
the known IREs (30). This could suggest that the putative IRE might be
located further upstream of the promoter of the GYS1 gene.
Fractional and total GYS1 activities as well as mRNA levels were
similar in the basal state among type 2 diabetic twins, nondiabetic
twins, and control subjects. This is in contrast to some previous
studies reporting decreased basal (fasting) fractional and total GYS1
activities (9, 22) or GYS1 mRNA expression (9, 10) in type 2 diabetic
subjects compared with control subjects. One explanation for this
discrepancy could be that we used a prior iv insulin infusion to lower
the compensatory effect of fasting hyperglycemia on glucose metabolism.
Thereby we obtained similar basal plasma insulin concentrations and
nearly similar basal plasma glucose concentrations in the diabetic and
nondiabetic twins and the control subjects. Thus, the basal or preclamp
measurements of GYS1 enzyme activity, mRNA, and protein levels in the
diabetic twins in this study were more comparable to those in the
nondiabetic controls compared with studies in which the basal muscle
biopsies in diabetic subjects were taken at higher fasting plasma
glucose and insulin levels. In this scenario, the lower GYS1 FV
0.1 activity in the diabetic twins would represent the impaired
response to insulin stimulation.
The data, however, clearly showed that expression of the GYS1 mRNA is resistant to the action of insulin in patients with type 2 diabetes and that this insulin resistance obviously is an acquired defect due to chronic hyperglycemia. High glucose has been shown to influence the expression of a number of genes, including the insulin gene in pancreatic ß-cells, by interfering with glucose response elements (31). Nothing is known about the putative mechanisms by which high glucose could influence GYS1 gene expression. GYS1 mRNA expression was decreased in skeletal muscle in the insulin-resistant type 2 diabetic patients (9, 10), but not in insulin-resistant nondiabetic subjects (32). The decreased GYS1 mRNA expression was also observed in skeletal muscle cultures from type 2 diabetic patients and was restored to normal by insulin infusion (33). Thus, this may suggest a role for glucose toxicity in down-regulation of the GYS1 mRNA expression in diabetic patients, as indicated by the inverse correlation between GYS1 mRNA expression and HbA1c shown in the present study. A decrease in GYS1 protein concentration would be expected to follow its decreased mRNA expression. The disparity between GYS1 mRNA and its protein expression in the diabetic patients points at the presence of compensatory mechanisms at the posttranscriptional level. In keeping with this view, it has been shown in man that acute physiological elevation of circulating insulin levels inhibits protein breakdown (34). Other studies have shown that insulin treatment restores overall protein synthesis in diabetic animals (35) and increases protein synthesis of glycogen synthase in rat hepatoma H4 cells (36). The similarity of GYS1 protein concentrations between diabetic and control subjects would imply that this effect is normally sensitive to insulin in diabetic subjects.
In summary, insulin up-regulates skeletal muscle glycogen synthase mRNA expression, and this effect is impaired in type 2 diabetes. This defect is acquired and most likely secondary to chronic hyperglycemia.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received July 29, 1999.
Revised November 30, 1999.
Accepted December 23, 1999.
|
References |
|---|
|
TopAbstractIntroductionSubjects and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M. Bhat, S. K. Kothiwale, A. R. Tirmale, S. Y. Bhargava, and B. N. Joshi Antidiabetic Properties of Azardiracta indica and Bougainvillea spectabilis: In Vivo Studies in Murine Diabetes Model Evid. Based Complement. Altern. Med., April 23, 2009; (2009) nep033v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. An, B. I. Freedman, C. L. Hanis, Y.-D. I. Chen, A. B. Weder, N. J. Schork, E. Boerwinkle, M. A. Province, C. A. Hsiung, X. Wu, et al. Genome-wide Linkage Scans for Fasting Glucose, Insulin, and Insulin Resistance in the National Heart, Lung, and Blood Institute Family Blood Pressure Program: Evidence of Linkages to Chromosome 7q36 and 19q13 From Meta-Analysis Diabetes, March 1, 2005; 54(3): 909 - 914. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Bouche, S. Serdy, C. R. Kahn, and A. B. Goldfine The Cellular Fate of Glucose and Its Relevance in Type 2 Diabetes Endocr. Rev., October 1, 2004; 25(5): 807 - 830. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Huang, A. Vaag, E. Carlsson, M. Hansson, B. Ahren, and L. Groop Impaired Cathepsin L Gene Expression in Skeletal Muscle Is Associated With Type 2 Diabetes Diabetes, September 1, 2003; 52(9): 2411 - 2418. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Maier and A. Olek Diabetes: A Candidate Disease for Efficient DNA Methylation Profiling J. Nutr., August 1, 2002; 132(8): 2440S - 2443. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Huang, A. Vaag, M. Hansson, and L. Groop Down-Regulation of Insulin Receptor Substrates (IRS)-1 and IRS-2 and Src Homologous and Collagen-Like Protein Shc Gene Expression by Insulin in Skeletal Muscle Is Not Associated with Insulin Resistance or Type 2 Diabetes J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 255 - 259. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
