| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Special Articles |
Unitat de Diabetologia, Endocrinologia i Nutricio, University Hospital of Girona "Dr Josep Trueta," 17007 Girona; and Unitat dEndocrinologia, Hospital of Tarragona "Joan XXIII," Facultat Medicina, Universitat Rovira i Virgili, 43007 Tarragona, Spain
Address correspondence and requests for reprints to: J. M. Fernandez-Real, M.D., Ph.D., Unitat de Diabetologia, Endocrinologia i Nutrició, University Hospital of Girona "Dr Josep Trueta," Carretera de França s/n, 17007 Girona, Spain. E-mail: endocrino{at}htrueta.scs.es
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
IL-6 inhibits adipocyte lipoprotein lipase activity (6) and induces increases in hepatic triglyceride secretion (7) in rats. In man, the action of IL-6 is also associated with increased plasma free fatty acids (FFAs) (8). Given the pathophysiological role of IL-6 on lipid metabolism, it is plausible to hypothesize alterations in plasma lipid levels attributed to genetic differences in IL-6 transcription rate.
Recently, a polymorphism in the 5' flanking region of the IL-6 gene (at position -174) has been reported in which the transcriptional response to stimuli such as endotoxin and IL-1 is altered (9). Specifically, subjects with the G allele showed higher plasma IL-6 levels compared with carriers of the C allele (9).
Given the higher IL-6 levels found in patients with lipid abnormalities of the insulin-resistance syndrome and the possible role of IL-6 in FFA and triglyceride metabolism, we aimed to study the IL-6 G/C polymorphism in relation with fasting and postglucose load FFA levels and fasting plasma lipids.
| Subjects and Methods |
|---|
|
|
|---|
Subjects.Thirty-two healthy subjects (17 women) were included in this study. All subjects were of Caucasian origin. Inclusion criteria were: 1) body mass index (BMI; weight in kilograms divided by the square of height in meters) <40 kg/m2; 2) absence of any systemic disease; and 3) absence of any infections in the previous month. All subjects reported that their body weight had been stable for at least 3 months before the study, and all were normotensive (the latter data not shown). None of the subjects were taking any medication (including glucocorticoids or estrogens) or had any evidence of metabolic disease other than obesity. Liver disease and thyroid dysfunction were specifically excluded by biochemical workup. All women had regular menstrual cycles. The protocol was approved by the Hospital Ethics Committee, and informed consent was obtained from each subject.
Procedures
Anthropometric measurements included BMI and waist to hip ratio (WHR). The subjects waist was measured with a soft tape midway between the lowest rib and the iliac crest. The hip circumference was measured at the widest part of the gluteal region.
The FFA suppression after oral glucose was evaluated in 20 of these subjects. These subjects were required to consume a weight-maintaining diet containing at least 300 g carbohydrate per day and refrained from exertion for 3 days before the study. The subjects also abstained from caffeine and alcohol for 72 h before the test. An oral glucose tolerance test (OGTT) was performed according to recent recommendations (10). After a 12-h overnight fast, glucose was ingested in a dose of 75 g, and blood samples were collected through a venous catheter from an antecubital vein at 0, 30, 60, 90, and 120 min for measurement of serum glucose. FFAs were determined in the fasting state and 120 min after the OGTT. [smh3]Analytical methods. The serum glucose level was measured in duplicate by the glucose oxidase method, with a coefficient of variation below 2%. Serum insulin was measured using a monoclonal immunoradiometric assay (Medgenix Diagnostics, Fleunes, Belgium). Serum IL-6 was measured using a commercial immunoassay (MEDGENIX IL-6 EASIA; Biosource Technologies, Inc., Europe S.A., Zoning Industriel B-6220, Fleunes, Belgium).
FFA levels were measured enzymatically (bioMerieux, MarcylEtoile, France), with oleic acid as standard. Total serum cholesterol was measured through the reaction of cholesterol esterase/cholesterol oxidase/peroxidase (11). Very low-density lipoprotein (VLDL)-cholesterol was measured after ultracentrifugation at 45,000 x g, which was performed using a ultracentrifuge Beckman Coulter, Inc. XL-70, with a rotor 50.4 Ti. HDL cholesterol was quantified after precipitation with polyethylene glycol at room temperature (12). Total serum triglycerides were measured through the reaction of glycerol-phosphate-oxidase and peroxidase (13). VLDL triglycerides were measured after ultracentrifugation at 45,000 x g. LDL-cholesterol was calculated as total cholesterol - (VLDL-cholesterol + HDL-cholesterol).
Restriction fragment length polymorphism (RFLP)-IL-6 gene analysis
DNA was extracted from cellular blood components by the salting-out method. The PCR was used to detect the IL-6 SfaNI RFLP. The SfaNI polymorphism is due to a replacement of G by C at position 174, and primers were designed to amplify the promoter region of IL-6 gene. The primers used in the PCR were: 5' TGACTTCAGCTTTACTCTTTGT 3' and 5' CTGATTGGAAACCTTATTAAG 3'. The reaction was carried out in a final volume of 50 mL containing 1.5 mmol/L of MgCl2, 0.2 mmol/L each dNTP (Boehringer Mannheim, Mannheim, Germany), 0.2 mmol/L each primer, and 2.5 U Taq polymerase (Life Technologies, Inc., Gaithersburg, MD). DNA was amplified during 35 cycles with an initial denaturation of 10 min at 94 C and a final extension of 10 min at 72 C. The cycle program consisted of a 1-min denaturation at 94 C, a 1-min, 35-sec annealing at 55 C, and a 1-min extension at 72 C. PCR products were digested with SfaNI restriction enzyme at 37 C overnight and electrophoresed on a 2% agarose gel. SfaNI RFLP was detected by ethidium bromide staining.
The identified genotypes were named according to the presence or absence of the enzyme restriction sites, so SfaNI (G/G), (G/C), and (C/C) are homozygotes for the presence of the site (140/58 bp), heterozygotes for the presence and absence of the site (198/140/58 bp), and homozygotes for the absence of the site (198 bp), respectively. The frequency of the alleles was C: 0.55, G: 0.45. The population was in Hardy-Weinberg equilibrium. X values were 1.30 and P = 0.52.
Statistical analysis.Descriptive results of continuous
variables are expressed as mean ± SD. Before
statistical analysis, normal distribution and homogeneity of the
variances were tested. Parameters that did not fulfill these tests
(HDL-2 cholesterol, triglycerides, VLDL-triglycerides, FFA) were
log-transformed. We used
2 test for
comparisons of proportions. Comparison of variables between groups of
subjects was performed using Students t test.
Relationships between variables were also sought by stepwise
multivariate linear regression analysis with forward selection. Levels
of statistical significance were set at P < 0.05.
| Results |
|---|
|
|
|---|
|
|
|
|
| Discussion |
|---|
|
|
|---|
In our study, the subjects with the G allele showed a tendency toward higher serum IL-6 levels. In fact, the six subjects with the highest serum IL-6 levels had the G allele. Interestingly, serum IL-6 levels correlated with postload FFAs and with fasting VLDL and total triglycerides. The latter association persisted after controlling for BMI and insulin levels. It should be kept in mind, however, that the circulating cytokine molecules are seldom found in the unbound state. They are almost always bound to binding or carriers proteins, autoantibodies, and soluble receptors. The usual sandwich-format immunoassays recover free, and some predictably bound cytokine, but misses other cytokine bound by unpredictable binding entities.
Higher IL-6 levels have been described in association with raised
plasma triglyceride concentration in epidemiological studies in men
with different cardiovascular risk factors (15) and with relatively
high plasma triglycerides and low HDL-cholesterol in healthy
centenarians (16). Together with our findings, it seems that those
individuals with a genetic predisposition to higher IL-6 secretion
(i.e. those with the G allele) are prone to develop higher
total and VLDL-triglycerides, higher plasma FFA, and lower
HDL2-cholesterol than subjects carriers of the C allele. In fact, the
latter subjects displayed a tightly regulated plasma triglyceride and
FFA concentration, as shown in Figs. 1
and 2
. In recent studies, it has
been shown that IL-6 induces physiological changes reminiscent of the
catabolic state, which include increased resting energy expenditure and
increases in plasma FFA. Specifically, infusions of recombinant human
IL-6 in humans induced a 60% increase in plasma FFA concentration and
a 105% increase in FFA rate of appearance in plasma (8). These effects
in humans might be due to the IL-6' effects on adipocyte lipoprotein
lipase activity (6) or hepatic triglyceride secretion (7) as
observed in rats.
Cytokines operate both as a cascade and as a network and can regulate
the production of other cytokines and cytokine receptors. In this
sense, perhaps the increased production of IL-6 is merely reflecting
the actions of other cytokines more closely involved in lipid
abnormalities, such as tumor necrosis factor-
(TNF-
).
Administration of TNF-
to humans increases serum triglyceride levels
by stimulating hepatic triglyceride synthesis and secretion (17). In a
recent study, plasma TNF-
concentration positively correlated with
VLDL triglycerides and negatively with HDL cholesterol in
postinfarction patients (18). We have recently described a significant
correlation between plasma levels of the soluble fraction of TNF-
and total triglycerides and HDL2 cholesterol (19). However, in contrast
to what occurs with IL-6, genetic polymorphisms of TNF-
do not
contribute to significant differences in plasma lipid concentration
(20).
In addition to lipid abnormalities, IL-6 contributes to atherogenesis in several other ways, such as by inducing adhesion molecules and increasing endothelial permeability. Higher circulating levels of IL-6 and C-reactive protein have been recently associated with mortality in healthy older persons (21). It cannot be excluded that hypertriglyceridemia and low HDL-cholesterol constitute confounding factors of this association (15, 16).
One limitation of this study is the small number of subjects. The size of the study has led possibly to potential type II errors (for example, HDL cholesterol would be significantly decreased if more subjects were studied). However, our subjects have been studied not only in fasting conditions, but also dynamically, after an oral glucose load, showing the blunted suppression of FFA. All the different measurements (fasting triglycerides, VLDL-triglycerides, basal and postload FFA) concur with the hypothesis that those individuals with the "higher cytokine responder genotype" display more probably lipid abnormalities.
In summary, a polymorphism of the IL-6 gene determines differences in plasma total and VLDL-triglycerides and in fasting and postglucose load FFA levels. In evolutionary terms, these findings are in agreement with the hypothesis that genetical predisposition to inflammation could be beneficial in the response to starvation and injury for our ancestors, providing substrates for brain metabolism, but this advantage is lost with westernization (22).
Received September 13, 1999.
Revised December 11, 1999.
Accepted January 10, 2000.
| References |
|---|
|
|
|---|
, in vivo. J Clin Endocrinol Metab. 82:41964200.
in disturbances of
triglyceride and glucose metabolism predisposing to coronary heart
disease. Metabolism. 47:113118.[CrossRef][Medline]
gene Ncol polymorphism influences the
relationship among insulin resistance, Percent body fat and increased
serum leptin levels. Diabetes. 46:14681472.[Abstract]
This article has been cited by other articles:
![]() |
Y. S. Kim, M. R. Young, G. Bobe, N. H. Colburn, and J. A. Milner Bioactive Food Components, Inflammatory Targets, and Cancer Prevention Cancer Prevention Research, March 1, 2009; 2(3): 200 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shen, D. K. Arnett, P. Perez-Martinez, L. D. Parnell, C.-Q. Lai, J. M. Peacock, J. E. Hixson, M. Y. Tsai, R. J. Straka, P. N. Hopkins, et al. The effect of IL6-174C/G polymorphism on postprandial triglyceride metabolism in the GOLDN study,boxs J. Lipid Res., August 1, 2008; 49(8): 1839 - 1845. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Turner, S. L.R. Kardia, T. H. Mosley, A. D. Rule, E. Boerwinkle, and M. de Andrade Influence of Genomic Loci on Measures of Chronic Kidney Disease in Hypertensive Sibships J. Am. Soc. Nephrol., July 1, 2006; 17(7): 2048 - 2055. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, Y. Berthier-Schaad, M. D. Fallin, N. E. Fink, R. P. Tracy, M. J. Klag, M. W. Smith, and J. Coresh IL-6 Haplotypes, Inflammation, and Risk for Cardiovascular Disease in a Multiethnic Dialysis Cohort J. Am. Soc. Nephrol., March 1, 2006; 17(3): 863 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. Escobar-Morreale, M. Luque-Ramirez, and J. L. San Millan The Molecular-Genetic Basis of Functional Hyperandrogenism and the Polycystic Ovary Syndrome Endocr. Rev., April 1, 2005; 26(2): 251 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Staiger, K. Staiger, N. Stefan, H. G. Wahl, F. Machicao, M. Kellerer, and H.-U. Haring Palmitate-Induced Interleukin-6 Expression in Human Coronary Artery Endothelial Cells Diabetes, December 1, 2004; 53(12): 3209 - 3216. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. McKenzie, E. P. Weiss, I. A. Ghiu, O. Kulaputana, D. A. Phares, R. E. Ferrell, and J. M. Hagberg Influence of the interleukin-6 -174 G/C gene polymorphism on exercise training-induced changes in glucose tolerance indexes J Appl Physiol, October 1, 2004; 97(4): 1338 - 1342. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ibanez, C. Valls, S. Cabre, and F. de Zegher Flutamide-Metformin Plus Ethinylestradiol-Drospirenone for Lipolysis and Antiatherogenesis in Young Women with Ovarian Hyperandrogenism: The Key Role of Early, Low-Dose Flutamide J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4716 - 4720. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Mozaffarian, T. Pischon, S. E Hankinson, N. Rifai, K. Joshipura, W. C Willett, and E. B Rimm Dietary intake of trans fatty acids and systemic inflammation in women Am. J. Clinical Nutrition, April 1, 2004; 79(4): 606 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Pankow, B. B. Duncan, M. I. Schmidt, C. M. Ballantyne, D. J. Couper, R. C. Hoogeveen, and S. H. Golden Fasting Plasma Free Fatty Acids and Risk of Type 2 Diabetes: The Atherosclerosis Risk in Communities study Diabetes Care, January 1, 2004; 27(1): 77 - 82. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Endler, C. Marsik, C. Joukhadar, R. Marculescu, F. Mayr, C. Mannhalter, O. F. Wagner, and B. Jilma The Interleukin-6 G(-174)C Promoter Polymorphism Does Not Determine Plasma Interleukin-6 Concentrations in Experimental Endotoxemia in Humans Clin. Chem., January 1, 2004; 50(1): 195 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Roth, M. A. Schrager, M. R. Lee, E. J. Metter, B. F. Hurley, and R. E. Ferrell Interleukin-6 (IL6) Genotype Is Associated With Fat-Free Mass in Men But Not Women J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2003; 58(12): B1085 - 1088. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Harding, S. Dhamrait, A. Millar, S. Humphries, N. Marlow, A. Whitelaw, and H. Montgomery Is Interleukin-6 -174 Genotype Associated With the Development of Septicemia in Preterm Infants? Pediatrics, October 1, 2003; 112(4): 800 - 803. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Fernandez-Real and W. Ricart Insulin Resistance and Chronic Cardiovascular Inflammatory Syndrome Endocr. Rev., June 1, 2003; 24(3): 278 - 301. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Fernandez-Real, M. Broch, J. Vendrell, and W. Ricart Insulin Resistance, Inflammation, and Serum Fatty Acid Composition Diabetes Care, May 1, 2003; 26(5): 1362 - 1368. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Fernandez-Real, M. Broch, C. Richart, J. Vendrell, A. Lopez-Bermejo, and W. Ricart CD14 Monocyte Receptor, Involved in the Inflammatory Cascade, and Insulin Sensitivity J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1780 - 1784. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Jenny, R. P. Tracy, M. S. Ogg, L. A. Luong, L. H. Kuller, A. M. Arnold, A. R. Sharrett, and S. E. Humphries In the Elderly, Interleukin-6 Plasma Levels and the -174G>C Polymorphism Are Associated With the Development of Cardiovascular Disease Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 2066 - 2071. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Villuendas, J. L. San Millan, J. Sancho, and H. F. Escobar-Morreale The -597 G->A and -174 G->C Polymorphisms in the Promoter of the IL-6 Gene Are Associated with Hyperandrogenism J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1134 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Papanicolaou Interleukin-6: The Endocrine Cytokine J. Clin. Endocrinol. Metab., March 1, 2000; 85(3): 1331 - 1333. [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |