help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fernández-Real, J.-M.
Right arrow Articles by Ricart, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fernández-Real, J.-M.
Right arrow Articles by Ricart, W.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 3 1334-1339
Copyright © 2000 by The Endocrine Society


Special Articles

Interleukin-6 Gene Polymorphism and Lipid Abnormalities in Healthy Subjects

José-Manuel Fernández-Real, Montserrat Broch, Joan Vendrell Cristóbal Richart and Wifredo Ricart

Unitat de Diabetologia, Endocrinologia i Nutricio, University Hospital of Girona "Dr Josep Trueta," 17007 Girona; and Unitat d’Endocrinologia, Hospital of Tarragona "Joan XXIII," Facultat Medicina, Universitat Rovira i Virgili, 43007 Tarragona, Spain

Address correspondence and requests for reprints to: J. M. Fernandez-Real, M.D., Ph.D., Unitat de Diabetologia, Endocrinologia i Nutrició, University Hospital of Girona "Dr Josep Trueta," Carretera de França s/n, 17007 Girona, Spain. E-mail: endocrino{at}htrueta.scs.es


    Abstract
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Several lines of evidence indicate that interleukin-6 (IL-6) is involved not only in the hepatic acute phase response but also in adipose tissue metabolism, lipoprotein lipase activity, and hepatic triglyceride secretion. A polymorphism in the IL-6 gene, associated with differences in IL-6 transcription rate, has been recently described. We aimed to study whether this IL-6 gene polymorphism leads to differences in fasting and postglucose load plasma lipids in healthy subjects. Subjects with G at position -174 of the IL-6 gene were similar in age, sex, body mass index, and waist to hip ratio in comparison with carriers of the C allele. However, G carriers showed almost twice plasma triglycerides (1.5 ± 0.9 vs. 0.90 ± 0.37 mmol/L; P = 0.01), very low-density lipoprotein (VLDL)-triglycerides (0.97 ± 0.69 vs. 0.42 ± 0.2 mmol/L; P = 0.002), higher fasting (881 vs. 458 µmol/L; P = 0.01), and postglucose load free fatty acids (299 vs. 90.5 µmol/L; P = 0.03), slightly lower high-density lipoprotein-2 cholesterol (0.25 ± 0.14 vs. 0.39 ± 0.26 mmol/L; P = 0.058), and similar cholesterol and LDL-cholesterol levels than carriers of the C allele. Serum IL-6 levels correlated positively with fasting triglycerides, VLDL-triglycerides, and postload free fatty acids (r = 0.61, 0.65 and 0.60, respectively; P < 0.001) and negatively with high-density lipoprotein-cholesterol (r = -0.42, P < 0.05). A tendency toward higher serum IL-6 levels was observed among G carriers (9.9 ± 6.9 vs. 6.85 ± 1.7 pg/mL; P = 0.09). The -174G construct was recently reported to show higher expression of IL-6 in He La cells and was associated with higher plasma IL-6 levels than the -174C allele. Thus, the results of the present study suggest that subjects with the G allele, associated to higher IL-6 secretion, are prone to lipid abnormalities. Whether this polymorphism contributes to lipid alterations associated with other metabolic disorders awaits additional studies.


    Introduction
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
INTERLEUKIN (IL)-6 is a multifunctional cytokine produced by many different cell types, including immune cells, endothelial cells, fibroblasts, myocytes, and adipose tissue, mediating inflammatory as well as stress-induced responses (1, 2, 3, 4). Recent investigations have shown that locally produced cytokines possess important auto-/paracrine properties that influence diverse functions of the adipose tissue (1, 2, 3), in addition to possible effects on other tissues. In this sense, IL-6 has been hypothesized to be responsible for the lipid abnormalities occurring in subjects with the insulin-resistance syndrome (5). This hypothesis is based on the findings of increased blood concentrations of markers of the acute phase response, including C-reactive protein and cortisol in parallel with dyslipidemia (decreased plasma high-density lipoprotein (HDL) cholesterol and increased plasma triglyceride concentration) in patients with this syndrome (5).

IL-6 inhibits adipocyte lipoprotein lipase activity (6) and induces increases in hepatic triglyceride secretion (7) in rats. In man, the action of IL-6 is also associated with increased plasma free fatty acids (FFAs) (8). Given the pathophysiological role of IL-6 on lipid metabolism, it is plausible to hypothesize alterations in plasma lipid levels attributed to genetic differences in IL-6 transcription rate.

Recently, a polymorphism in the 5' flanking region of the IL-6 gene (at position -174) has been reported in which the transcriptional response to stimuli such as endotoxin and IL-1 is altered (9). Specifically, subjects with the G allele showed higher plasma IL-6 levels compared with carriers of the C allele (9).

Given the higher IL-6 levels found in patients with lipid abnormalities of the insulin-resistance syndrome and the possible role of IL-6 in FFA and triglyceride metabolism, we aimed to study the IL-6 G/C polymorphism in relation with fasting and postglucose load FFA levels and fasting plasma lipids.


    Subjects and Methods
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Study population

Subjects.Thirty-two healthy subjects (17 women) were included in this study. All subjects were of Caucasian origin. Inclusion criteria were: 1) body mass index (BMI; weight in kilograms divided by the square of height in meters) <40 kg/m2; 2) absence of any systemic disease; and 3) absence of any infections in the previous month. All subjects reported that their body weight had been stable for at least 3 months before the study, and all were normotensive (the latter data not shown). None of the subjects were taking any medication (including glucocorticoids or estrogens) or had any evidence of metabolic disease other than obesity. Liver disease and thyroid dysfunction were specifically excluded by biochemical workup. All women had regular menstrual cycles. The protocol was approved by the Hospital Ethics Committee, and informed consent was obtained from each subject.

Procedures

Anthropometric measurements included BMI and waist to hip ratio (WHR). The subjects’ waist was measured with a soft tape midway between the lowest rib and the iliac crest. The hip circumference was measured at the widest part of the gluteal region.

The FFA suppression after oral glucose was evaluated in 20 of these subjects. These subjects were required to consume a weight-maintaining diet containing at least 300 g carbohydrate per day and refrained from exertion for 3 days before the study. The subjects also abstained from caffeine and alcohol for 72 h before the test. An oral glucose tolerance test (OGTT) was performed according to recent recommendations (10). After a 12-h overnight fast, glucose was ingested in a dose of 75 g, and blood samples were collected through a venous catheter from an antecubital vein at 0, 30, 60, 90, and 120 min for measurement of serum glucose. FFAs were determined in the fasting state and 120 min after the OGTT. [smh3]Analytical methods. The serum glucose level was measured in duplicate by the glucose oxidase method, with a coefficient of variation below 2%. Serum insulin was measured using a monoclonal immunoradiometric assay (Medgenix Diagnostics, Fleunes, Belgium). Serum IL-6 was measured using a commercial immunoassay (MEDGENIX IL-6 EASIA; Biosource Technologies, Inc., Europe S.A., Zoning Industriel B-6220, Fleunes, Belgium).

FFA levels were measured enzymatically (bioMerieux, Marcy–l’Etoile, France), with oleic acid as standard. Total serum cholesterol was measured through the reaction of cholesterol esterase/cholesterol oxidase/peroxidase (11). Very low-density lipoprotein (VLDL)-cholesterol was measured after ultracentrifugation at 45,000 x g, which was performed using a ultracentrifuge Beckman Coulter, Inc. XL-70, with a rotor 50.4 Ti. HDL cholesterol was quantified after precipitation with polyethylene glycol at room temperature (12). Total serum triglycerides were measured through the reaction of glycerol-phosphate-oxidase and peroxidase (13). VLDL triglycerides were measured after ultracentrifugation at 45,000 x g. LDL-cholesterol was calculated as total cholesterol - (VLDL-cholesterol + HDL-cholesterol).

Restriction fragment length polymorphism (RFLP)-IL-6 gene analysis

DNA was extracted from cellular blood components by the salting-out method. The PCR was used to detect the IL-6 SfaNI RFLP. The SfaNI polymorphism is due to a replacement of G by C at position 174, and primers were designed to amplify the promoter region of IL-6 gene. The primers used in the PCR were: 5' TGACTTCAGCTTTACTCTTTGT 3' and 5' CTGATTGGAAACCTTATTAAG 3'. The reaction was carried out in a final volume of 50 mL containing 1.5 mmol/L of MgCl2, 0.2 mmol/L each dNTP (Boehringer Mannheim, Mannheim, Germany), 0.2 mmol/L each primer, and 2.5 U Taq polymerase (Life Technologies, Inc., Gaithersburg, MD). DNA was amplified during 35 cycles with an initial denaturation of 10 min at 94 C and a final extension of 10 min at 72 C. The cycle program consisted of a 1-min denaturation at 94 C, a 1-min, 35-sec annealing at 55 C, and a 1-min extension at 72 C. PCR products were digested with SfaNI restriction enzyme at 37 C overnight and electrophoresed on a 2% agarose gel. SfaNI RFLP was detected by ethidium bromide staining.

The identified genotypes were named according to the presence or absence of the enzyme restriction sites, so SfaNI (G/G), (G/C), and (C/C) are homozygotes for the presence of the site (140/58 bp), heterozygotes for the presence and absence of the site (198/140/58 bp), and homozygotes for the absence of the site (198 bp), respectively. The frequency of the alleles was C: 0.55, G: 0.45. The population was in Hardy-Weinberg equilibrium. X values were 1.30 and P = 0.52.

Statistical analysis.Descriptive results of continuous variables are expressed as mean ± SD. Before statistical analysis, normal distribution and homogeneity of the variances were tested. Parameters that did not fulfill these tests (HDL-2 cholesterol, triglycerides, VLDL-triglycerides, FFA) were log-transformed. We used {chi}2 test for comparisons of proportions. Comparison of variables between groups of subjects was performed using Student’s t test. Relationships between variables were also sought by stepwise multivariate linear regression analysis with forward selection. Levels of statistical significance were set at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
Anthropometric and biochemical characteristics of the subjects at the time of entry into the study are shown in Table 1Go. The subjects were divided into two groups on the basis of the IL-6 genotype. Twenty-one subjects had a G at position -174 of the IL-6 gene, 13 heterozygotes (C/G) and 8 homozygotes (G/G). Eleven subjects were homozygotes for the presence of C at this position.


View this table:
[in this window]
[in a new window]
 
Table 1. Anthropometric and biochemical variables of the study subjects

 
Subjects carrying the G allele, associated to higher plasma levels of IL-6 in a recent study (9), were similar in age, sex, BMI, and WHR in comparison with carriers of the C allele (Table 1Go). The subjects with the G allele showed significantly higher serum insulin, total and VLDL-triglycerides (Fig. 1Go), and a tendency toward lower HDL-2 cholesterol than carriers of the C allele (Table 1Go). Plasma FFA levels were higher in subjects with the G allele in whom a significant gene dosage effect was observed (Fig. 2Go). These levels remained higher after oral glucose load (Table 1Go). No significant differences were observed concerning total and LDL-cholesterol or VLDL-cholesterol.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Individual plasma fasting triglycerides and VLDL-triglycerides according to the IL-6 genotype.

 


View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. Individual fasting FFAs according to the IL-6 genotype (note the log scale).

 
A tendency toward higher serum IL-6 levels was observed among G carriers (9.9 ± 6.9 vs. 6.85 ± 1.7 pg/mL; P = 0.09). Serum IL-6 levels correlated positively with fasting triglycerides, VLDL-triglycerides (Fig. 3Go), postload FFAs (r = 0.61, 0.65 and 0.60, respectively; P < 0.001) and negatively with HDL-cholesterol (r = -0.42, P < 0.05). In a multiple linear Regression in a stepwise manner to predict serum triglyceride levels, with BMI, WHR, fasting insulin, and IL-6 levels as independent variables, only IL-6 levels (P = 0.0012) and WHR (P = 0.01) were significantly associated with serum triglycerides contributing to 50% of their variance.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 3. Linear correlation between VLDL-triglycerides and serum IL-6 levels in the study subjects.

 

    Discussion
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 
It has been previously demonstrated that cytokines have profound effects on lipid metabolism, leading to hyperlipidemia (14). Here, we describe that a polymorphism of the IL-6 gene at position -174 is associated with fasting and postload FFA levels and with fasting VLDL and total triglycerides. When comparing constructs of the 5' flanking region of IL-6 in a luciferase reporter vector transiently transfected into He La cells, the -174 G construct showed higher expression than the -174 C construct (9). This different transcription rate was supported by the in vivo observation that IL-6 levels were higher in control subjects with the G allele (9).

In our study, the subjects with the G allele showed a tendency toward higher serum IL-6 levels. In fact, the six subjects with the highest serum IL-6 levels had the G allele. Interestingly, serum IL-6 levels correlated with postload FFAs and with fasting VLDL and total triglycerides. The latter association persisted after controlling for BMI and insulin levels. It should be kept in mind, however, that the circulating cytokine molecules are seldom found in the unbound state. They are almost always bound to binding or carriers proteins, autoantibodies, and soluble receptors. The usual sandwich-format immunoassays recover free, and some predictably bound cytokine, but misses other cytokine bound by unpredictable binding entities.

Higher IL-6 levels have been described in association with raised plasma triglyceride concentration in epidemiological studies in men with different cardiovascular risk factors (15) and with relatively high plasma triglycerides and low HDL-cholesterol in healthy centenarians (16). Together with our findings, it seems that those individuals with a genetic predisposition to higher IL-6 secretion (i.e. those with the G allele) are prone to develop higher total and VLDL-triglycerides, higher plasma FFA, and lower HDL2-cholesterol than subjects carriers of the C allele. In fact, the latter subjects displayed a tightly regulated plasma triglyceride and FFA concentration, as shown in Figs. 1Go and 2Go. In recent studies, it has been shown that IL-6 induces physiological changes reminiscent of the catabolic state, which include increased resting energy expenditure and increases in plasma FFA. Specifically, infusions of recombinant human IL-6 in humans induced a 60% increase in plasma FFA concentration and a 105% increase in FFA rate of appearance in plasma (8). These effects in humans might be due to the IL-6' effects on adipocyte lipoprotein lipase activity (6) or hepatic triglyceride secretion (7) as observed in rats.

Cytokines operate both as a cascade and as a network and can regulate the production of other cytokines and cytokine receptors. In this sense, perhaps the increased production of IL-6 is merely reflecting the actions of other cytokines more closely involved in lipid abnormalities, such as tumor necrosis factor-{alpha} (TNF-{alpha}). Administration of TNF-{alpha} to humans increases serum triglyceride levels by stimulating hepatic triglyceride synthesis and secretion (17). In a recent study, plasma TNF-{alpha} concentration positively correlated with VLDL triglycerides and negatively with HDL cholesterol in postinfarction patients (18). We have recently described a significant correlation between plasma levels of the soluble fraction of TNF-{alpha} and total triglycerides and HDL2 cholesterol (19). However, in contrast to what occurs with IL-6, genetic polymorphisms of TNF-{alpha} do not contribute to significant differences in plasma lipid concentration (20).

In addition to lipid abnormalities, IL-6 contributes to atherogenesis in several other ways, such as by inducing adhesion molecules and increasing endothelial permeability. Higher circulating levels of IL-6 and C-reactive protein have been recently associated with mortality in healthy older persons (21). It cannot be excluded that hypertriglyceridemia and low HDL-cholesterol constitute confounding factors of this association (15, 16).

One limitation of this study is the small number of subjects. The size of the study has led possibly to potential type II errors (for example, HDL cholesterol would be significantly decreased if more subjects were studied). However, our subjects have been studied not only in fasting conditions, but also dynamically, after an oral glucose load, showing the blunted suppression of FFA. All the different measurements (fasting triglycerides, VLDL-triglycerides, basal and postload FFA) concur with the hypothesis that those individuals with the "higher cytokine responder genotype" display more probably lipid abnormalities.

In summary, a polymorphism of the IL-6 gene determines differences in plasma total and VLDL-triglycerides and in fasting and postglucose load FFA levels. In evolutionary terms, these findings are in agreement with the hypothesis that genetical predisposition to inflammation could be beneficial in the response to starvation and injury for our ancestors, providing substrates for brain metabolism, but this advantage is lost with westernization (22).

Received September 13, 1999.

Revised December 11, 1999.

Accepted January 10, 2000.


    References
 Top
 Abstract
 Introduction
 Subjects and Methods
 Results
 Discussion
 References
 

  1. Orban Z, Remaley A, Sampson M, Trajanoski Z, Chrousos GP. 1999 The differential effect of food intake and ß-adrenergic stimulation on adipose-derived hormones and cytokines in man. J Clin Endocrinol Metab. 84:2126–2133.[Abstract/Free Full Text]
  2. Fried SK, Bunkin DA, Greenberg AS. 1998 Omental and subcutaneous adipose tissues of obese subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab. 83:847–850.[Abstract/Free Full Text]
  3. Mohamed-Ali V, Goodrick S, Rawesh A, et al. 1997 Subcutaneous adipose tissue releases interleukin-6, but not tumor necrosis factor-{alpha}, in vivo. J Clin Endocrinol Metab. 82:4196–4200.[Abstract/Free Full Text]
  4. Papanicolau DA, Wilder RL, Manolagas SC, Chrousos GP. 1998 The pathophysiologic roles of interleukin-6 in human disease. Ann Intern Med. 128:127–137.[Abstract/Free Full Text]
  5. Pickup JC, Mattock MB, Chusney GD, Burt D. 1997 NIDDM as a disease of the innate immune system: association of acute-phase reactants and interleukin-6 with metabolic syndrome X. Diabetologia. 40:1286–1292.[CrossRef][Medline]
  6. Greenberg AS, Nordan RP, McIntosh J, Calvo JC, Scow RO, Jablons D. 1992 Interleukin-6 reduces lipoprotein lipase activity in adipose tissue of mice in vivo and in 3T3–L1 adipocytes: a possible role for interleukin-6 in cancer cachexia. Cancer Res. 52:4113–4116.[Abstract/Free Full Text]
  7. Nonogaki K, Fuller GM, Fuentes NL, Moser AH, Staprans I, Grunfeld C. 1995 Interleukin-6 stimulates hepatic triglyceride secretion in rats. Endocrinology. 136:2143–2149.[Abstract]
  8. Stouthard JM, Romijn JA, Van der Poll T, et al. 1995 Endocrinologic and metabolic effects of interleukin-6 in humans. Am J Physiol. 268:E813–E819.
  9. Fishman D, Faulds G, Jeffery R, et al. 1998 The effect of novel polymorphisms in the interleukin 6 (IL-6) gene on IL-6 transcription and plasma IL-6 levels, and an association with systemic-onset juvenile chronic arthritis. J Clin Invest. 102:1369–1376.[Medline]
  10. The Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. 1997 Report of The Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 20:1183–1197.[Medline]
  11. Siedel J, Hagele EO, Ziegenhorn J, Wahlefeld AW. 1983 Reagent for the enzymatic determination of serum total cholesterol with improved lipolytic efficiency. Clin Chem. 29:1075–1080.[Abstract/Free Full Text]
  12. Kostner GM, Molinari E, Pichler P. 1985 Evaluation of a new HDL2/HDL3 quantitation method based on precipitation with polyethylene glycol. Clin Chim Acta. 148:139–147.[CrossRef][Medline]
  13. Wahlefeld AW. 1974 Lipoproteins. In: Bergmeyer HU, ed. Methoden der enzymatischen analyse, 3rd ed., vol II. Weinheim: Verlag Chemie; 187–188.
  14. Grunfeld C, Feingold KR. 1992 Role of cytokines in inducing hyperlipidemia. Diabetes. 41(Suppl 2):97–101.
  15. Mendall MA, Patel P, Asante M, et al. 1997 Relation of serum cytokine concentration to cardiovascular risk factors and coronary artery disease. Heart. 78:273–277.[Abstract/Free Full Text]
  16. Baggio G, Donazzan S, Monti D, et al. 1998 Lipoprotein(a) and lipoprotein profile in healthy centenarians: a reappraisal of vascular risk factors. FASEB J. 12:433–437.[Abstract/Free Full Text]
  17. Stames Jr HH, Warren RS, Jeevsnadern M, et al. 1988 Tumor necrosis factor and the acute metabolic response to injury in man. J Clin Invest. 82:1321–1325.
  18. Jovinge S, Hamsten A, Tornvall P, et al. 1998 Evidence for a role of tumor necrosis factor {alpha} in disturbances of triglyceride and glucose metabolism predisposing to coronary heart disease. Metabolism. 47:113–118.[CrossRef][Medline]
  19. Fernández-Real JM, Gutierrez C, Ricart W, Castiñeira MJ, Vendrell J, Ricart W. 1999 Plasma levels of the soluble fraction of tumor necrosis factor receptors 1 and 2 are independent determinants of plasma cholesterol and LDL-cholesterol concentrations in healthy subjects. Atherosclerosis. 146:321–327.[CrossRef][Medline]
  20. Fernández-Real JM, Gutiérrez C, Ricart W, et al. 1997 The TNF-{alpha} gene Ncol polymorphism influences the relationship among insulin resistance, Percent body fat and increased serum leptin levels. Diabetes. 46:1468–1472.[Abstract]
  21. Harris TB, Ferrucci L, Tracy RP, et al. 1999 Associations of elevated interleukin-6 and C-reactive protein levels with mortality in the elderly. Am J Med. 106:506–512.[CrossRef][Medline]
  22. Fernández-Real JM, Ricart W. 1999 Insulin resistance and inflammation in an evolutionary perspective: the contribution of cytokine genotype/phenotype to thriftiness. Diabetologia. 42:1367–1374.[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Prevention ResearchHome page
Y. S. Kim, M. R. Young, G. Bobe, N. H. Colburn, and J. A. Milner
Bioactive Food Components, Inflammatory Targets, and Cancer Prevention
Cancer Prevention Research, March 1, 2009; 2(3): 200 - 208.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. Shen, D. K. Arnett, P. Perez-Martinez, L. D. Parnell, C.-Q. Lai, J. M. Peacock, J. E. Hixson, M. Y. Tsai, R. J. Straka, P. N. Hopkins, et al.
The effect of IL6-174C/G polymorphism on postprandial triglyceride metabolism in the GOLDN study,boxs
J. Lipid Res., August 1, 2008; 49(8): 1839 - 1845.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
S. T. Turner, S. L.R. Kardia, T. H. Mosley, A. D. Rule, E. Boerwinkle, and M. de Andrade
Influence of Genomic Loci on Measures of Chronic Kidney Disease in Hypertensive Sibships
J. Am. Soc. Nephrol., July 1, 2006; 17(7): 2048 - 2055.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
Y. Liu, Y. Berthier-Schaad, M. D. Fallin, N. E. Fink, R. P. Tracy, M. J. Klag, M. W. Smith, and J. Coresh
IL-6 Haplotypes, Inflammation, and Risk for Cardiovascular Disease in a Multiethnic Dialysis Cohort
J. Am. Soc. Nephrol., March 1, 2006; 17(3): 863 - 870.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
H. F. Escobar-Morreale, M. Luque-Ramirez, and J. L. San Millan
The Molecular-Genetic Basis of Functional Hyperandrogenism and the Polycystic Ovary Syndrome
Endocr. Rev., April 1, 2005; 26(2): 251 - 282.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
H. Staiger, K. Staiger, N. Stefan, H. G. Wahl, F. Machicao, M. Kellerer, and H.-U. Haring
Palmitate-Induced Interleukin-6 Expression in Human Coronary Artery Endothelial Cells
Diabetes, December 1, 2004; 53(12): 3209 - 3216.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. A. McKenzie, E. P. Weiss, I. A. Ghiu, O. Kulaputana, D. A. Phares, R. E. Ferrell, and J. M. Hagberg
Influence of the interleukin-6 -174 G/C gene polymorphism on exercise training-induced changes in glucose tolerance indexes
J Appl Physiol, October 1, 2004; 97(4): 1338 - 1342.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
L. Ibanez, C. Valls, S. Cabre, and F. de Zegher
Flutamide-Metformin Plus Ethinylestradiol-Drospirenone for Lipolysis and Antiatherogenesis in Young Women with Ovarian Hyperandrogenism: The Key Role of Early, Low-Dose Flutamide
J. Clin. Endocrinol. Metab., September 1, 2004; 89(9): 4716 - 4720.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
D. Mozaffarian, T. Pischon, S. E Hankinson, N. Rifai, K. Joshipura, W. C Willett, and E. B Rimm
Dietary intake of trans fatty acids and systemic inflammation in women
Am. J. Clinical Nutrition, April 1, 2004; 79(4): 606 - 612.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
J. S. Pankow, B. B. Duncan, M. I. Schmidt, C. M. Ballantyne, D. J. Couper, R. C. Hoogeveen, and S. H. Golden
Fasting Plasma Free Fatty Acids and Risk of Type 2 Diabetes: The Atherosclerosis Risk in Communities study
Diabetes Care, January 1, 2004; 27(1): 77 - 82.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
G. Endler, C. Marsik, C. Joukhadar, R. Marculescu, F. Mayr, C. Mannhalter, O. F. Wagner, and B. Jilma
The Interleukin-6 G(-174)C Promoter Polymorphism Does Not Determine Plasma Interleukin-6 Concentrations in Experimental Endotoxemia in Humans
Clin. Chem., January 1, 2004; 50(1): 195 - 200.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
S. M. Roth, M. A. Schrager, M. R. Lee, E. J. Metter, B. F. Hurley, and R. E. Ferrell
Interleukin-6 (IL6) Genotype Is Associated With Fat-Free Mass in Men But Not Women
J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2003; 58(12): B1085 - 1088.
[Abstract] [Full Text] [PDF]


Home page
PediatricsHome page
D. Harding, S. Dhamrait, A. Millar, S. Humphries, N. Marlow, A. Whitelaw, and H. Montgomery
Is Interleukin-6 -174 Genotype Associated With the Development of Septicemia in Preterm Infants?
Pediatrics, October 1, 2003; 112(4): 800 - 803.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. M. Fernandez-Real and W. Ricart
Insulin Resistance and Chronic Cardiovascular Inflammatory Syndrome
Endocr. Rev., June 1, 2003; 24(3): 278 - 301.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
J.-M. Fernandez-Real, M. Broch, J. Vendrell, and W. Ricart
Insulin Resistance, Inflammation, and Serum Fatty Acid Composition
Diabetes Care, May 1, 2003; 26(5): 1362 - 1368.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. M. Fernandez-Real, M. Broch, C. Richart, J. Vendrell, A. Lopez-Bermejo, and W. Ricart
CD14 Monocyte Receptor, Involved in the Inflammatory Cascade, and Insulin Sensitivity
J. Clin. Endocrinol. Metab., April 1, 2003; 88(4): 1780 - 1784.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. S. Jenny, R. P. Tracy, M. S. Ogg, L. A. Luong, L. H. Kuller, A. M. Arnold, A. R. Sharrett, and S. E. Humphries
In the Elderly, Interleukin-6 Plasma Levels and the -174G>C Polymorphism Are Associated With the Development of Cardiovascular Disease
Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 2066 - 2071.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
G. Villuendas, J. L. San Millan, J. Sancho, and H. F. Escobar-Morreale
The -597 G->A and -174 G->C Polymorphisms in the Promoter of the IL-6 Gene Are Associated with Hyperandrogenism
J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1134 - 1141.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
D. A. Papanicolaou
Interleukin-6: The Endocrine Cytokine
J. Clin. Endocrinol. Metab., March 1, 2000; 85(3): 1331 - 1333.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fernández-Real, J.-M.
Right arrow Articles by Ricart, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fernández-Real, J.-M.
Right arrow Articles by Ricart, W.
Right arrowPubmed/NCBI databases
*OMIM
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals