The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 3 1180-1187
Copyright © 2000 by The Endocrine Society
A Human Pituitary Tumor-Derived Folliculostellate Cell Line1
Daniel C. Danila,
Xun Zhang,
Yunli Zhou,
G. Richard Dickersin,
Jonathan A. Fletcher,
E. Tessa Hedley-Whyte,
Martin K. Selig,
Stacey R. Johnson and
Anne Klibanski
Neuroendocrine Unit (D.C.D., X.Z., Y.Z., S.R.J., A.K.) and the
Department of Pathology (G.R.D., M.K.S., E.T.H.-W.), Massachusetts
General Hospital, and the Department of Pathology, Brigham and Womens
Hospital and Harvard Medical School (J.A.F.), Boston, Massachusetts
02115.
Address all correspondence and requests for reprints to: Anne Klibanski, M.D., Neuroendocrine Unit, Bulfinch 457, Massachusetts General Hospital, Boston, Massachusetts 02114. E-mail:
aklibanski{at}partners.org
 |
Abstract
|
|---|
Pituitary cells have been used for the study of hormone synthesis,
secretion, and regulation. However, the lack of human cell lines of
pituitary origin has made such studies in humans very difficult.
Activin, a member of the transforming growth factor-ß cytokine
family, is secreted by the pituitary and serves, in addition to
regulating hormone biosynthesis, as a regulator of cell growth and
differentiation. In the human pituitary, folliculo-stellate cells
secrete an activin-binding and -neutralizing protein, follistatin.
However, the role of these cells in the autocrine/paracrine regulatory
mechanisms of activin is poorly understood. We describe a human
pituitary-derived folliculostellate cell line, designated PDFS, that
was developed spontaneously from a clinically nonfunctioning pituitary
macroadenoma. PDFS cells showed an epithelial-like morphology with long
cytoplasmic processes. Electron microscopy revealed frequent
intercellular junctions, including desmosomes, and cytogenetic analysis
showed clonal characteristics with chromosomal abnormalities. These
cells express vimentin and the nervous tissue-specific S-100 protein,
specific markers of folliculostellate cells in the anterior pituitary,
but no secretory pituitary cell markers. PDFS cells formed large
colonies in an anchorage-independent transformation assay. They express
follistatin and activin A and have an intact activin intracellular
signaling pathway as determined by reporter assays. Therefore, this
human cell line provides a useful model for studying the regulation of
cell growth and cytokine production by factors endogenously produced in
pituitary folliculostellate cells.
 |
Introduction
|
|---|
IN VITRO STUDIES of human
pituitary tumors using short term primary cell culture have contributed
significantly to our understanding of pituitary hormone regulation and
pathogenesis. However, because primary cultures represent a
heterogeneous population of cells (1, 2) with limited viability and
progressive loss of differentiated functions (3, 4, 5), the lack of human
cell lines of pituitary lineage has made such studies problematic.
There have been numerous attempts to develop human pituitary cell lines
of homogeneous, well characterized cell populations. Recently, human
lines originating from anterior pituitary secretory cells that
apparently developed spontaneously (6) or that were immortalized using
a temperature-sensitive mutant of simian virus 40 large T antigen (7)
have been described. These human epithelial-like endocrine tumor cells
could provide models for the studies of cell proliferation and
regulation of hormonal secretion.
The anterior pituitary is composed of two different cell types,
secretory cells and folliculostellate cells. It has been suggested that
the folliculostellate cells, derived from neuroectoderm, modulate
secretory cell functions by intercellular communication in a paracrine
manner (8, 9). In the normal pituitary, folliculostellate cells express
and secrete follistatin, which can bind and neutralize activin and,
therefore, regulate FSH biosynthesis and secretion indirectly (10, 11).
Recent data suggest that most circulating follistatin is bound to
activin, and only the locally produced follistatin has functional
significance in the regulation of activin-induced hormone secretion and
proliferative responses (12). It has been demonstrated that
folliculostellate cells also produce lipocortin-1 (13), a key
inhibitory mediator of glucocorticoids on corticotropin secretion, at
both the hypothalamic and pituitary levels (14, 15). The regulatory
interactions between folliculostellate and lactotroph cells (16, 17, 18, 19)
and the role of folliculostellate cells in immune system modulation
(20, 21, 22, 23, 24) have also been reported. In the pituitary, it has been shown
that a subset of pituitary adenomas has significant numbers of
folliculostellate cells (25, 26, 27, 28, 29, 30), and furthermore, pituitary tumors
consisting only of folliculostellate cells have been described
(29).
We describe here a spontaneously transformed human cell line, PDFS, of
folliculostellate origin, derived from a pituitary gonadotroph adenoma.
The transformation and immortalization of this cell line are possibly
due to the mutation of p53. It expresses follistatin and activin A,
important peptides in the autocrine/paracrine regulatory mechanisms of
normal and neoplastic pituitary, and retains an intact activin-mediated
signal transduction pathway, as determined by reporter assays.
Therefore, this cell line may provide a useful model for the study of
regulation of cell growth and hormone production by factors
endogenously expressed in the normal and neoplastic human pituitary as
well as human neoplastic cell transformation.
 |
Materials and Methods
|
|---|
Establishment of primary pituitary tumor culture
Tumor fragments from a 71-yr-old man with a clinically
nonfunctioning pituitary macroadenoma were obtained in saline solution
after transsphenoidal surgery. A portion of the resected tumor was
embedded in paraffin for histological examination, which showed cells
immunoreactive for
- and ß-subunits of LH and FSH, consistent with
a pituitary adenoma of gonadotroph origin. Another fragment was
enzymatically dispersed as previously described (31) and cells were
maintained in DMEM supplemented with 10% FCS, 0.1%
insulin/transferrin/selenium, 1% nonessential amino acids, and
antibiotics. After several days, a distinct focus of nonfibroblastic
cells had formed in one of the culture dishes. This cell clone was
isolated using a cloning ring, trypsinized, and replated in medium as
described above. The cells have been maintained in culture for over 1
yr and in excess of 70 passages.
Chromosomal analysis
Metaphase cells were obtained by exposing cultured cells to
Colcemid (Life Technologies, Inc., Gaithersburg, MD) for
1 h. Metaphase harvesting conditions, slide making, and
trypsin-Giemsa chromosome banding were previously described (32).
Twenty metaphase cells were analyzed, and clonal aberrations were
specified according to the 1995 International System for Human
Cytogenetic Nomenclature (33).
Electron microscopy
Cultured cells were fixed with Karnovsky II fixative (2.5%
glutaraldehyde, 2% paraformaldehyde, and 0.025% calcium chloride in
0.1 mol/L sodium cacodylate buffer, pH 7.4), postfixed with osmium
tetroxide, en bloc stained with uranyl acetate, dehydrated
through a graded ethanol series, infiltrated with 100% ethanol and
epoxy resin mixture, and embedded in pure epoxy. After polymerization,
the cell layer was removed from the petri dish and reembedded, so that
1-µm thick cross sections of the cells could be cut and stained with
toluidine blue. Representative areas were chosen for thin sectioning by
light microscopy. Thin sections were cut, stained with lead citrate,
and examined with a Philips 301A electron microscope (Philips
Electronic Instruments, Rahway, NJ).
Cell growth and transformation assay
PDFS cells were plated into 6-well plates at a density of 5000
cells/well in medium containing 0.2%, 5%, and 10% FCS. Cells in
triplicate wells were harvested every day, and counted in a Coulter
counter (Coulter Electronics, Hialeah, FL), and cell doubling time was
calculated as previously described (34).
The transforming ability of PDFS cells was tested in an
anchorage-independent growth assay on soft agar as previously described
(35, 36). Two milliliters of 0.5% soft agar were added to 6-well
plates. Ten thousand cells were mixed with 1 mL 0.3% soft agar and
added to each well. Cells were incubated for 2 weeks before colonies of
60 or more cells were counted and photographed. Human osteosarcoma U2OS
and fibroblast HS27 cells were used as positive and negative controls,
respectively.
RT-PCR
Total ribonucleic acid (RNA) was extracted from 5 x
105 cultured PDFS cells or 100 mg normal
pituitary tissue with Trizol reagent (Life Technologies, Inc.), and RT-PCR was performed as previously described (37). We
used the following sets of primers, described in 5'-3' sequence and
with the expected product size in parentheses: vimentin,
gcaggactcggtggacttctc and ggcagccacactttcatattg (603 bp); and activin
A, ctgaacgcgatcagaaagctt and tcctccacgatcatgttctg (1015 bp). All other
primers were described previously (2, 38). Reactions were preformed in
the presence of [
-32P]deoxy-CTP (100
nCi/reaction), and products were resolved by electrophoresis on 6%
nondenaturing TBE/polyacrylamide gel (Protogel, National
Diagnostics, Atlanta, GA) and visualized by autoradiography on
Kodak X-Omat film (Eastman Kodak Co.,
Rochester, NY) for 4 h. The PCR products were sequenced to confirm
identities.
Western blotting
Immunoblotting for p16ink4a, p53, and Rb
protein expression in PDFS cells was performed as previously described
(39). The cellular proteins were extracted in RIPA buffer [150 mmol/L
NaCl, 50 mmol/L Tris (pH 7.4), 1 mmol/L ethylenediamine tetraacetate,
1% Nonidet P-40, and 0.25% sodium deoxycholate] containing 1 mmol/L
phenylmethylsulfonylfluoride, and 1 µg/ml aprotinin and leupeptin.
The homogenates were centrifuged, and the protein concentration in each
sample was determined by Bradford assay (Sigma, St. Louis,
MO). Twenty micrograms of total cellular proteins were resolved by 10%
SDS-PAGE, and then electroblotted onto polyvinylidene difluoride
filters (Millipore Corp., Bedford, MA). Filters were
probed with specific primary antibodies, anti-Rb (G3245,
PharMingen, San Diego, CA), anti-p53 (FL-393, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and
anti-p16ink4a (DCS-50.1, NeoMarker, Fremont, CA).
The blots were processed by a chemiluminescence-based enhanced
chemiluminescence Western blotting detection system (Amersham Pharmacia Biotech, Piscataway, NJ) according to the
manufacturers instruction.
Immunocytochemistry
Immunostaining of tumor and cultured cells was carried out as
previously described (40). Antibodies against the anterior pituitary
hormones, vimentin (Santa Cruz Biotechnology, Inc.), the
folliculostellate specific marker S-100 (DAKO Corp., High
Wycombe, UK), and follistatin (National Hormone and Pituitary Program,
Torrance, CA) were used as primary antibodies. All antisera were used
at the manufacturers suggested concentrations and were visualized
using an indirect immunoperoxidase procedure with Vectastatin Elite ABC
kit (Vector Laboratories, Inc., Burlingame, CA). Controls
included substitution of nonimmune serum for primary antibody,
elimination of secondary antibody, or streptavidin-biotin-peroxidase
complexes. Immunostaining for p53 wild-type (wt) and mutant proteins
was preformed as described above, except that cells were fixed in
acetone-methanol (1:1 ratio), and incubated with 0.03%
H2O2 in methanol. The
primary anti-p53 antibodies used were PAb1801 (which recognizes both wt
and mutated p53) (41) and PAb240 (specific for the mutated p53;
NeoMarker) (42).
Enzyme-linked immunosorbent assay of activin A in conditioned
medium
Cells (106) were plated in 100-mm cell
culture dishes with 10 mL culture medium. After 48 h, the culture
medium was collected as conditioned medium, and the activin A
concentration was measured using an activin A assay kit
(Serotec, Oxford, UK), according to the manufacturers
protocol.
Cell transfection and luciferase assay
Mink lung L17 cells were transiently transfected using
Lipofectamine (Life Technologies, Inc.) as previously
described (39). Cells were plated in six-well plates at a density of
2 x 105 cells/well and transfected in
triplicate with 1 µg/well wt activin receptor IB (Act-RIB) inserted
under the control of the cytomegalovirus promoter in the pCI/Neo
expression vector (Promega Corp., Madison, WI),
pCI-Act-RIB (wt), and 1 µg/well p3TPlux reporter, in which a
luciferase gene is under the control of an activin-responsive
element-containing promoter (provided by Dr. Joan Massagué) (43).
As an internal control, 0.2 µg/well pRSV-lacZ was included
in each experiment. After 4-h incubation at 37 C, the culture medium
was replaced with fresh medium, and 500 µL PDFS-conditioned medium or
50 ng human recombinant activin A (National Hormone and Pituitary
Program) were added to each well. After an additional 24-h incubation,
cells were harvested, the luciferase activity was measured, and results
were normalized to ß-galactosidase activity. PDFS cells were
similarly transiently transfected with pCI-Act-RIB (wt) or pCI-Act-RIB
(
c), which expresses a truncated form of Act-RIB lacking the
intracellular domain (provided by Dr. Wylie Vale) (44), and p3TPlux. To
quantitate the luciferase activity in this model, we transfected in
parallel L17 cells with pCI-Act-RIB (wt) and p3TPlux, and then treated
them with 10 ng/mL activin A. Cells were harvested after 24-h
incubation in fresh medium, and the activities of luciferase and
ß-galactosidase were measured. Each experiment was repeated twice,
and statistical significance was tested by Students t test
using SigmaPlot.
 |
Results
|
|---|
Characterization of PDFS cells
The PDFS cell line was spontaneously transformed from the primary
culture of a clinically nonfunctioning pituitary macroadenoma. It
showed an epithelial-like morphology with large nuclei and abundant
cytoplasm, with long cytoplasmic processes (Fig. 1A
). Hematoxylin/eosin staining shows
that PDFS cells have notable pleomorphism, with multiple nucleoli and
numerous mitotic figures (Fig. 1B
). Electron microscopy of the cultured
cells revealed them to be tightly opposed in clusters and to have
frequent intercellular junctions, including desmosomes (Fig. 1C
). Free
cell surfaces were raised into multiple filopodia. Nuclei were
euchromatic and contained prominent and multiple nucleoli. The
cytoplasm contained innumerable free ribosomes, many mitochondria, and
a few cisternae of rough endoplasmic reticulum. Some cells contained
many primary and secondary lysosomes. There was no evidence of
secretory granules, including dense core type, suggesting that it did
not originate from hormone-secreting cells. Filaments were sparse and
present in only a few cells.

View larger version (139K):
[in this window]
[in a new window]
|
Figure 1. The morphology of PDFS cells. A, Phase
contrast micrograph of PDFS cells in monolayer culture. Note the long
cytoplasmic processes formed by cells in monolayer (magnification,
x100). B, Hematoxylin- and eosin-stained PDFS cells showing
pleomorphism, coarse chromatin, multiple nucleoli, and numerous mitotic
figures (magnification, x400). C, Electron micrograph of a group of
PDFS cells showing many primary and secondary lysosomes
(arrows), intercellular junctions
(arrowheads), and filopodia along the cells free
surfaces projecting into the open space (OS; original magnification,
x6600). Inset, A desmosome at high magnification
(x62,000). D, Immunohistochemistry staining for vimentin of PDFS cells
showing that the individual cells express vimentin in their cytoplasm
(counterstained with hematoxylin; magnification, x400).
|
|
Cytogenetic analysis revealed that all cells were hyperdiploid as a
result of multiple clonal trisomies and tetrasomies. Structural clonal
aberrations were present, including rearrangements of a chromosome X
short arm, chromosome 1 long arm, and chromosome 7 short arm. The
karyotype was 60, add(X)(p22), -Y, +1, add(1)(q32)x2, +2, +2, +5, +6,
+7, add(7)(p22)x2, +10, +10, +12, +16, +17, +17, +18, +19, +22.
PDFS cells showed no expression of messenger RNA (mRNA) encoding Pit-1
or any of the anterior pituitary hormones (data not shown), as
determined by RT-PCR. We therefore investigated whether the PDFS cell
line was of folliculostellate origin using specific folliculostellate
markers. Immunocytochemistry showed that the PDFS cells express
vimentin, a component of the intermediary filaments, in the cytoplasm
(Fig. 1D
). The S-100 protein, a folliculo- stellate-specific marker
in the context of pituitary, is expressed in PDFS cells, as shown by
immunocytochemistry in Fig. 2
. The PDFS
cells specifically stained positively for S-100 (Fig. 2A
), as confirmed
by substitution of the primary antibody against S-100 with nonimmune
serum (Fig. 2B
). In Fig. 2
, C and D, respectively, the S-100-positive
breast cancer cell line MDA-MB 231 (45) and the S-100-negative
pituitary secretory-cell derived line CHP2 (7) were used as
controls.

View larger version (100K):
[in this window]
[in a new window]
|
Figure 2. Immunocytochemistry for S-100 protein. A,
PDFS cells; B, PDFS cells, primary antibody against S-100 was replaced
with nonimmune serum; C, S-100-positive breast cancer cell line MDA-MB;
D, S-100-negative human anterior pituitary secretory cell-derived line
CHP2.
|
|
Growth characteristics and transforming ability
The growth of PDFS cells was serum dependent. Decreasing
concentrations of FCS in the medium to 0.2% resulted in cell death.
There were no significant differences in cellular proliferation between
concentrations of 5% and 10% serum. The doubling time of the cells
was 23.8 h.
The transforming ability of these cells was tested in an
anchorage-independent growth assay. We found that PDFS cells formed
colonies in soft agar (Fig. 3A
), similar
to the human carcinoma cell line U2OS (Fig. 3B
), whereas the human
fibroblast cells, used as a negative control, failed to form colonies
(Fig. 3C
). From 104 PDFS cells, 942 ± 177
colonies were formed in 2 weeks (mean ± SEM).

View larger version (70K):
[in this window]
[in a new window]
|
Figure 3. Transformation assay. After 2 weeks, PDFS
cells formed colonies on soft agar (A; original magnification, x40;
inset, a single PDFS colony at magnification of x100).
In the same experiment, human osteosarcoma U2OS cells formed numerous
colonies (B; magnification, x40), whereas human fibroblast HS27 cells
failed to form colonies (C; magnification, x40).
|
|
Tumor suppressor genes in PDFS cells
To understand the potential mechanism underlying immortalization
of this cell line, we investigated the tumor suppressor genes
p16ink4a, Rb, and p53 status in PDFS cells. The
PDFS cells express p16ink4a protein (Fig. 4A
, lane 1), as determined by Western
blotting. Rb protein was detected in PDFS cells and displayed the
correct size and a normal phosphorylation pattern compared to that in
control cells (Fig. 4B
).

View larger version (65K):
[in this window]
[in a new window]
|
Figure 4. Western blots of tumor suppressor protein
p16ink4a, Rb, and p53 in PDFS cells. A,
p16ink4a: lane 1, PDFS cells; lane 2, human breast
carcinoma MCF 7 cells (p16 null); lane 3, human osteosarcoma Saos2
cells (wt p16). B, Rb: lane 1, PDFS cells; lane 2, human osteosarcoma
Saos2 cells (Rb null); lane 3, human fibroblast HS27 cells (wt Rb). C,
p53: lane 1, PDFS cells; lane 2, human breast carcinoma T47D cells
(mutant p53); lane 3, human osteosarcoma Saos2 cells (p53 null); lane
4, human fibroblast HS27 cells (wt p53).
|
|
Western blotting with anti-p53 antibody showed very strong expression
in PDFS cells (Fig. 4C
, lane 1), similar to that in T47D cells, a human
breast carcinoma cell line known to express mutant p53 (lane 2) (46).
The expression of p53 in PDFS cells was stronger than the expression
detected in normal human fibroblast HS 27 cells (lane 4). We further
studied p53 expression in PDFS cells by immunostaining with PAb 240
antibody, which specifically recognizes mutated p53 (Fig. 5
, right panels), and
comparing it with PAb1801 antibody, which recognize both wt and mutant
p53 (Fig. 5
, left panels). The PDFS cells stained positively
with both PAb1801 and PAb 240 antibodies (Fig. 5A
), whereas the wt
control MCF-7 cells (47) stained positively only with PAb1801 (Fig. 5C
). The T47D cells also stained positively with both anti-p53
antibodies (Fig. 5B
), whereas the osteosarcoma Saos2 cells, p53 null
(48), did not stain with any antibody (Fig. 5D
).

View larger version (102K):
[in this window]
[in a new window]
|
Figure 5. Immunocytochemistry for mutant p53 protein
in PDFS cells. Left panel, Immunostaining with control
antibody PAb1801, which recognizes both wt and mutant p53. Right
panels, Immunostaining with PAb240 antibody, which recognizes
mutant p53. A, PDFS cells; B, human breast carcinoma T47D cells (mutant
p53); C, human breast carcinomas MCF-7 cells (wt p53); D, human
osteosarcoma Saos2 cells (p53 null).
|
|
Follistatin, activin A, and activin receptor mRNA expression by
PDFS cells
We studied the expression of follistatin, activin, and its
receptor in PDFS cells. Using RT-PCR, we found that PDFS cells express
follistatin mRNA (Fig. 6A
). The cells
also express mRNA for ßA-subunit of activin/inhibin (Fig. 6B
),
suggesting that these cells may produce the ßA-homodimeric activin A.
This result was further confirmed by enzyme-linked immunosorbent assay,
which measured 50 ng/mL activin A protein secreted over 48 h by
106 PDFS cells in 10 mL culture medium. RT-PCR
also detected mRNA for Act-RIB (Fig. 6C
), and Act-RIIB (Fig. 6D
) in
PDFS cells.

View larger version (67K):
[in this window]
[in a new window]
|
Figure 6. Follistatin, activin A, and activin receptor
mRNA expression in PDFS cells and three normal pituitary specimens by
RT-PCR. A, Follistatin; B, ßA-subunit of activin; C,
Act-RIB; D, Act-RIIB.
|
|
To evaluate the bioactivity of secreted activin A, PDFS-conditioned
medium was added to L17 cells to test the induction of
activin-responsive luciferase reporter activity in transient
transfection experiments with cotransfection of an Act-RIB expression
vector. As shown in Fig. 7A
, PDFS-conditioned medium caused a 3-fold increase in luciferase activity
from p3TPlux reporter compared to regular medium, an effect comparable
to that of 50 ng/mL recombinant activin. The increase in reporter
activity was activin signaling pathway specific, as the conditioned
medium did not stimulate the reporter in the absence of Act-RIB.

View larger version (22K):
[in this window]
[in a new window]
|
Figure 7. A, Effects of PDFS-conditioned medium (CM)
on 3TPLux reporter activity in L17 cells. Cells (2 x
105) were transfected with 3TPLux in the presence
(filled bars) or absence (open bars) of
Act-RIB, then cells were incubated in presence of 0.5 mL PDFS CM or 50
ng human recombinant activin A. Significant induction of luciferase
activity was observed only in the presence of Act-RIB (*,
P < 0.001). B, p3TPLux reporter activity in PDFS
cells (filled bars). Cotransfection with wt Act-RIB
further enhances the reporter activity, whereas cotransfection of
truncated Act-RIB ( c) decreases reporter activity [*,
P = 0.0001; **, P = 0.0003
(compared to p3TPLux transfection alone)]. In parallel, L17 cells
(open bars) were transfected with p3TPLux and
pCI-Act-RIB wt, and treated with 10 ng/mL activin A (***,
P = 0.001, compared to L17 cells that were not
treated with activin A). Results are presented as relative light units
of luciferase activity.
|
|
To test whether the activin signaling pathway is functional in PDFS
cells, p3TPlux alone was transfected into PDFS cells. Luciferase
expression was higher than that observed in L17 cells expressing
Act-RIB receptor and treated with 10 ng/mL activin A in parallel
experiments (Fig. 7B
). This activin-induced activation in the PDFS
cells is probably due to the presence of endogenous functional activin
receptors and the autocrine/paracrine effects of secreted activin A.
Cotransfection of p3TPlux with full-length Act-RIB in PDFS cells
further enhanced the luciferase activity, whereas cotransfection with
the truncated Act-RIB (
c) significantly decreased the reporter
activity (P < 0.001; Fig. 7B
).
 |
Discussion
|
|---|
We have developed and characterized a transformed human
folliculostellate cell line, derived from a pituitary gonadotroph
adenoma. Multiple lines of evidence lead us to conclude that this
transformed cell line is of folliculostellate origin. It expresses the
specific markers of folliculostellate cells, vimentin (49) and S-100
(50, 51). In addition, the desmosomes described by electron microscopy
are consistent with the ultrastructural features of folliculostellate
cells (52, 53). This is the first human pituitary-derived
folliculostellate cell line and is an important first step in the
investigation of autocrine/paracrine effects in the human
pituitary.
The study of the growth rate of the PDFS cell line revealed a doubling
time of 24 h, similar to that of most established human carcinoma
cell lines. In an anchorage-independent transformation assay, PDFS
cells formed large colonies in soft agar, indicating that the cells had
undergone malignant transformation. Cell transformation is usually
caused by oncogene activation (54) or inactivation of tumor suppressor
genes (55, 56, 57). One of the most frequent functionally inactivated tumor
suppressor genes in human cancers is Rb, which controls progression
from G1 to S phases in normal cycling cells by
regulating the transcription of E2F-responsive genes (58). Another
frequently mutated tumor suppressor gene is p53, which promotes growth
arrest and apoptosis in response to cellular stresses in a
transcription-specific manner that may correlate with the functional
status of Rb (59). In cells expressing functional Rb, p53 induces
G1 arrest by induction of cyclin-dependent kinase
(cdk) inhibitors, whereas in cells lacking functional Rb, p53 induces
apoptosis. Either of the above will inhibit neoplastic cell
development. Hyperphosphorylation of Rb by G1
cdk, mainly cdk4 or cdk6, neutralizes its tumor-suppressing function.
The kinase activity of cdk4/6 is inhibited by an ink family of cdk
inhibitors, such as p16ink4a (60), resulting in
Rb activation. Therefore, the inactivation of Rb, a result of mutation
or the lack of functional p16ink4a expression,
leads to uncontrolled cell growth and immortalization. Although in many
human tumors the inactivation of tumor-suppressor genes Rb, p53, and
p16ink4a has been found from the early stages
(60, 61), mutations of these genes have not been commonly found in
human pituitary adenomas (62). However, it has been demonstrated that
these tumor suppressor genes are frequently mutated during
establishment of various cell lines. Therefore, we studied the status
of these most frequently inactivated tumor suppressor genes in PDFS
cells. Although p16ink4a and Rb expressions were
normal, the p53 appeared mutated in PDFS cells. This is probably a
point mutation, because the protein size of p53 is not altered and the
nuclear localization is preserved, as illustrated by Western blotting
and cellular immunostaining. However, the mutation caused protein
conformation changes in p53, which are recognized by PAb240, a mutant
p53-specific antibody. In addition, the interaction with mdm2 protein,
which is required for ubiqitin-mediated degradation of p53, may be
altered in this cell line, resulting in its accumulation within the
cell (63, 64). This may explain the high level of p53 expression in
PDFS cells, similar to that found in mutant p53-expressing T47D cells.
Only weak p53 expression was detected in HS-27 cells due to the very
short half-life of wt p53 in nonstress conditions (65). It has been
reported that p53 is prone to inactivation during cell line
establishment. For example, all spontaneously immortalized cell lines
derived from mouse embryonic fibroblasts contain p53 mutations (66).
Therefore, it is possible that a p53 mutation was generated during the
culture establishment of the PDFS cell line and helped its
immortalization and transformation. However, it is unlikely to be
related to formation of the original pituitary adenoma.
Due to the patients sex, we were unable to confirm whether the cell
line was monoclonal in origin by X-linked inactivation. However, the
cytogenetic analysis revealed that all cells were hyperdiploid as a
result of multiple clonal trisomies and tetrasomies. Other clonal
aberrations included rearrangements of a chromosome X short arm,
chromosome 1 long arm, and chromosome 7 short arm. There are few
published pituitary adenoma karyotypes. Rey et al. reported
a GH-secreting adenoma karyotype with 58 chromosomes and clonal
aberrations, primarily numerical (chromosome gains) rather than
structural in nature, similar to those found in PDFS cells (67). Recent
data suggest that genetic abnormalities in pituitary adenomas often
involve several chromosomes, which may inactivate a tumor suppressor
gene or activate an oncogene that is important in the initiation or
progression of sporadic pituitary adenomas (68).
Activin and other members of the transforming growth factor-ß family
of cytokines function as both growth and differentiation factors in a
variety of cell types (69). Follistatin, a glycosylated monomeric
protein that binds to activin, was originally discovered from ovarian
follicular fluid as a suppressor of FSH secretion (70) and later was
identified as a widely distributed activin-binding and -neutralizing
protein, suggesting its regulatory effects in different
activin-mediated actions (71, 72, 73, 74). It has been shown that in the normal
human pituitary, follistatin is readily expressed in gonadotropes and
folliculostellate cells (75). Locally secreted activin in the normal
pituitary is a potent factor in controlling hormone biosynthesis and
secretion (76, 77, 78). Activin also influences the proliferation of a
number of normal and neoplastic human cell types, and the relative
amounts of locally secreted activin, inhibin, and follistatin may
control normal cellular proliferation (2, 79). However, the functional
interaction between activin and follistatin and the physiological
significance of this interaction are poorly understood. Our PDFS cell
line provides a novel model to study such interactions in regard to
hormone secretion and cell growth. Our data indicate that PDFS cells
secrete biologically active activin A, express functional activin
receptor types I and II, and retain an intact activin-mediated signal
transduction pathway as determined by reporter assays. Therefore, this
cell line could also be very useful for studying the molecular events
underlying the regulation of cell proliferation by activin.
In conclusion, we report the first transformed human folliculostellate
cell line, derived from a gonadotroph adenoma of the pituitary. This
line expresses activin and follistatin, important proteins in the
autocrine/paracrine regulation of anterior pituitary cells, and may
serve as a model system to elucidate further the mechanisms of growth
factor regulation in normal and neoplastic human pituitary.
 |
Acknowledgments
|
|---|
We thank Dr. Joan Massagué (Memorial Sloan-Kettering
Cancer Center, New York, NY) who generously provided the L17 cell line
and p3TPlux construct, Dr. A. F. Parlow (National Hormone and
Pituitary Program, Torrence, CA) who kindly provided the recombinant
human activin A, and Dr. Wylie Vale (The Clayton Foundation
Laboratories for Peptide Biology, The Salk Institute for Biological
Studies, La Jolla, CA) who provided the Act-RIB
c construct. We are
grateful to Dr. Jack Ham (Department of Medicine, University of Wales
College of Medicine, Cardiff, UK) who provided the CHP2 cell line.
 |
Footnotes
|
|---|
1 This work was supported in part by NIH Grants R01-DK-40947 and
P32-DK-07028, and the Jarislowsky Foundation. 
Received August 18, 1999.
Revised November 4, 1999.
Accepted November 12, 1999.
 |
References
|
|---|
-
Alexander JM, Jameson JL, Bikkal HA, Schwall RH,
Klibanski A. 1991 The effects of activin on follicle-stimulating
hormone secretion and biosynthesis in human glycoprotein
hormone-producing pituitary adenomas. J Clin Endocrinol Metab. 72:12611267.[Abstract/Free Full Text]
-
Alexander JM, Swearingen B, Tindall GT, Klibanski
A. 1995 Human pituitary adenomas express endogenous inhibin
subunit and follistatin messenger ribonucleic acids. J Clin
Endocrinol Metab. 80:147152.[Abstract]
-
Dufy-Barbe L, Corcuff JB, Sartor P, Guerin J, Dufy
B. Neuropeptide expression in human pituitary cell lines
[Abstract T-27]. Proc of the 2nd Int Pituitary Congr. 1989.
-
Prysor-Jones RA, Silverlight JJ, Jenkins JS. 1989 Oestradiol, vasoactive intestinal peptide and fibroblast growth factor
in the growth of human pituitary tumour cells in vitro. J
Endocrinol. 120:171177.[Abstract/Free Full Text]
-
Tougard C, Tixier-Vidal A. 1988 Lactotrophs and
gonadotrophs. In: Knobil E, Neill JD, eds. Physiology of reproduction,
chapt 30. New York: Raven Press; 13051333.
-
Chomczynski P, Sosynski PA, Frohman LA. 1993 Stimulatory effect of thyroid hormone on growth hormone gene expression
in a human pituitary cell line. J Clin Endocrinol Metab. 77:281285.[Abstract]
-
Ham J, Webster J, Bond JA, et al. 1998 Immortalized human pituitary cells express glycoprotein alpha-subunit
and thyrotropin beta (TSH beta). J Clin Endocrinol Metab. 83:1598603.[Abstract/Free Full Text]
-
Baes M, Denef C. 1987 Evidence that stimulation of
growth hormone release by epinephrine and vasoactive intestinal peptide
is based on cell-to-cell communication in the pituitary. Endocrinology. 120:280290.[Abstract/Free Full Text]
-
Soji T, Mabuchi Y, Kurono C, Herbert DC. 1997 Folliculo-stellate cells and intercellular communication within the rat
anterior pituitary gland. Microsc Res Technol. 39:138149.[CrossRef][Medline]
-
Gospodarowicz D, Lau K. 1989 Pituitary follicular
cells secrete both vascular endothelial growth factor and follistatin. Biochem Biophys Res Commun. 165:292298.[CrossRef][Medline]
-
Kaiser UB, Lee BL, Carroll RS, Unabia G, Chin WW, Childs
GV. 1992 Follistatin gene expression in the pituitary:
localization in gonadotropes and folliculostellate cells in diestrous
rats. Endocrinology. 130:30483056.[Abstract/Free Full Text]
-
McConnell DS, Wang Q, Sluss PM, et al. 1998 A
two-site chemiluminescent assay for activin-free follistatin reveals
that most follistatin circulating in men and normal cycling women is in
an activin-bound state. J Clin Endocrinol Metab. 83:851858.[Abstract/Free Full Text]
-
Johnson MD, Gray ME, Pepinsky RB, Stahlman MT. 1990 Lipocortin-1 immunoreactivity in the human pituitary gland. J
Histochem Cytochem. 38:18411845.[Abstract]
-
Jessop DS. 1999 Central non-glucocorticoid
inhibitors of the hypothalamo-pituitary-adrenal axis. J Endocrinol. 160:169180.[CrossRef][Medline]
-
Loxley HD, Cowell AM, Flower RJ, Buckingham JC. 1993 Modulation of the hypothalamo-pituitary adrenocortical response to
cytokines in the rat by lipocortin 1 and glucocorticoids: a role for
lipocortin 1 in the feedback inhibition of CRF-41 release? Neuroendocrinology. 57:801813.[Medline]
-
Lach B, Rippstein P, Benott BG, Staines W. 1996 Differentiating neuroblastoma of pituitary gland: neuroblastic
transformation of epithelial adenoma cells. Case report. J
Neurosurg. 85:953960.[Medline]
-
Lloyd RV, Jin L, Fields K, Kulig E. 1990 Regulation
of prolactin gene expression in a DMBA-estrogen-induced transplantable
rat pituitary tumor. Am J Pathol. 137:15251537.[Abstract]
-
Mitchner NA, Garlick C, Ben-Jonathan N. 1998 Cellular distribution and gene regulation of estrogen receptors
and
ß in the rat pituitary gland. Endocrinology. 139:39763983.[Abstract/Free Full Text]
-
Sbarbati A, Fakhreddine A, Zancanaro C, Bontempini L,
Cinti S. 1991 Ultrastructural morphology of folliculo-stellate
cells in human pituitary adenomas. Ultrastruct Pathol. 15:241248.[Medline]
-
Kobayashi H, Fukata J, Murakami N, et al. 1997 Tumor necrosis factor receptors in the pituitary cells. Brain Res. 758:4550.[CrossRef][Medline]
-
Renner U, Gloddek J, Pereda MP, Arzt E, Stalla GK. 1998 Regulation and role of intrapituitary IL-6 production by
folliculostellate cells. Dom Anim Endocrinol. 15:353362.[CrossRef][Medline]
-
Renner U, Gloddek J, Arzt E, Inoue K, Stalla GK. 1997 Interleukin-6 is an autocrine growth factor for
folliculostellate-like TtT/GF mouse pituitary tumor cells. Exp Clin
Endocrinol Diabetes. 105:345352.[Medline]
-
Vankelecom H, Matthys P, Van Damme J, Heremans H,
Billiau A, Denef C. 1993 Immunocytochemical evidence that
S-100-positive cells of the mouse anterior pituitary contain
interleukin-6 immunoreactivity. J Histochem Cytochem. 41:151156.[Abstract]
-
Suzui H, Takahashi JA, Fukumoto M, et al. 1994 Immunohistochemical study for basic fibroblast growth factor and
fibroblast growth factor receptor I in pituitary adenomas. Neurosci
Lett. 171:192196.[CrossRef][Medline]
-
Voit D, Saeger W, Ludecke DK. 1999 Folliculo-stellate cells in pituitary adenomas of patients with
acromegaly. Pathol Res Pract. 195:143147.[Medline]
-
Velasco ME, Roessmann U, Gambetti P. 1982 The
presence of glial fibrillary acidic protein in the human pituitary
gland. J Neuropathol Exp Neurol. 41:150163.[Medline]
-
Yamakita N, Ikeda T, Murai T, et al. 1997 Panhypopituitarism due to Rathkes cleft cyst associated with
pituitary oncocytoma. Intern Med. 36:107112.[Medline]
-
Sbarbati A, Fakhreddine A, Zancanaro C, Bontempini L,
Cinti S. 1991 Ultrastructural morphology of folliculo-stellate
cells in human pituitary adenomas. Ultrastruct Pathol. 15:241248.
-
Lach B, Rippstein P, Benott BG, Staines W. 1996 Differentiating neuroblastoma of pituitary gland: neuroblastic
transformation of epithelial adenoma cells. Case report. J
Neurosurg. 85:953960.
-
Giometto B, Miotto D, Botteri M, et al. 1997 Folliculo-stellate cells of human pituitary adenomas:
immunohistochemical study of the monocyte/macrophage phenotype
expression. Neuroendocrinology. 65:4752.[CrossRef][Medline]
-
Klibanski A, Shupnik MA, Bikkal HA, Black PM, Kliman B,
Zervas NT. 1988 Dopaminergic regulation of
-subunit secretion
and messenger ribonucleic acid levels in alpha-secreting pituitary
tumors. J Clin Endocrinol Metab. 66:96102.[Abstract/Free Full Text]
-
Fletcher JA, Kozakewich HP, Hoffer FA, et al. 1991 Diagnostic relevance of clonal cytogenetic aberrations in malignant
soft-tissue tumors. N Engl J Med. 324:436442.[Abstract]
-
Mitelman F, ed. 1995 ISCN: an international system
for human cytogenetic nomenclature. Basel: Karger.
-
Chaidarun SS, Alexander JM. 1998 A tumor-specific
truncated estrogen receptor splice variant enhances estrogen-stimulated
gene expression. Mol Endocrinol. 12:13551366.[Abstract/Free Full Text]
-
Cowley S, Paterson H, Kemp P, Marshall CJ. 1994
Activation of MAP kinase is necessary and sufficient for PC12
differentiation and for transformation of NIH 373 cells. Cell. 77:841852.
-
Zhang X, Horwitz GA, Prezant TR, et al. 1999 Structure, expression, and function of human pituitary
tumor-transforming gene (PTTG). Mol Endocrinol. 13:156166.[Abstract/Free Full Text]
-
Chomczynski P, Sacchi N. 1987 Single-step method of
RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. Anal Biochem. 162:156159.[Medline]
-
Alexander JM, Bikkal HA, Zervas NT, Laws Jr ER,
Klibanski A. 1996 Tumor-specific expression and alternate splicing
of messenger ribonucleic acid encoding activin/transforming growth
factor-ß receptors in human pituitary adenomas. J Clin
Endocrinol Metab. 81:783790.[Abstract]
-
Danila DC, Schally AV, Nagy A, Alexander JM. 1999 Selective induction of apoptosis by the cytotoxic analog AN-207 in
cells expressing recombinant receptor for luteinizing hormone-releasing
hormone. Proc Natl Acad Sci USA. 96:669673.[Abstract/Free Full Text]
-
Zhou Y, Li J, Xu K, Hu SX, Benedict WF, Xu HJ. 1994 Further characterization of retinoblastoma gene-mediated cell growth
and tumor suppression in human cancer cells. Proc Natl Acad Sci USA. 91:41654169.[Abstract/Free Full Text]
-
Banks L, Matlashewski G, Crawford L. 1986 Isolation
of human-p53-specific monoclonal antibodies and their use in the
studies of human p53 expression. Eur J Biochem. 159:529534.[Medline]
-
Gannon JV, Greaves R, Iggo R, Lane DP. 1990 Activating mutations in p53 produce a common conformational effect. A
monoclonal antibody specific for the mutant form. EMBO J. 9:15951602.[Medline]
-
Wrana JL, Attisano L, Carcamo J, et al. 1992 TGFß
signals through a heteromeric protein kinase receptor complex. Cell. 71:10031014.[CrossRef][Medline]
-
Tsuchida K, Vaughan JM, Wiater E, Gaddy-Kurten D, Vale
WW. 1995 Inactivation of activin-dependent transcription by
kinase-deficient activin receptors. Endocrinology. 136:54935503.[Abstract]
-
Pedrocchi M, Schafer BW, Mueller H, Eppenberger U,
Heizmann CW. 1994 Expression of Ca(2+)-binding proteins of the
S100 family in malignant human breast-cancer cell lines and biopsy
samples. Int J Cancer. 57:684690.[Medline]
-
Nigro JM, Baker SJ, Preisinger AC, et al. 1989 Mutations in the p53 gene occur in diverse human tumour types. Nature. 342:705708.[CrossRef][Medline]
-
Casey G, Lo-Hsueh M, Lopez ME, Vogelstein B, Stanbridge
EJ. 1991 Growth suppression of human breast cancer cells by the
introduction of a wild-type p53 gene. Oncogene. 6:1791797.[Medline]
-
Diller L, Kassel J, Nelson CE, et al. 1990 p53
functions as a cell cycle control protein in osteosarcomas. Mol Cell
Biol. 10:57725781.[Abstract/Free Full Text]
-
Kasper M. 1992 Cytokeratins in intracranial and
intraspinal tissues. Adv Anat Embryol Cell Biol. 126:182.[Medline]
-
Nakajima T, Yamaguchi H, Takahashi K. 1980 S-100
protein in folliculostellate cells of the rat pituitary anterior lobe. Brain Res. 191:523531.[CrossRef][Medline]
-
Ishikawa H, Nogami H, Shirasawa N. 1983 Novel
clonal strains from adult rat anterior pituitary producing S-100
protein. Nature. 303:711713.[CrossRef][Medline]
-
Tachibana O, Yamashima T. 1988 Previously
unreported "hemidesmosomal junctions" between folliculo-stellate
cells and pituitary adenoma cells. Histol Histopathol. 3:275258.[Medline]
-
Herbert DC. 1979 Intercellular junctions in the
rhesus monkey pars distalis. Anat Rec. 195:16.[CrossRef][Medline]
-
Kang JS, Krauss RS. 1996 Ras induces
anchorage-independent growth by subverting multiple adhesion-regulated
cell cycle events. Mol Cell Biol. 16:33703380.[Abstract]
-
Reddel RR. 1998 Genes involved in the control of
cellular proliferative potential. Ann NY Acad Sci. 854:819.[CrossRef][Medline]
-
Kiyono T, Foster SA, Koop JI, McDougall JK, Galloway DA,
Klingelhutz AJ. 1998 Both Rb/p16INK4a inactivation and telomerase
activity are required to immortalize human epithelial cells. Nature. 396:8488.[CrossRef][Medline]
-
Weinberg RA. 1995 The molecular basis of oncogenes
and tumor suppressor genes. Ann NY Acad Sci. 758:331338.[Medline]
-
Sherr CJ. 1996 Cancer cell cycles. Science. 274:16721677.[Abstract/Free Full Text]
-
Ko LJ, Prives C. 1996 p53:puzzle and paradigm. Genes Dev. 10:10541072.[Free Full Text]
-
Serrano M. 1997 The tumor suppressor protein
p16INK4a. Exp Cell Res. 237:713.[CrossRef][Medline]
-
Greenblatt MS, Bennett WP, Hollstein M, Harris CC. 1994 Mutations in the p53 tumor suppressor gene: clues to cancer
etiology and molecular pathogenesis. Cancer Res. 54:48554878.[Free Full Text]
-
Asa SL, Ezzat S. 1998 The cytogenesis and
pathogenesis of pituitary adenomas. Endocr Rev. 19:798827.[Abstract/Free Full Text]
-
Haupt Y, Maya R, Kazaz A, Oren M. 1997 Mdm2
promotes the rapid degradation of p53. Nature. 387:296299.[CrossRef][Medline]
-
Kubbutat MH, Jones SN, Vousden KH. 1997 Regulation
of p53 stability by Mdm2. Nature. 387:299303.[CrossRef][Medline]
-
Hinds PW, Finlay CA, Quartin RS, et al. 1990 Mutant
p53 DNA clones from human colon carcinomas cooperate with ras in
transforming primary rat cells: a comparison of the "hot spot"
mutant phenotypes. Cell Growth Differ. 1:571580.[Abstract]
-
Harvey DM, Levine AJ. 1991 p53 alteration is a
common event in the spontaneous immortalization of primary BALB/c
murine embryo fibroblasts. Genes Dev. 5:23752385.[Abstract/Free Full Text]
-
Rey JA, Bello MJ, de Campos JM, Kusak ME,
Martinez-Castro P, Benitez J. 1986 A case of pituitary adenoma
with 58 chromosomes. Cancer Genet Cytogenet. 23:171174.[CrossRef][Medline]
-
Metzger AK, Mohapatra G, Minn YA, et al. 1999 Multiple genetic aberrations including evidence of chromosome 11q13
rearrangement detected in pituitary adenomas by comparative genomic
hybridization. J Neurosurg. 90:306314.[Medline]
-
Mathews LS. 1994 Activin receptors and cellular
signaling by the receptor serine kinase family [Review]. Endocr Rev. 15:310325.[Abstract/Free Full Text]
-
Esch FS, Shimasaki S, Mercado M, et al. 1987 Structural characterization of follistatin: a novel
follicle-stimulating hormone release-inhibiting polypeptide from the
gonad. Mol Endocrinol. 1:849855.[Abstract/Free Full Text]
-
Wang EY, Draper LB, Lee E, Polak A, Sluss P, Weiss J,
Woodruff TK. 1999 Identification of naturally occurring
follistatin complexes in human biological fluids. Biol Reprod. 60:813.[Abstract/Free Full Text]
-
Shimasaki S, Koga M, Buscaglia ML, Simmons DM, Bicsak
TA, Ling N. 1989 Follistatin gene expression in the ovary and
extragonadal tissues. Mol Endocrinol. 3:651659.[Abstract/Free Full Text]
-
Ying SY. 1989 Inhibins, activins and follistatins. J Steroid Biochem. 33:705713.[CrossRef][Medline]
-
Michel U, Albiston A, Findlay JK. 1990 Rat
follistatin: gonadal and extragonadal expression and evidence for
alternative splicing. Biochem Biophys Res Commun. 173:401407.[CrossRef][Medline]
-
Kaiser UB, Lee BL, Carroll RS, Unabia G, Chin WW, Childs
GV. 1992 Follistatin gene expression in the pituitary:
localization in gonadotropes and folliculostellate cells in diestrous
rats. Endocrinology. 130:30483056.
-
Carroll RS, Corrigan AZ, Gharib SD, WV, Chin WW. 1989 Inhibin, activin, and follistatin: regulation of
follicle-stimulating hormone messenger ribonucleic acid levels. Mol
Endocrinol. 3:19691976.[Abstract/Free Full Text]
-
Billestrup N, Gonzalez-Manchon C, Potter E, and Vale
W. 1990 Inhibition of somatotroph growth and growth hormone
biosynthesis by activin in vitro. Mol Endocrinol. 4:356362.[Abstract/Free Full Text]
-
Murata T, Ying SY. 1991 Transforming growth
factor-beta and activin inhibit basal secretion of prolactin in a
pituitary monolayer culture system. Proc Soc Exp Biol Med. 198:599605.[CrossRef][Medline]
-
Penabad JL, Bashey HM, Asa SL, et al. 1996 Decreased follistatin gene expression in gonadotroph adenomas. J
Clin Endocrinol Metab. 81:33973403.[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
L. M Bilezikjian, A. L Blount, C. J Donaldson, and W. W Vale
Pituitary actions of ligands of the TGF-{beta} family: activins and inhibins.
Reproduction,
August 1, 2006;
132(2):
207 - 215.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Cherrington, T. A. Farmerie, C. A. Lents, J. D. Cantlon, M. S. Roberson, and C. M. Clay
Activin Responsiveness of the Murine Gonadotropin-Releasing Hormone Receptor Gene Is Mediated by a Composite Enhancer Containing Spatially Distinct Regulatory Elements
Mol. Endocrinol.,
April 1, 2005;
19(4):
898 - 912.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang, Y. Zhou, K. R. Mehta, D. C. Danila, S. Scolavino, S. R. Johnson, and A. Klibanski
A Pituitary-Derived MEG3 Isoform Functions as a Growth Suppressor in Tumor Cells
J. Clin. Endocrinol. Metab.,
November 1, 2003;
88(11):
5119 - 5126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Solito, A. Mulla, J. F. Morris, H. C. Christian, R. J. Flower, and J. C. Buckingham
Dexamethasone Induces Rapid Serine-Phosphorylation and Membrane Translocation of Annexin 1 in a Human Folliculostellate Cell Line via a Novel Nongenomic Mechanism Involving the Glucocorticoid Receptor, Protein Kinase C, Phosphatidylinositol 3-Kinase, and Mitogen-Activated Protein Kinase
Endocrinology,
April 1, 2003;
144(4):
1164 - 1174.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Bilezikjian, A. M. O. Leal, A. L. Blount, A. Z. Corrigan, A. V. Turnbull, and W. W. Vale
Rat Anterior Pituitary Folliculostellate Cells Are Targets of Interleukin-1{beta} and a Major Source of Intrapituitary Follistatin
Endocrinology,
February 1, 2003;
144(2):
732 - 740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Danila, X. Zhang, Y. Zhou, J. N. S. Haidar, and A. Klibanski
Overexpression of Wild-Type Activin Receptor Alk4-1 Restores Activin Antiproliferative Effects in Human Pituitary Tumor Cells
J. Clin. Endocrinol. Metab.,
October 1, 2002;
87(10):
4741 - 4746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Kawakami, Y. Fujii, Y. Okada, and S. J. Winters
Paracrine Regulation of FSH by Follistatin in Folliculostellate Cell-Enriched Primate Pituitary Cell Cultures
Endocrinology,
June 1, 2002;
143(6):
2250 - 2258.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhang, H. Sun, D. C. Danila, S. R. Johnson, Y. Zhou, B. Swearingen, and A. Klibanski
Loss of Expression of GADD45{gamma}, a Growth Inhibitory Gene, in Human Pituitary Adenomas: Implications for Tumorigenesis
J. Clin. Endocrinol. Metab.,
March 1, 2002;
87(3):
1262 - 1267.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Danila, J. N. S. Haidar, X. Zhang, L. Katznelson, M. D. Culler, and A. Klibanski
Somatostatin Receptor-Specific Analogs: Effects on Cell Proliferation and Growth Hormone Secretion in Human Somatotroph Tumors
J. Clin. Endocrinol. Metab.,
July 1, 2001;
86(7):
2976 - 2981.
[Abstract]
[Full Text]
[PDF]
|
 |
|