| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Induces Interleukin-1 Converting Enzyme Expression in Pancreatic Islets by an Interferon Regulatory Factor-1-Dependent Mechanism1
Steno Diabetes Center and Hagedorn Research Institute (A.E.K., K.N., J.J., H.U.A., F.P., T.M.-P., J.N.), 2820 Gentofte, Denmark; and Diabetes Research Center, Vrije Universiteit Brussel (D.P., D.L.E.), B-1090 Brussels, Belgium
Address correspondence and requests for reprints to: Dr. Allan E. Karlsen, Steno Diabetes Center, Niels Steensensvej 2, 2820 Gentofte, Denmark. E-mail: aek{at}novo.dk
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ICE messenger RNA (mRNA) expression was highly up-regulated
after 6-, 24-, and 72-h exposure of human islets to interferon
(IFN)
, tumor necrosis factor (TNF)
+ IFN or IL-1ß + TNF +
IFN, paralleled by increased iNOS (the inducible form of NO
synthase) expression and NO production after exposure to the combined
cytokines but not to IFN or TNF + IFN. Cytokine-induced
NO-independent ICE transcription was confirmed using iNOS
inhibitors.
Exposure of rat and mouse islets, or rat insulinoma cells, for 24
h to IFN alone or in combination with the two other cytokines also
resulted in a highly significant ICE mRNA expression. ICE transcription
was not inducible in islets from IFN regulatory factor-1 knock-out
mice, suggesting a key-role of this transcription-factor in
cytokine-mediated ICE expression in pancreatic islets.
In conclusion, cytokines and IFN in particular increase ICE mRNA
expression in pancreatic islet cells and ß-cell lines, independently
of NO synthesis, suggesting that ICE up-regulation may be involved in
cytokine-induced NO-independent apoptosis of human islets.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, and interferon (IFN) induces apoptosis in an
NO-independent way (2). Several death signals, triggered by different exogenous stimuli, may result in apoptosis. A major pathway in the apoptotic cascade is controlled by the cysteine proteases of the IL-1ß-converting enzyme (ICE)-like family, classified as caspases (reviewed in Ref. 3). One of the major proapoptotic caspases is the interleukin-converting enzyme (ICE, or caspase 1). In T lymphocytes, mitogen induced ICE expression, and resulting apoptosis has been demonstrated to be dependent on the transcription factor IFN regulatory factor-1 (IRF-1) (4). In serum-depleted vascular smooth muscle cells, a similar IRF-1-dependent ICE up-regulation and resulting apoptosis have been reported (5). Against this background, we presently aimed to clarify whether proinflammatory cytokines induce ICE expression in human and rodent islets, and in insulinoma cell lines, and whether such expression is dependent on cytokine-induced iNOS and IRF-1 activation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cytokines used for the human islet experiments were recombinant
human (rh) IL-1ß (105 U/µg), rh IFN
(4.7 x 104 U/µg) from Genzyme
Corporation (Cambridge, MA), and recombinant murine (rm) TNF
(1.5 x 105 U/µg) from Innogenetics (Gent,
Belgium). The cytokines used for the mouse islets were rm IFN
(104 U/µg, Holland Biotechnology, Leiden, The
Netherlands), rh IL-1ß (3.8 x 104 U/µg,
a kind gift of Dr. C. W. Reynolds from the National Cancer
Institute, Bethesda, MD), and rm TNF (2.2 x
105 U/µg, Innogenetics). The cytokines
used for the rat islets, rat insulinoma (RIN), and MSL cell experiments
were rh IL-1ß (4 x 105 U/µg, Novo
Nordisk Ltd., Bagsværd, Denmark), rh TNF (1.43 x
105 U/µg), and rm IFN (1.14 x
104 U/µg) (Genzyme).
NG-monomethyl-L-arginine (NMMA) was
purchased from Alexis Corporation (San Diego, CA).
Islet isolation, cell culture, and cytokine treatment
Islets from 11 human donors (mean age ± SD,
41 ± 4 yr; range, 25–60 yr) were isolated and cultured at the
Central Unit of the ß-Cell Transplant Program (Vrije Universiteit
Brussel), as previously described (6). Light microscopic examination of
the immunocytochemically stained islets indicated the prevalence of
insulin- and glucagon-positive cells to be 50 ± 4% and 12
± 2% (mean ± SD), respectively. The remaining cells
are mostly ductal cells and other endocrine cells, as previously
described (7). The human islets were cultured in the presence or
absence of the cytokines IL-1ß (50 U/mL), TNF (1000 U/mL), and
IFN (1000 U/mL) alone or in combination for 6, 24, or 72 h,
concentrations derived from our previous experiments (2, 8);
105 - 2 x 105 cells
per analysis from 5 different donors were divided among the different
experimental groups in the first series of experiments. In a second set
of experiments, human islet preparations were exposed for 72 h to
cytokines (n = 4); and the culture medium was collected for
determination of nitrite, as a measure of NO production, by the Griess
reaction (9). In a third set of human islet analyses, islet
preparations were exposed to IL-1ß or IFN alone or in combination,
for 6 or 24 h, in the presence or absence of 1.0 mmol/L of the
iNOS inhibitor L-NMMA. We have previously observed that this
concentration of NMMA prevents cytokine-induced nitrite production by
human pancreatic islets (10).
Islets from 3- to 6-day-old Wistar rats (Møllegård, Lille Skensved,
Denmark) were isolated by hand-picking after collagenase digestion of
the pancreata. After isolation, the islets were kept in preculture for
3–7 days at 37 C in atmospheric humidified air in RPMI 1640 + 10% FCS
(Life Technologies, Inc., Rockville, MD) as
previously detailed (11, 12). After preculture, a total of 150 islets
per condition were set up in 300 µL RPMI 1640 + 0.5% normal human
serum, as previously described detailed (12). Rat insulinoma
(RIN-5AH-T2B) and MSL cells, another
well-described beta-cell line (13), were cultured in RPMI 1640 + 10%
FCS, as previously described (14, 15). The islets and cells were
cultured in the presence or absence of the cytokines IL-1ß (150
U/mL), TNF (200 U/mL), and IFN (200 U/mL) alone or in combination
for 24 or 72 h, with or without NMMA. At the end of the
experiment, culture media were collected for nitrite determination (as
a measure on NO production), and the pelleted islets/cells were
snap-frozen and kept at -80 C until RNA isolation. The cytokine
concentrations used for these experiments are based on our previous
experiments and, by titration, to obtain significant levels of
cytotoxicity in the cell-lines after 24–72 h of culture. For NO and
messenger RNA (mRNA) analyses, the RIN and MSL cells were set up in
6-well tissue-culture plates (Costar, Cambridge, MA) at
1.5 x 106 cells/well and allowed to settle
for 24 hr before cytokine exposure for an additional 24
h.
The IRF-1-/- mice (16) were a generous gift from Dr. Tak Mak of the
Ontario Cancer Institute (Ontario, Canada). The IRF-1-/- mice were
backcrossed into a C57BL/6 background, and wild-type (wt) C57BL/6 were
used as controls for the IRF-1-/- mice. The animals were bred and
maintained under filter hoods at the experimental animal facility of
the Catholic University of Leuven. Wt C57BL/6 mice were purchased from
Harland Nederland, Horst, The Netherlands, and maintained under similar
conditions as the IRF-1-/- mice. The mouse islets were also isolated
by collagenase digestion of the pancreas, followed by filtration over
500 µmol/L pore mesh nylon screen and hand-picking. Cell culture was
performed in Ham’s F-10 medium supplemented with 10 mmol/L glucose, 50
µmol/L 3-isobutyl-1-methylxanthin and 1% BSA, as previously
described (17). After a 24-h preculture, culture was continued for an
additional 24 h in the presence or absence of IFN (1000 U/mL),
IL-1ß (50 U/mL), and/or TNF (1000 U/mL) for 24 h, with 150
islets per experimental setup. For the IRF-1-/- islets, four
independent experiments were performed; and for the wt, one or two were
performed. The homozygosity of the IRF-1-/- mice was confirmed in
islet and spleen tissue by the absence of IRF-1 mRNA expression after
IFN exposure. Islets isolated from wt mice presented a high IRF-1
expression (data not shown).
Proliferation assay
The Cell Titer 96 nonradioactive cell proliferation assay (Promega Corp., Madison, WI), also known as the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, was used as an assay of viability based on mitochondria activity (18, 19, 20) in control vs. cytokine-exposed RIN cells; 104 RIN cells were set up in 96-well tissue-culture plates (Costar), allowed to settle for 24 h, before cytokine exposure for additional 3 days. The assay is based on cellular conversion of a tetrazolium salt (MTT) to a blue formazan product by the mitochondrial enzyme succinate dehydrogenase, the resulting color-reaction read at A570 nm (18, 21).
RNA isolation and semiquantitative RT-PCR analysis
Total RNA from the islets was extracted by a modification of the 8 mol/L guanidine method (22), and complementary DNA (cDNA) (Invitrogen Corp. cDNA cycle Kit, Carlsbad, CA) was prepared using oligo(dT) as primer (23). For the RIN and MSL cells, total RNA was extracted after culture in 6-well plates (Costar) by the RNAzol method (RNAzol, Campro Scientific, Veenendaal, Netherlands); and oligo(dT)-primed cDNA synthesis was performed on 1 µg total RNA (Invitrogen cDNA cycle Kit). Semiquantitative RT-PCR was done for 25–29 cycles, as previously described (24), using deoxycycidine triphosphate as the 33P-labeled nucleotide. After separation by 6% PAGE, the transcription products were scanned and quantified on a PhosphorImager using the ImageQuant version 3.3 software (Molecular Dynamics, Inc., Sunnyvale, CA). To compensate for variations in cDNA concentration and PCR efficiency between tubes, internal standards were included in each amplification for normalization. No contamination with genomic DNA was observed. As internal standards, TATA-binding protein (TBP), cyclophilin, and ß-glucoronidase were used based on their linear amplification in the same range as for the mRNAs of interest (ICE and iNOS) and their unresponsiveness to the cytokine treatment. The primers used (amplicon-size in base pairs and GENEbank accession number included) were: 1) RT-PCR primers used with human islets: ICE (5'aaatctcactgcttcggacat, 5'gggcagttcttggtattcaac; 201 bp; no. M87507); iNOS (5'tctgctggcttcctgctttc, 5'actgggtcttggggcttca; 197 bp; no. D26525); Cyclophilin (5'caagatcgaggtggagaagc, 5'gtccgctccaccagatgccag; 147 bp; no. M60857); and TBP (5'gccagcttcggagagttctg, 5'tgaaaatcagtgccgtggtt; 185 bp; no. M55654); and 2) RT-PCR primers used with RIN/MSL cells and rat and mouse islets: ICE (5'aagttgctgctggaggatct, 5'gtcccacatattccctcctg; 170 bp; no. L28095); iNOS (5'cagcaatgggcagactct, 5'cacaggctgcccccggaaggtttg; 247 bp; no. U26686); TBP (5'acccttcaccaatgactcctatg, 5'atgatgactgcagcaaatcgc; 190bp; no. D01034); and ß-glucoronidase (5'gtgatgtggtctgtggccaa, 5'tctgctccatactcgctctg; 301 bp; no. M13962).
Statistical analysis
Results are presented as means ± SD. When multiple comparisons were performed, the data were compared by one-way ANOVA. Two-tailed Student’s paired t tests were used for statistical analysis of difference between groups. The level of significance was chosen at P < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Using cyclophilin for normalization,
ANOVA analysis clearly demonstrated that cytokines indeed influenced
ICE mRNA expression after both 24-h (F3 = 25.9,
P < 0.0001, n = 5) and 72-h
(F3 = 15.4, P < 0.0001, n =
5) exposure. Using t tests for comparison between the
groups, a highly significant up-regulation of ICE mRNA expression was
observed after 24-h or 72-h exposure of human islets to TNF + IFN
(P < 0.01 vs. controls) or to IL-1ß +
TNF + IFN (Mix, P < 0.01 vs.
control). ICE expression induced by 24 h exposure to TNF +
IFN was significantly reduced when IL-1ß was also present (Mix)
(P < 0.004). Similar data for relative ICE expression
was obtained using TBP as internal standard (data not shown).
|
). Whereas iNOS transcription
was barely detectable in control islets or islets exposed to IL-1ß
alone or to TNF + IFN, the combination of the three cytokines
induced a highly significant iNOS expression after 24 and 72 h,
when compared with the other three culture conditions
(P < 0.008). Analysis of the resulting NO production,
determined as nitrite production after 72-h cytokine exposure, revealed
that only the mixture of the three cytokines induced a significantly
increased NO production (pmol/µg DNA x h; mean ±
SD, n = 4): control, 5.9 ± 6.3;
IL-1ß, 6.1 ± 6.4; TNF + IFN, 3.4 ± 3.3; IL-1ß +
TNF + IFN, 46.3 ± 16.6 (P < 0.02
vs. controls).
To evaluate the influence of IFN alone on ICE mRNA expression in
human islets and the role for NO in this phenomenon, islets were
exposed for 6 or 24 h to IFN or IL-1ß alone or in
combination, in the presence or absence of NMMA. We have previously
observed that a combination of IL-1ß + IFN- induces a nitrite
production similar to that induced by IL-1ß + IFN- + TNF- (10).
Using cyclophilin for normalization, ANOVA analyses demonstrated that
both 6-h (F4 = 9.1, P < 0.003,
n = 3) and 24-h (F4 = 16.2,
P < 0.002, n = 3) cytokine exposure influenced
ICE expression, and (in agreement with the data in Fig. 1)
t test analysis compared with the expression level in
control islets revealed no significant change in ICE expression in
IL-1ß-exposed islets (control vs. IL-1ß; 6 h:
2.9 ± 1,1 vs. 1.6 ± 0.9; 24 h: 1.2 ±
0.6 vs. 1.3 ± 0.9) or in islets exposed to NMMA alone
(data not shown). In contrast, exposure to IFN alone resulted in a
clear increase in ICE mRNA expression already after 6 h of
exposure (10.9 ± 3.2, P < 0.03 vs.
control), which was maintained for 24 h (13.8 ± 2.7,
P < 0.02 vs. control). Whereas ICE mRNA
expression after exposure to the combination of IL-1ß and IFN was
also increased (6 h: 5.9 ± 3.0 and 24 h: 7.3 ± 2.0),
it was not statistically different from the level in control islets;
however, coincubation with the iNOS inhibitor NMMA resulted in a
borderline-significant up-regulation of ICE expression after both 6 and
24 h (P = 0.05 vs. control). Although
not statistically significant, IL-1ß decreased IFN-induced ICE
expression; but when these cells were exposed to IL-1ß + IFN- in
the presence of NMMA, ICE expression was similar to that observed with
IFN alone (Fig. 2). Taken together,
these data suggest that NO is not required for cytokine-induced ICE
expression. On the contrary, this radical apparently has an inhibitory
effect on ICE expression, which may explain, at least in part, the
inhibitory effect of IL-1ß on ICE expression induced by the
combination of TNF and IFN, seen in Fig. 1, but the small number
of experiments performed precluded a clear conclusion.
|
) cell-death may be induced by
cytokines (Fig. 3). Thus, the combination
of IL-1ß, TNF, and IFN (resulting in 7–8 nmol/L nitrite
accumulation per well, as a measure of NO) had a profound effect on
viability (Fig. 3). In contrast, exposure to IFN or TNF alone or
in combination did not induce any NO production above the detection
limit of our assay (1 nmol/L). Despite this, also here a markedly
decreased cell viability was observed after exposure to any of the
tested IFN concentrations, whereas TNF alone did not reduce the
cell survival at any of the concentrations tested, and barely
potentiated the effect of IFN. These data suggest that IFN is the
main inducer of NO-independent RIN cell death, which correlates well
with the need for IFN in NO-independent apoptosis of human islets
(2). In accordance with the data from the human islets, ICE
transcription in the RIN cells was barely detectable in the absence of
cytokines, or in response to IL-1ß or TNF alone or in combination,
whereas exposure to IFN alone or in combination with the other
cytokines induced a marked ICE expression (Fig. 4A). In addition, the RIN mRNA data
confirmed the dissociation between ICE and iNOS expression observed in
the human islets (Fig. 4, A and B). In line with the data on human
islets, IFN induced ICE expression in the absence of an NO
production (Fig. 4C), and inhibition of NO production by addition of
NMMA potentiated the IL-1ß + TNF + IFN-induced ICE expression
(P < 0.001, Fig. 4A). We also analyzed mRNA samples
from another rat ß-cell line, the MSL-G2 cells (27), as well as
isolated rat islets. Exposure of these cells for 24 h to IL-1ß
(150 U/mL), TNF (185 U/mL), and IFN (14 U/mL) showed an
up-regulation of ICE mRNA expression (ICE expressed as per cent of TBP,
mean ± SD), MSL cells: control:
2.7 ± 3.7 and 3 cytokines: 26.4 ± 12.7, n = 4; and rat
islets: control:1.1 ± 1.0 and 3 cytokines: 70.7 ± 33.0,
n = 3.
|
|
is the main
cytokine responsible for cytokine-induced ICE expression. To test
whether the transcription factor IRF-1 mediates this effect of IFN,
we exposed islets isolated from IRF-1-/- or wt mice to different
combinations of cytokines (Fig. 5). In
agreement with the human islet and RIN cell data, IFN alone and in
combination with IL-1ß and/or TNF induced ICE expression in wt
mouse islets (expression relative to TBP in the wt-control islets:
8.5% vs. 103–349% in the cytokine-exposed islets). In
contrast, neither IFN alone nor a combination of IFN with the
other cytokines was able to induce a significant ICE up-regulation in
islets from IRF1-/- mice (expression in control islets: 4.1%
vs. 4.2–5.8% in the cytokine exposed islets, see also Fig. 5) This indicates that IRF-1 is critically involved in
cytokine-induced, ICE expression in islet cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
+ IFN, IL-1ß +
IFN, or IL-1ß + TNF + IFN), but not IL-1ß alone, induce
apoptosis in human ß-cells after 6–9 days of exposure (Ref. 2 ;
Hoorens et al., manuscript in preparation). These effects
are not prevented by iNOS blockers (2), suggesting that
cytokine-induced apoptosis in human islets may depend on activation of
alternative, non-NO-dependent pathways. In the present study, we
substantiate the hypothesis that both NO-dependent and NO-independent
death-pathways may be induced in beta-cells/islets by different
combinations of cytokines. Furthermore, we demonstrate that
combinations of cytokines that are shown to induce human ß-cell
apoptosis also induce up-regulation of ICE mRNA expression. It is
noteworthy that IL-1ß alone, at a concentration reported not to lead
to human ß-cell apoptosis (Ref. 2 ; Hoorens et al.,
manuscript in preparation), also fails to increase ICE expression.
Although we cannot exclude that ICE transcription may be induced by
cytokines in the non-ß-cells present in the human islets preparations
(6, 7), the present finding that similar cytokine treatment induced ICE
expression in the insulin-producing clonal RIN and MSL cells suggests
the ß-cell association of this transcription. Furthermore, analyses
of the RIN cells revealed that exposure to IFN alone significantly
reduced the viability and increased ICE mRNA expression in the absence
of induced NO production, whereas TNF alone did not influence either
viability or ICE expression.
While the present experiments were being performed [part of the
present data has been previously published in abstract form (28, 29)],
up-regulated ICE protein expression was demonstrated in IL-1ß-exposed
mouse islets (30). However, this is, to our knowledge, the first
demonstration of cytokine up-regulated ICE expression in human and rat
pancreatic islets. In the human islets, the combination of cytokines
(TNF + IFN) which induced the strongest increase in ICE
expression did not induce NO production, whereas the combination of
IL-1ß + TNF + IFN induced both iNOS and NO production but less
ICE up-regulation. In the RIN cells, IFN alone, or in
combination with TNF and/or IL-1ß, also induced ICE expression. It
is noteworthy that, in the human islets, addition of IL-1ß to TNF
+ IFN seems to have an NO-dependent inhibitory effect on ICE mRNA
expression, as suggested by the observation that the iNOS inhibitor
NMMA further potentiates induction of ICE by the three cytokines.
IL-1ß may have a potentiating effect on ICE mRNA expression in RIN
cells, which is, nevertheless, inhibited by NO. Species differences in
promoter regions, signal transduction, and the use of transformed
cell-line vs. primary islet cells may explain these
differences. In support of NO as an inhibitor of ICE, this radical has
been shown to inhibit both ICE activity, and thus IL-1ß release in
macrophages (31), and ICE-mediated apoptosis in different cell-lines,
by S-nitrosylation at the active cysteine-site of ICE (32, 33). Taken
together, our data suggest that, in human islets and RIN cells, IL-1ß
is necessary for iNOS and NO expression, and NO seems to have a
inhibitory effect on cytokine-induced ICE mRNA expression.
ICE expression is involved in apoptosis resulting from different
pathways, such as granzyme B-induced apoptosis (34), DNA damage and
IRF-1-mediated apoptosis (4), and degradation of extracellular
matrix-induced apoptosis in epithelial cells (35). ICE expression is
also involved in Fas-mediated apoptosis in several cell systems (3, 36), including pancreatic ß-cells (37, 38). Constitutive expression
of the caspases ICE, Cpp32, and Ich is required for TNF-induced
apoptosis in human fibroblast cell lines (39). In several cell systems,
elevated cellular ICE expression, as induced either by ICE gene
transfection (40) or by cytokines (41), leads to cell death by
apoptosis.
The presence of IFN is required for IL-1ß- or TNF-induced
apoptosis in human islets (2), and IFN is the most important
cytokine for the induction of ICE expression in these cells (present
data). IFN induces ICE expression in different cell types via
activation of the transcription factors STAT-1 and IRF-1 (41, 42). We
have previously shown that IFN and (to a minor extent) IL-1ß
induce IRF-1 expression in human islets and RIN cells (43), and
existing evidence supports that these cytokines also induce STAT-1
activation and binding to the nucleus of rodent ß-cells (44). Thus,
it is conceivable that the cytokines used in the present experiments
increase ICE expression via activation of STAT-1 and IRF-1. To test
this hypothesis, we used islets from wt and IRF-1-/- mice, and we
observed that none of the cytokines tested induced ICE expression in
the IRF-1-/- mice islets. On the other hand, IFN alone, or in
combination with the other cytokines, induced a severalfold increase in
ICE expression in the islets isolated from wt mice. This confirms an
essential role for IRF-1 in this process. In this context, it is of
interest to note that IRF-1 has been suggested to play a key role in
promoting inflammation and autoimmunity in type II collagen-induced
arthritis and experimental allergic encephalomyelitis (45) and recently
in a mouse model of the neurodegenerative disorder Huntington’s
disease (46). ICE interacts with a network of several other pro- and
antiapoptotic proteins, including the apoptosis-inhibiting protein
bcl-2, the combined action of which determines whether the cell will
eventually undergo apoptosis (reviewed in Refs. 38 and 47).
Overexpression of bcl-2 in mouse pancreatic beta-cell lines and
primary islets protected them against cytokine-mediated apoptosis
(48, 49, 50).
Based on the present and previous data, the apoptosis observed in rat
islets and RIN cells, after short-term incubation with IL-1ß alone or
in combination with TNF and IFN, seems to be related to NO
production (reviewed in Ref. 1). However, here we show that an
NO-independent beta-cell destruction may also occur in RIN cells after
IFN exposure, a process associated with up-regulated ICE mRNA
expression. As a whole, our data suggest that induced ICE expression
may be an important effector mechanism involved in the NO-independent
apoptosis reported in human islets after 6 days of cytokine exposure
(2). Furthermore, our data support the view that cytokines may induce
apoptosis or necrosis by several different interacting pathways,
dependent on cytokine profile, concentration, exposure-time,
islet-species, metabolic state, and degree of transformation. This view
is supported by the recent demonstration that cytokine exposure may
result in recovery, apoptosis, or necrosis in Jurkat cells, regulated
by NO at two ATP-dependent steps (51). The degree of activation and
level of interaction between these different pathways may be
responsible for the reported differences in cytokine response among
human, rat, and mouse islets and different beta-cell lines.
In conclusion, it is conceivable that ICE expression is critically involved in cytokine-induced NO-independent human islet cell apoptosis. ICE expression is induced in an IRF-1-dependent fashion, and it is, at least in part, inhibited by NO.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Received August 26, 1998.
Revised July 13, 1999.
Accepted November 2, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- and ß-cell tumor phenotypes. Endocrinology. 133:2022–2030.-inducing factor (IL-18) release from
macrophages by inhibiting caspase-1 (IL-1ß-converting enzyme). J
Immunol. 161:4122–4128.-induced apoptosis in STAT1-null cells
due to low constitutive levels of caspases. Science. 278:1630–1632.-induced interferon regulatory factor-1 (IRF-1)
expression in rodent and human islet cells precedes nitric oxide
production. Endocrinology. 138:2747–2753.This article has been cited by other articles:
 |
|
 |
|
  P. Augstein, P. Heinke, E. Salzsieder, R. Grimm, J. Giebel, C. Salzsieder, and L. C Harrison Dominance of cytokine- over FasL-induced impairment of the mitochondrial transmembrane potential ({Delta}{Psi}m) in the pancreatic {beta}-cell line NIT-1 Diabetes and Vascular Disease Research, September 1, 2008; 5(3): 198 - 204. [Abstract] [PDF]
|
|
|
|
 |
|
 K. L A Souza, E. Gurgul-Convey, M. Elsner, and S. Lenzen Interaction between pro-inflammatory and anti-inflammatory cytokines in insulin-producing cells J. Endocrinol., April 1, 2008; 197(1): 139 - 150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cnop, N. Welsh, J.-C. Jonas, A. Jorns, S. Lenzen, and D. L. Eizirik Mechanisms of Pancreatic {beta}-Cell Death in Type 1 and Type 2 Diabetes: Many Differences, Few Similarities Diabetes, December 1, 2005; 54(suppl_2): S97 - S107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Gysemans, L. Ladriere, H. Callewaert, J. Rasschaert, D. Flamez, D. E. Levy, P. Matthys, D. L. Eizirik, and C. Mathieu Disruption of the {gamma}-Interferon Signaling Pathway at the Level of Signal Transducer and Activator of Transcription-1 Prevents Immune Destruction of {beta}-cells Diabetes, August 1, 2005; 54(8): 2396 - 2403. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Bergholdt, C. Taxvig, S. Eising, J. Nerup, and F. Pociot CBLB variants in type 1 diabetes and their genetic interaction with CTLA4 J. Leukoc. Biol., April 1, 2005; 77(4): 579 - 585. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Sparre, M. R. Larsen, P. E. Heding, A. E. Karlsen, O. N. Jensen, and F. Pociot Unraveling the Pathogenesis of Type 1 Diabetes with Proteomics: Present And Future Directions Mol. Cell. Proteomics, April 1, 2005; 4(4): 441 - 457. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Liu and S. I. Abrams Coordinate Regulation of IFN Consensus Sequence-Binding Protein and Caspase-1 in the Sensitization of Human Colon Carcinoma Cells to Fas-Mediated Apoptosis by IFN-{gamma} J. Immunol., June 15, 2003; 170(12): 6329 - 6337. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Jambal, S. Masterson, A. Nesterova, R. Bouchard, B. Bergman, J. C. Hutton, L. M. Boxer, J. E.-B. Reusch, and S. Pugazhenthi Cytokine-mediated Down-regulation of the Transcription Factor cAMP-response Element-binding Protein in Pancreatic {beta}-Cells J. Biol. Chem., June 13, 2003; 278(25): 23055 - 23065. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Steinbrenner, T.-B.-T. Nguyen, U. Wohlrab, W. A. Scherbaum, and J. Seissler Effect of Proinflammatory Cytokines on Gene Expression of the Diabetes-Associated Autoantigen IA-2 in INS-1 Cells Endocrinology, October 1, 2002; 143(10): 3839 - 3845. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Cottet, P. Dupraz, F. Hamburger, W. Dolci, M. Jaquet, and B. Thorens cFLIP Protein Prevents Tumor Necrosis Factor-{alpha}-Mediated Induction of Caspase-8-Dependent Apoptosis in Insulin-Secreting {beta}Tc-Tet Cells Diabetes, June 1, 2002; 51(6): 1805 - 1814. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Huo, R.-H. Luo, S. A. Metz, and G. Li Activation of Caspase-2 Mediates the Apoptosis Induced by GTP-Depletion in Insulin-Secreting (HIT-T15) Cells Endocrinology, May 1, 2002; 143(5): 1695 - 1704. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. E. Karlsen, S. G. Ronn, K. Lindberg, J. Johannesen, E. D. Galsgaard, F. Pociot, J. H. Nielsen, T. Mandrup-Poulsen, J. Nerup, and N. Billestrup Suppressor of cytokine signaling 3 (SOCS-3) protects beta -cells against interleukin-1beta - and interferon-gamma -mediated toxicity PNAS, September 26, 2001; (2001) 211445998. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yoshikawa, Y. Nakajima, and K. Tasaka IFN-{gamma} Induces the Apoptosis of WEHI 279 and Normal Pre-B Cell Lines by Expressing Direct Inhibitor of Apoptosis Protein Binding Protein with Low pI J. Immunol., September 1, 2001; 167(5): 2487 - 2495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Streetz, B. Fregien, J. Plumpe, K. Korber, S. Kubicka, G. Sass, S. C. Bischoff, M. P. Manns, G. Tiegs, and C. Trautwein Dissection of the Intracellular Pathways in Hepatocytes Suggests a Role for Jun Kinase and IFN Regulatory Factor-1 in Con A-Induced Liver Failure J. Immunol., July 1, 2001; 167(1): 514 - 523. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. K. Cardozo, M. Kruhøffer, R. Leeman, T. Ørntoft, and D. L. Eizirik Identification of Novel Cytokine-Induced Genes in Pancreatic {beta}-Cells by High-Density Oligonucleotide Arrays Diabetes, May 1, 2001; 50(5): 909 - 920. [Abstract] [Full Text]
|
|
|
|
|
|
P. M. Larsen, S.J. Fey, M.R. Larsen, A. Nawrocki, H.U. Andersen, H. Kähler, C. Heilmann, M.C. Voss, P. Roepstorff, F. Pociot, et al. Proteome Analysis of Interleukin-1{beta}-Induced Changes in Protein Expression in Rat Islets of Langerhans Diabetes, May 1, 2001; 50(5): 1056 - 1063. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. Goodbourn, L. Didcock, and R. E. Randall Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures J. Gen. Virol., October 1, 2000; 81(10): 2341 - 2364. [Full Text]
|
|
|
|
|
|
A. E. Karlsen, S. G. Ronn, K. Lindberg, J. Johannesen, E. D. Galsgaard, F. Pociot, J. H. Nielsen, T. Mandrup-Poulsen, J. Nerup, and N. Billestrup Suppressor of cytokine signaling 3 (SOCS-3) protects beta -cells against interleukin-1beta - and interferon-gamma -mediated toxicity PNAS, October 9, 2001; 98(21): 12191 - 12196. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
