help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Karlsen, A. E.
Right arrow Articles by Nerup, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Karlsen, A. E.
Right arrow Articles by Nerup, J.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 2 830-836
Copyright © 2000 by The Endocrine Society


Original Studies

Interferon-{gamma} Induces Interleukin-1 Converting Enzyme Expression in Pancreatic Islets by an Interferon Regulatory Factor-1-Dependent Mechanism1

Allan E. Karlsen, Dejan Pavlovic, Karin Nielsen, Jan Jensen, Henrik U. Andersen, Flemming Pociot, Thomas Mandrup-Poulsen, Décio L. Eizirik and Jørn Nerup

Steno Diabetes Center and Hagedorn Research Institute (A.E.K., K.N., J.J., H.U.A., F.P., T.M.-P., J.N.), 2820 Gentofte, Denmark; and Diabetes Research Center, Vrije Universiteit Brussel (D.P., D.L.E.), B-1090 Brussels, Belgium

Address correspondence and requests for reprints to: Dr. Allan E. Karlsen, Steno Diabetes Center, Niels Steensensvej 2, 2820 Gentofte, Denmark. E-mail: aek{at}novo.dk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Whereas nitric oxide (NO) production is associated with the toxic effect of cytokines on rodent pancreatic ß-cells, cytokine-induced apoptosis in human islets may occur independently of NO. The cysteine protease interleukin (IL)-1 converting enzyme (ICE) is a key proapoptotic caspase. Our aim was therefore to analyze the effect of cytokines on ICE expression in human, rat, and mouse islets and rat insulinoma cells.

ICE messenger RNA (mRNA) expression was highly up-regulated after 6-, 24-, and 72-h exposure of human islets to interferon (IFN){gamma}, tumor necrosis factor (TNF){alpha} + IFN{gamma} or IL-1ß + TNF{alpha} + IFN{gamma}, paralleled by increased iNOS (the inducible form of NO synthase) expression and NO production after exposure to the combined cytokines but not to IFN{gamma} or TNF{alpha} + IFN{gamma}. Cytokine-induced NO-independent ICE transcription was confirmed using iNOS inhibitors.

Exposure of rat and mouse islets, or rat insulinoma cells, for 24 h to IFN{gamma} alone or in combination with the two other cytokines also resulted in a highly significant ICE mRNA expression. ICE transcription was not inducible in islets from IFN regulatory factor-1 knock-out mice, suggesting a key-role of this transcription-factor in cytokine-mediated ICE expression in pancreatic islets.

In conclusion, cytokines and IFN{gamma} in particular increase ICE mRNA expression in pancreatic islet cells and ß-cell lines, independently of NO synthesis, suggesting that ICE up-regulation may be involved in cytokine-induced NO-independent apoptosis of human islets.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
INSULIN-DEPENDENT diabetes mellitus (IDDM) is associated with infiltration of the islets of Langerhans with autoreactive lymphocytes and specific destruction of the insulin-producing ß-cells. Cytokines, in particular interleukin-1ß (IL-1ß), and up-regulation of the inducible form of nitric oxide synthase (iNOS) and consequent nitric oxide (NO) production have been associated with ß-cell destruction (reviewed in Ref. 1). Although NO may play an important role in cytokine-mediated destruction of rat ß-cells and rodent ß-cell lines, its role in cytokine-mediated destruction of human islet cells is less clear. Whereas both rat islets and rodent ß-cell lines are readily induced to produce NO by IL-1ß alone, and toxicity may be observed as early as after 24 h, human islets seem more resistant to IL-1 ß alone and require exposure to combinations of cytokines to produce NO (1). Prolonged exposure (6–9 days) of human islet cells to a combination of IL-1ß, tumor necrosis factor (TNF){alpha}, and interferon (IFN){gamma} induces apoptosis in an NO-independent way (2).

Several death signals, triggered by different exogenous stimuli, may result in apoptosis. A major pathway in the apoptotic cascade is controlled by the cysteine proteases of the IL-1ß-converting enzyme (ICE)-like family, classified as caspases (reviewed in Ref. 3). One of the major proapoptotic caspases is the interleukin-converting enzyme (ICE, or caspase 1). In T lymphocytes, mitogen induced ICE expression, and resulting apoptosis has been demonstrated to be dependent on the transcription factor IFN regulatory factor-1 (IRF-1) (4). In serum-depleted vascular smooth muscle cells, a similar IRF-1-dependent ICE up-regulation and resulting apoptosis have been reported (5). Against this background, we presently aimed to clarify whether proinflammatory cytokines induce ICE expression in human and rodent islets, and in insulinoma cell lines, and whether such expression is dependent on cytokine-induced iNOS and IRF-1 activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials

Cytokines used for the human islet experiments were recombinant human (rh) IL-1ß (105 U/µg), rh IFN{gamma} (4.7 x 104 U/µg) from Genzyme Corporation (Cambridge, MA), and recombinant murine (rm) TNF{alpha} (1.5 x 105 U/µg) from Innogenetics (Gent, Belgium). The cytokines used for the mouse islets were rm IFN{gamma} (104 U/µg, Holland Biotechnology, Leiden, The Netherlands), rh IL-1ß (3.8 x 104 U/µg, a kind gift of Dr. C. W. Reynolds from the National Cancer Institute, Bethesda, MD), and rm TNF{alpha} (2.2 x 105 U/µg, Innogenetics). The cytokines used for the rat islets, rat insulinoma (RIN), and MSL cell experiments were rh IL-1ß (4 x 105 U/µg, Novo Nordisk Ltd., Bagsværd, Denmark), rh TNF{alpha} (1.43 x 105 U/µg), and rm IFN{gamma} (1.14 x 104 U/µg) (Genzyme). NG-monomethyl-L-arginine (NMMA) was purchased from Alexis Corporation (San Diego, CA).

Islet isolation, cell culture, and cytokine treatment

Islets from 11 human donors (mean age ± SD, 41 ± 4 yr; range, 25–60 yr) were isolated and cultured at the Central Unit of the ß-Cell Transplant Program (Vrije Universiteit Brussel), as previously described (6). Light microscopic examination of the immunocytochemically stained islets indicated the prevalence of insulin- and glucagon-positive cells to be 50 ± 4% and 12 ± 2% (mean ± SD), respectively. The remaining cells are mostly ductal cells and other endocrine cells, as previously described (7). The human islets were cultured in the presence or absence of the cytokines IL-1ß (50 U/mL), TNF{alpha} (1000 U/mL), and IFN{gamma} (1000 U/mL) alone or in combination for 6, 24, or 72 h, concentrations derived from our previous experiments (2, 8); 105 - 2 x 105 cells per analysis from 5 different donors were divided among the different experimental groups in the first series of experiments. In a second set of experiments, human islet preparations were exposed for 72 h to cytokines (n = 4); and the culture medium was collected for determination of nitrite, as a measure of NO production, by the Griess reaction (9). In a third set of human islet analyses, islet preparations were exposed to IL-1ß or IFN{gamma} alone or in combination, for 6 or 24 h, in the presence or absence of 1.0 mmol/L of the iNOS inhibitor L-NMMA. We have previously observed that this concentration of NMMA prevents cytokine-induced nitrite production by human pancreatic islets (10).

Islets from 3- to 6-day-old Wistar rats (Møllegård, Lille Skensved, Denmark) were isolated by hand-picking after collagenase digestion of the pancreata. After isolation, the islets were kept in preculture for 3–7 days at 37 C in atmospheric humidified air in RPMI 1640 + 10% FCS (Life Technologies, Inc., Rockville, MD) as previously detailed (11, 12). After preculture, a total of 150 islets per condition were set up in 300 µL RPMI 1640 + 0.5% normal human serum, as previously described detailed (12). Rat insulinoma (RIN-5AH-T2B) and MSL cells, another well-described beta-cell line (13), were cultured in RPMI 1640 + 10% FCS, as previously described (14, 15). The islets and cells were cultured in the presence or absence of the cytokines IL-1ß (150 U/mL), TNF{alpha} (200 U/mL), and IFN{gamma} (200 U/mL) alone or in combination for 24 or 72 h, with or without NMMA. At the end of the experiment, culture media were collected for nitrite determination (as a measure on NO production), and the pelleted islets/cells were snap-frozen and kept at -80 C until RNA isolation. The cytokine concentrations used for these experiments are based on our previous experiments and, by titration, to obtain significant levels of cytotoxicity in the cell-lines after 24–72 h of culture. For NO and messenger RNA (mRNA) analyses, the RIN and MSL cells were set up in 6-well tissue-culture plates (Costar, Cambridge, MA) at 1.5 x 106 cells/well and allowed to settle for 24 hr before cytokine exposure for an additional 24 h.

The IRF-1-/- mice (16) were a generous gift from Dr. Tak Mak of the Ontario Cancer Institute (Ontario, Canada). The IRF-1-/- mice were backcrossed into a C57BL/6 background, and wild-type (wt) C57BL/6 were used as controls for the IRF-1-/- mice. The animals were bred and maintained under filter hoods at the experimental animal facility of the Catholic University of Leuven. Wt C57BL/6 mice were purchased from Harland Nederland, Horst, The Netherlands, and maintained under similar conditions as the IRF-1-/- mice. The mouse islets were also isolated by collagenase digestion of the pancreas, followed by filtration over 500 µmol/L pore mesh nylon screen and hand-picking. Cell culture was performed in Ham’s F-10 medium supplemented with 10 mmol/L glucose, 50 µmol/L 3-isobutyl-1-methylxanthin and 1% BSA, as previously described (17). After a 24-h preculture, culture was continued for an additional 24 h in the presence or absence of IFN{gamma} (1000 U/mL), IL-1ß (50 U/mL), and/or TNF{alpha} (1000 U/mL) for 24 h, with 150 islets per experimental setup. For the IRF-1-/- islets, four independent experiments were performed; and for the wt, one or two were performed. The homozygosity of the IRF-1-/- mice was confirmed in islet and spleen tissue by the absence of IRF-1 mRNA expression after IFN{gamma} exposure. Islets isolated from wt mice presented a high IRF-1 expression (data not shown).

Proliferation assay

The Cell Titer 96 nonradioactive cell proliferation assay (Promega Corp., Madison, WI), also known as the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, was used as an assay of viability based on mitochondria activity (18, 19, 20) in control vs. cytokine-exposed RIN cells; 104 RIN cells were set up in 96-well tissue-culture plates (Costar), allowed to settle for 24 h, before cytokine exposure for additional 3 days. The assay is based on cellular conversion of a tetrazolium salt (MTT) to a blue formazan product by the mitochondrial enzyme succinate dehydrogenase, the resulting color-reaction read at A570 nm (18, 21).

RNA isolation and semiquantitative RT-PCR analysis

Total RNA from the islets was extracted by a modification of the 8 mol/L guanidine method (22), and complementary DNA (cDNA) (Invitrogen Corp. cDNA cycle Kit, Carlsbad, CA) was prepared using oligo(dT) as primer (23). For the RIN and MSL cells, total RNA was extracted after culture in 6-well plates (Costar) by the RNAzol method (RNAzol, Campro Scientific, Veenendaal, Netherlands); and oligo(dT)-primed cDNA synthesis was performed on 1 µg total RNA (Invitrogen cDNA cycle Kit). Semiquantitative RT-PCR was done for 25–29 cycles, as previously described (24), using deoxycycidine triphosphate as the 33P-labeled nucleotide. After separation by 6% PAGE, the transcription products were scanned and quantified on a PhosphorImager using the ImageQuant version 3.3 software (Molecular Dynamics, Inc., Sunnyvale, CA). To compensate for variations in cDNA concentration and PCR efficiency between tubes, internal standards were included in each amplification for normalization. No contamination with genomic DNA was observed. As internal standards, TATA-binding protein (TBP), cyclophilin, and ß-glucoronidase were used based on their linear amplification in the same range as for the mRNAs of interest (ICE and iNOS) and their unresponsiveness to the cytokine treatment. The primers used (amplicon-size in base pairs and GENEbank accession number included) were: 1) RT-PCR primers used with human islets: ICE (5'aaatctcactgcttcggacat, 5'gggcagttcttggtattcaac; 201 bp; no. M87507); iNOS (5'tctgctggcttcctgctttc, 5'actgggtcttggggcttca; 197 bp; no. D26525); Cyclophilin (5'caagatcgaggtggagaagc, 5'gtccgctccaccagatgccag; 147 bp; no. M60857); and TBP (5'gccagcttcggagagttctg, 5'tgaaaatcagtgccgtggtt; 185 bp; no. M55654); and 2) RT-PCR primers used with RIN/MSL cells and rat and mouse islets: ICE (5'aagttgctgctggaggatct, 5'gtcccacatattccctcctg; 170 bp; no. L28095); iNOS (5'cagcaatgggcagactct, 5'cacaggctgcccccggaaggtttg; 247 bp; no. U26686); TBP (5'acccttcaccaatgactcctatg, 5'atgatgactgcagcaaatcgc; 190bp; no. D01034); and ß-glucoronidase (5'gtgatgtggtctgtggccaa, 5'tctgctccatactcgctctg; 301 bp; no. M13962).

Statistical analysis

Results are presented as means ± SD. When multiple comparisons were performed, the data were compared by one-way ANOVA. Two-tailed Student’s paired t tests were used for statistical analysis of difference between groups. The level of significance was chosen at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ICE transcription was barely detectable in human islets in the absence of cytokines or after exposure to IL-1ß alone (Fig. 1Go). Using cyclophilin for normalization, ANOVA analysis clearly demonstrated that cytokines indeed influenced ICE mRNA expression after both 24-h (F3 = 25.9, P < 0.0001, n = 5) and 72-h (F3 = 15.4, P < 0.0001, n = 5) exposure. Using t tests for comparison between the groups, a highly significant up-regulation of ICE mRNA expression was observed after 24-h or 72-h exposure of human islets to TNF{alpha} + IFN{gamma} (P < 0.01 vs. controls) or to IL-1ß + TNF{alpha} + IFN{gamma} (Mix, P < 0.01 vs. control). ICE expression induced by 24 h exposure to TNF{alpha} + IFN{gamma} was significantly reduced when IL-1ß was also present (Mix) (P < 0.004). Similar data for relative ICE expression was obtained using TBP as internal standard (data not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. ICE and iNOS mRNA expression in human islets (relative to cyclophilin mRNA). A shows ICE mRNA expression, and B shows iNOS mRNA expression, after 24 h (black bars) or 72 h (white bars) of culture in the absence or presence of cytokines. Data are means ± SD, n = 5. Mix indicates IL-1ß (50U/mL) + TNF{alpha} (1000 U/mL) + IFN{gamma} (1000 U/ml). The level of significance is shown relative to the values obtained by TNF{alpha} + IFN{gamma}. **, P < 0.01; ***, P < 0.005.

 
To evaluate whether cytokine-induced ICE mRNA expression in human islets was paralleled by increased iNOS mRNA expression, this transcript was also quantified (Fig. 1BGo). Whereas iNOS transcription was barely detectable in control islets or islets exposed to IL-1ß alone or to TNF{alpha} + IFN{gamma}, the combination of the three cytokines induced a highly significant iNOS expression after 24 and 72 h, when compared with the other three culture conditions (P < 0.008). Analysis of the resulting NO production, determined as nitrite production after 72-h cytokine exposure, revealed that only the mixture of the three cytokines induced a significantly increased NO production (pmol/µg DNA x h; mean ± SD, n = 4): control, 5.9 ± 6.3; IL-1ß, 6.1 ± 6.4; TNF{alpha} + IFN{gamma}, 3.4 ± 3.3; IL-1ß + TNF{alpha} + IFN{gamma}, 46.3 ± 16.6 (P < 0.02 vs. controls).

To evaluate the influence of IFN{gamma} alone on ICE mRNA expression in human islets and the role for NO in this phenomenon, islets were exposed for 6 or 24 h to IFN{gamma} or IL-1ß alone or in combination, in the presence or absence of NMMA. We have previously observed that a combination of IL-1ß + IFN-{gamma} induces a nitrite production similar to that induced by IL-1ß + IFN-{gamma} + TNF-{alpha} (10). Using cyclophilin for normalization, ANOVA analyses demonstrated that both 6-h (F4 = 9.1, P < 0.003, n = 3) and 24-h (F4 = 16.2, P < 0.002, n = 3) cytokine exposure influenced ICE expression, and (in agreement with the data in Fig. 1Go) t test analysis compared with the expression level in control islets revealed no significant change in ICE expression in IL-1ß-exposed islets (control vs. IL-1ß; 6 h: 2.9 ± 1,1 vs. 1.6 ± 0.9; 24 h: 1.2 ± 0.6 vs. 1.3 ± 0.9) or in islets exposed to NMMA alone (data not shown). In contrast, exposure to IFN{gamma} alone resulted in a clear increase in ICE mRNA expression already after 6 h of exposure (10.9 ± 3.2, P < 0.03 vs. control), which was maintained for 24 h (13.8 ± 2.7, P < 0.02 vs. control). Whereas ICE mRNA expression after exposure to the combination of IL-1ß and IFN{gamma} was also increased (6 h: 5.9 ± 3.0 and 24 h: 7.3 ± 2.0), it was not statistically different from the level in control islets; however, coincubation with the iNOS inhibitor NMMA resulted in a borderline-significant up-regulation of ICE expression after both 6 and 24 h (P = 0.05 vs. control). Although not statistically significant, IL-1ß decreased IFN{gamma}-induced ICE expression; but when these cells were exposed to IL-1ß + IFN-{gamma} in the presence of NMMA, ICE expression was similar to that observed with IFN{gamma} alone (Fig. 2Go). Taken together, these data suggest that NO is not required for cytokine-induced ICE expression. On the contrary, this radical apparently has an inhibitory effect on ICE expression, which may explain, at least in part, the inhibitory effect of IL-1ß on ICE expression induced by the combination of TNF{alpha} and IFN{gamma}, seen in Fig. 1Go, but the small number of experiments performed precluded a clear conclusion.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 2. ICE mRNA expression in three separate human islet isolations (relative to cyclophilin mRNA) after 6- or 24-h exposure to IFN{gamma} alone or in combination with IL-1ß, in the presence or absence of 1 mM NMMA.

 
In a second series of experiments, we evaluated ICE expression in the clonal rat insulin-producing RIN cells. Similar to human islets, the RIN cells are sensitive to cytokines (25, 26). First, in our analyses using an MTT assay as an indirect measure of cell growth and viability (18, 20), we demonstrate that both NO-dependent (involving IL-1ß) and NO-independent (involving IFN{gamma}) cell-death may be induced by cytokines (Fig. 3Go). Thus, the combination of IL-1ß, TNF{alpha}, and IFN{gamma} (resulting in 7–8 nmol/L nitrite accumulation per well, as a measure of NO) had a profound effect on viability (Fig. 3Go). In contrast, exposure to IFN{gamma} or TNF{alpha} alone or in combination did not induce any NO production above the detection limit of our assay (1 nmol/L). Despite this, also here a markedly decreased cell viability was observed after exposure to any of the tested IFN{gamma} concentrations, whereas TNF{alpha} alone did not reduce the cell survival at any of the concentrations tested, and barely potentiated the effect of IFN{gamma}. These data suggest that IFN{gamma} is the main inducer of NO-independent RIN cell death, which correlates well with the need for IFN{gamma} in NO-independent apoptosis of human islets (2). In accordance with the data from the human islets, ICE transcription in the RIN cells was barely detectable in the absence of cytokines, or in response to IL-1ß or TNF{alpha} alone or in combination, whereas exposure to IFN{gamma} alone or in combination with the other cytokines induced a marked ICE expression (Fig. 4AGo). In addition, the RIN mRNA data confirmed the dissociation between ICE and iNOS expression observed in the human islets (Fig. 4Go, A and B). In line with the data on human islets, IFN{gamma} induced ICE expression in the absence of an NO production (Fig. 4CGo), and inhibition of NO production by addition of NMMA potentiated the IL-1ß + TNF{alpha} + IFN{gamma}-induced ICE expression (P < 0.001, Fig. 4AGo). We also analyzed mRNA samples from another rat ß-cell line, the MSL-G2 cells (27), as well as isolated rat islets. Exposure of these cells for 24 h to IL-1ß (150 U/mL), TNF{alpha} (185 U/mL), and IFN{gamma} (14 U/mL) showed an up-regulation of ICE mRNA expression (ICE expressed as per cent of TBP, mean ± SD), MSL cells: control: 2.7 ± 3.7 and 3 cytokines: 26.4 ± 12.7, n = 4; and rat islets: control:1.1 ± 1.0 and 3 cytokines: 70.7 ± 33.0, n = 3.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 3. MTT activity (as a measure of viability) was determined in RIN cells after 3 days culture in the absence or presence of different concentrations of TNF{alpha} (at the x-axis) and IFN{gamma} (different histogram-patterns) found not to induce measurable NO production. As a positive control, the well-described, cytotoxic NO-inducing mixture of IL-1ß, TNF{alpha}, and IFN{gamma} (last column) was included. Mean data from one typical experiment, performed in triplicate, are shown.

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 4. Cytokine-induced ICE and iNOS mRNA expression (relative to the internal standard TBP), as well as accumulated NO production in RIN cells after 24 h of culture in the absence or presence of cytokines and/or NMMA. Mean ± SD values from four to six experiments are shown. Similar data were obtained using ß-glucoronidase as the internal standard. The level of significance is shown relative to the values obtained by IFN{gamma}. *, P < 0.05; ***, P < 0.005.

 
From the data described above, it seems clear that IFN{gamma} is the main cytokine responsible for cytokine-induced ICE expression. To test whether the transcription factor IRF-1 mediates this effect of IFN{gamma}, we exposed islets isolated from IRF-1-/- or wt mice to different combinations of cytokines (Fig. 5Go). In agreement with the human islet and RIN cell data, IFN{gamma} alone and in combination with IL-1ß and/or TNF{alpha} induced ICE expression in wt mouse islets (expression relative to TBP in the wt-control islets: 8.5% vs. 103–349% in the cytokine-exposed islets). In contrast, neither IFN{gamma} alone nor a combination of IFN{gamma} with the other cytokines was able to induce a significant ICE up-regulation in islets from IRF1-/- mice (expression in control islets: 4.1% vs. 4.2–5.8% in the cytokine exposed islets, see also Fig. 5Go) This indicates that IRF-1 is critically involved in cytokine-induced, ICE expression in islet cells.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 5. ICE mRNA expression in wt and IRF-1-/- mouse islets after 24-h culture in the absence or presence of cytokines. Data are representative for 1–4 independent experiments. To illustrate the difference in ICE expression between the wt and IRF-1-/- mouse islets, data from a 30-cycle PCR reaction is shown. Thus, the lower bands seen in some of the lanes represent renaturation of the PCR products in the gel, attributable to the large amount of amplicon. Semiquantitative calculation of expression level (see text) was done after 28 PCR cycles.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Combinations of two to three cytokines (TNF{alpha} + IFN{gamma}, IL-1ß + IFN{gamma}, or IL-1ß + TNF{alpha} + IFN{gamma}), but not IL-1ß alone, induce apoptosis in human ß-cells after 6–9 days of exposure (Ref. 2 ; Hoorens et al., manuscript in preparation). These effects are not prevented by iNOS blockers (2), suggesting that cytokine-induced apoptosis in human islets may depend on activation of alternative, non-NO-dependent pathways. In the present study, we substantiate the hypothesis that both NO-dependent and NO-independent death-pathways may be induced in beta-cells/islets by different combinations of cytokines. Furthermore, we demonstrate that combinations of cytokines that are shown to induce human ß-cell apoptosis also induce up-regulation of ICE mRNA expression. It is noteworthy that IL-1ß alone, at a concentration reported not to lead to human ß-cell apoptosis (Ref. 2 ; Hoorens et al., manuscript in preparation), also fails to increase ICE expression. Although we cannot exclude that ICE transcription may be induced by cytokines in the non-ß-cells present in the human islets preparations (6, 7), the present finding that similar cytokine treatment induced ICE expression in the insulin-producing clonal RIN and MSL cells suggests the ß-cell association of this transcription. Furthermore, analyses of the RIN cells revealed that exposure to IFN{gamma} alone significantly reduced the viability and increased ICE mRNA expression in the absence of induced NO production, whereas TNF{alpha} alone did not influence either viability or ICE expression.

While the present experiments were being performed [part of the present data has been previously published in abstract form (28, 29)], up-regulated ICE protein expression was demonstrated in IL-1ß-exposed mouse islets (30). However, this is, to our knowledge, the first demonstration of cytokine up-regulated ICE expression in human and rat pancreatic islets. In the human islets, the combination of cytokines (TNF{alpha} + IFN{gamma}) which induced the strongest increase in ICE expression did not induce NO production, whereas the combination of IL-1ß + TNF{alpha} + IFN{gamma} induced both iNOS and NO production but less ICE up-regulation. In the RIN cells, IFN{gamma} alone, or in combination with TNF{alpha} and/or IL-1ß, also induced ICE expression. It is noteworthy that, in the human islets, addition of IL-1ß to TNF{alpha} + IFN{gamma} seems to have an NO-dependent inhibitory effect on ICE mRNA expression, as suggested by the observation that the iNOS inhibitor NMMA further potentiates induction of ICE by the three cytokines. IL-1ß may have a potentiating effect on ICE mRNA expression in RIN cells, which is, nevertheless, inhibited by NO. Species differences in promoter regions, signal transduction, and the use of transformed cell-line vs. primary islet cells may explain these differences. In support of NO as an inhibitor of ICE, this radical has been shown to inhibit both ICE activity, and thus IL-1ß release in macrophages (31), and ICE-mediated apoptosis in different cell-lines, by S-nitrosylation at the active cysteine-site of ICE (32, 33). Taken together, our data suggest that, in human islets and RIN cells, IL-1ß is necessary for iNOS and NO expression, and NO seems to have a inhibitory effect on cytokine-induced ICE mRNA expression.

ICE expression is involved in apoptosis resulting from different pathways, such as granzyme B-induced apoptosis (34), DNA damage and IRF-1-mediated apoptosis (4), and degradation of extracellular matrix-induced apoptosis in epithelial cells (35). ICE expression is also involved in Fas-mediated apoptosis in several cell systems (3, 36), including pancreatic ß-cells (37, 38). Constitutive expression of the caspases ICE, Cpp32, and Ich is required for TNF{alpha}-induced apoptosis in human fibroblast cell lines (39). In several cell systems, elevated cellular ICE expression, as induced either by ICE gene transfection (40) or by cytokines (41), leads to cell death by apoptosis.

The presence of IFN{gamma} is required for IL-1ß- or TNF{alpha}-induced apoptosis in human islets (2), and IFN{gamma} is the most important cytokine for the induction of ICE expression in these cells (present data). IFN{gamma} induces ICE expression in different cell types via activation of the transcription factors STAT-1 and IRF-1 (41, 42). We have previously shown that IFN{gamma} and (to a minor extent) IL-1ß induce IRF-1 expression in human islets and RIN cells (43), and existing evidence supports that these cytokines also induce STAT-1 activation and binding to the nucleus of rodent ß-cells (44). Thus, it is conceivable that the cytokines used in the present experiments increase ICE expression via activation of STAT-1 and IRF-1. To test this hypothesis, we used islets from wt and IRF-1-/- mice, and we observed that none of the cytokines tested induced ICE expression in the IRF-1-/- mice islets. On the other hand, IFN{gamma} alone, or in combination with the other cytokines, induced a severalfold increase in ICE expression in the islets isolated from wt mice. This confirms an essential role for IRF-1 in this process. In this context, it is of interest to note that IRF-1 has been suggested to play a key role in promoting inflammation and autoimmunity in type II collagen-induced arthritis and experimental allergic encephalomyelitis (45) and recently in a mouse model of the neurodegenerative disorder Huntington’s disease (46). ICE interacts with a network of several other pro- and antiapoptotic proteins, including the apoptosis-inhibiting protein bcl-2, the combined action of which determines whether the cell will eventually undergo apoptosis (reviewed in Refs. 38 and 47). Overexpression of bcl-2 in mouse pancreatic beta-cell lines and primary islets protected them against cytokine-mediated apoptosis (48, 49, 50).

Based on the present and previous data, the apoptosis observed in rat islets and RIN cells, after short-term incubation with IL-1ß alone or in combination with TNF{alpha} and IFN{gamma}, seems to be related to NO production (reviewed in Ref. 1). However, here we show that an NO-independent beta-cell destruction may also occur in RIN cells after IFN{gamma} exposure, a process associated with up-regulated ICE mRNA expression. As a whole, our data suggest that induced ICE expression may be an important effector mechanism involved in the NO-independent apoptosis reported in human islets after 6 days of cytokine exposure (2). Furthermore, our data support the view that cytokines may induce apoptosis or necrosis by several different interacting pathways, dependent on cytokine profile, concentration, exposure-time, islet-species, metabolic state, and degree of transformation. This view is supported by the recent demonstration that cytokine exposure may result in recovery, apoptosis, or necrosis in Jurkat cells, regulated by NO at two ATP-dependent steps (51). The degree of activation and level of interaction between these different pathways may be responsible for the reported differences in cytokine response among human, rat, and mouse islets and different beta-cell lines.

In conclusion, it is conceivable that ICE expression is critically involved in cytokine-induced NO-independent human islet cell apoptosis. ICE expression is induced in an IRF-1-dependent fashion, and it is, at least in part, inhibited by NO.


    Acknowledgments
 
The expert technical skills of Susanne Munch, Rikke Bonne, Erna Engholm Petersen, Ruth Leemans, Eveline Verheugen, and the technical staff providing rat and human islets is greatly appreciated. We are grateful to Dr. Chantal Mathieu, Laboratory for Experimental Medicine and Endocrinology, Katholieke Universiteit Leuven, for the maintenance and breeding of the IRF-1-/- mice in her Animal Care Facility. We are grateful to Prof. D. G. Pipeleers, Coordinator of the ß-Cell Transplant Program, for providing access to the human islet preparations and information on the cell composition, financially supported by a Shared Cost Action in Medical and Health Research of the European Community (BMH CT 95–1561).


    Footnotes
 
1 This work was supported by the Juvenile Diabetes Foundation International (1–1998-4), the Danish Diabetes Association, The Danish Research Council, Novo Nordisk A/S, and the Belgian Fonds voor Wetenschappelijk Onderzoek (3.0057.94), Flemish Scientific Research Foundation (FWO, G.0216.99), and by a Shared Cost Action in Medical and Health Research of the European Community (BMH4-CT98–3448). Back

Received August 26, 1998.

Revised July 13, 1999.

Accepted November 2, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Eizirik DL, Flodström M, Karlsen AE, Welsh N. 1996 The harmony of the spheres: inducible nitric oxide synthase and related genes in pancreatic beta cells. Diabetologia. 39:875–890.[Medline]
  2. Delaney CA, Pavlovic D, Hoorens A, Pipeleers DG, Eizirik DL. 1997 Cytokines induce deoxyribonucleic acid strand breaks and apoptosis in human pancreatic islet cells. Endocrinology. 138:2610–2614.[Abstract/Free Full Text]
  3. Hale A, Smith C, Sutherland L et al. 1996 Apoptosis: molecular regulation of cell death. Eur J Biochem. 236:1–26.[Medline]
  4. Tamura T, Ishihara M, Lamphier M, et al. 1995 An IRF-1 dependent pathway of DNA damage-induced apoptosis in mitogen-activated T lymphocytes. Nature. 376:596–599.[CrossRef][Medline]
  5. Horiuchi M, Yamada H, Akishita M, Ito M, Tamura K, Dzau VJ. 1999 Interferon regulatory factors regulate interleukin-1ß-converting enzyme expression and apoptosis in vascular smooth muscle cells. Hypertension. 33:162–166.[Abstract/Free Full Text]
  6. Keymeulen B, Ling Z, Gorus F, et al. 1998 Implantation of standardized beta-cell grafts in a liver segment of IDDM patients: graft and recipients characteristics in two cases of insulin-independence under maintenance immunosuppression for prior kidney graft. Diabetologia. 41:452–459.[CrossRef][Medline]
  7. Pavlovic D, Chen M, Bouwens M, Eizirik D, Pipelers D. 1999 Contribution of ductal cells to cytokine responses by human pancreatic islets. Diabetes. 48:29–33.[Abstract]
  8. Eizirik DL, Sandler S, Welsh N, et al. 1994 Cytokine suppress human islet function irrespective of their effects on nitric oxide generation. J Clin Invest. 93:1968–1974.
  9. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. 1982 Analysis of nitrate, nitrite and [12N]nitrate in biological fluids. Anal Biochem. 126:131–138.[CrossRef][Medline]
  10. Hoostens K, Pavlovic D, Zambre Y, et al. 1999 Exposure of human islets to cytokines can result in disproportionately elevated proinsulin release. J Clin Invest. 104.
  11. Brunstedt J, Nielsen JH, Lernmark Å, and The Hagedorn Study Group. 1984 Isolation of islets from mice and rats. In: Larner J, Pohl SL, eds. Methods in diabetes research, (laboratory methods, part C). Vol. 1. New York: Wiley & Sons; 254–288.
  12. Andersen HU, Mauricio D, Karlsen AE, Mandrup-Poulsen T, Nielsen JH, Nerup J. 1996 Interleukin-1ß-induced nitric oxide production from isolated rat islets is modulated by D-glucose and 3-isobutyl-1-methyl xanthine. Eur J Endocrinol. 134:251–259.[Abstract]
  13. Madsen OD, Karlsen C, Nielsen E, et al. 1993 The dissociation of a tumor-induced weight loss from hypoglycemia in a transplantable pluripotent rat islet tumor result in the segregation of stable {alpha}- and ß-cell tumor phenotypes. Endocrinology. 133:2022–2030.[Abstract]
  14. Karlsen AE, Fujimoto WY, Rabinovitch P, Dube S, Lernmark Å. 1991 Effects of sodium butyrate on proliferation-dependent insulin gene expression and insulin release in glucose-sensitive RIN-5AH cells. J Biol Chem. 266:7542–7548.[Abstract/Free Full Text]
  15. Nielsen K, Karlsen AE, Deckert M, et al. 1999 ß-cell maturation leads to in vitro sensitivity to cytokines. Diabetes. 48:2324–2332.[Abstract]
  16. Matsuyama T, Kimura.T, Kitagawa M, et al. 1993 Targeted disruption of IRF-1 or IRF-2 results in abnormal type-I IFN gene induction and aberrant lymphocyte development. Cell. 75:83–97.[CrossRef][Medline]
  17. Ling Z, Pipeleers D. 1994 Preservation of glucose-responsive islet beta-cells during serum-free culture. Endocrinology. 134:2614–2621.[Abstract]
  18. Mosmann T. 1983 Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assay. J Immunol Methods. 65:55–63.[CrossRef][Medline]
  19. Tiedge M, Lortz S, Munday R, Lenzen S. 1998 Complementary action of antioxidant enzymes in the protection of bioengineered insulin-producing RINm5F cells against the toxicity of reactive oxygen species. Diabetes. 47:1578–1585.[Abstract]
  20. Tiedge M, Lortz S, Munday R, Lenzen S. 1999 Protection against the co-operative toxicity of nitric oxide and oxygen free radicals by overexpression of antioxidant enzymes in bioengineered insulin-producing RINm5F cells. Diabetologia. 42:849–855.[CrossRef][Medline]
  21. Marshall NJ, Goodwin CJ, Holt SJ. 1995 A critical assessment of the use of microculture tetrazolium assay to measure cell growth and function. Growth Regul. 5:69–84.[Medline]
  22. Karlsen AE, Hagopian WA, Grubin CE, et al. 1991 Cloning and primary structure of a human islet isoform of glutamic acid decarboxylase from chromosome 10. Proc Natl Acad Sci USA. 88:8337–8341.[Abstract/Free Full Text]
  23. Wadt KAW, Larsen KM, Andersen HU, Nielsen K, Karlsen AE, Mandrup-Poulsen T. 1998 Ciliary neurotrophic factor potentiates the ß-cell inhibitory effect of IL-1ß in rat pancreatic islets associated with increased nitric oxide synthesis and increased expression of inducible nitric oxide synthase. Diabetes. 47:1602–1608.[Abstract]
  24. Jensen J, Serup P, Karlsen C, Nielsen TF, Madsen OD. 1996 mRNA profiling of rat islet tumors reveals Nkx 6.1 as a beta-cell specific homeodomain transcription factor. J Biol Chem. 271:18749–18758.[Abstract/Free Full Text]
  25. Cunningham JM, Green IC. 1994 Cytokines, nitric oxide and insulin-secreting cells. Growth Regul. 4:173–180.[Medline]
  26. Vassiliadis S, Dragiotis V, Protopapadakis E, et al. 1999 The destructive action of IL-1 alpha and IL-1 beta in IDDM is a multistage process: evidence and confirmation by apoptotic studies, induction of intermediates and electron microscopy. Mediators Inflamm. 8:85–91.[CrossRef][Medline]
  27. Madsen OD, Karlsen C, Serup P, et al. 1994 Studies of pluripotent islet tumour cell differentiation in relation to diabetes. In: Flatt PR, Lenzen S, eds. Insulin secretion and pancreatic B-cell research. London, UK: Smith-Gordon; 61–68.
  28. Karlsen AE, Nielsen K, Jensen J, et al. 1996 Cytokine induction of interleukin-1 converting enzyme (ICE), inducible nitric oxide synthase (iNOS) and apoptosis in beta-cells. Autoimmunity. 24:A24.
  29. Karlsen AE, Pavlovic D, Nielsen K, et al. 1998 Cytokine induced nitric oxide and interleukin-1 converting enzyme may represent different pathways of cytokine induced ß-cell destruction. Diabetologia. [Suppl 1] 41:A56.
  30. Ingelsson E, Saldeen J, Welsh N. 1998 Islet expression of perforin, Fas/Apo-1 and interleukin-1 converting enzyme (ICE) in non-obese diabetic (NOD) mice. Immunol Lett. 63:125–129.[CrossRef][Medline]
  31. Kim YM, Talanian RV, Li J, Billiar TR. 1998 Nitric oxide prevents IL-1ß and IFN-{gamma}-inducing factor (IL-18) release from macrophages by inhibiting caspase-1 (IL-1ß-converting enzyme). J Immunol. 161:4122–4128.[Abstract/Free Full Text]
  32. Dimmeler S, Haendeler J, Nehls M, Zeiher AM. 1997 Suppression of apoptosis by nitric oxide via inhibition of interleukin-1ß-converting enzyme (ICE)-like and cysteine protease proteins (CPP)-32-like proteases. J Exp Med. 185:601–607.[Abstract/Free Full Text]
  33. Li J, Billiar TR, Talanian RV, Kim YM. 1997 Nitric oxide reversibly inhibits seven members of the caspase family via S-nitrosylation. Biochem Biophys Res Commun. 240:419–424.[CrossRef][Medline]
  34. Shi L, Chen G, MacDonald G, et al. 1996 Activation of interleukin 1 converting enzyme-dependent apoptosis pathway by granzyme B. Proc Natl Acad Sci USA. 93:11002–11007.[Abstract/Free Full Text]
  35. Boudreau N, Sympson C, Werb Z, Bissel M. 1995 Suppression of ICE and apoptosis in mammary epithelial cells by extracellular matrix. Science. 267:891–893.[Abstract/Free Full Text]
  36. Los M, Van de Ceaen M, Penning LC, et al. 1995 Requirement of an ICE/CED-3 protease for Fas/Apo-1-mediated apoptosis. Nature. 375:81–83.[CrossRef][Medline]
  37. Chervonsky A, Wang Y, Wong F, et al. 1997 The role of Fas in autoimmune diabetes. Cell. 89:17–24.[CrossRef][Medline]
  38. Ohsako S, Elkon KB. 1999 Apoptosis in the effector phase of autoimmune diabetes, multiple sclerosis and thyroiditis. Cell Death Differ. 6:13–21.[CrossRef][Medline]
  39. Kumar A, Commane M, Flickinger T, Horvath C, Stark G. 1997 Defective TNF-{alpha}-induced apoptosis in STAT1-null cells due to low constitutive levels of caspases. Science. 278:1630–1632.[Abstract/Free Full Text]
  40. Miura M, Zhu H, Rotello R, Hartweig E, Yuan J. 1993 Induction og apoptosis in fibroblasts by IL-1ß-converting enzyme, a mammalian homolog of the C.elegans cell death gene ced-3. Cell. 75:653–660.[CrossRef][Medline]
  41. Chin Y, Kitawaga M, Kuida K, Flavell R, Fu X-Y. 1997 Activation of the STAT signaling pathway can cause expression of caspase 1 and apoptosis. Mol Cell Biol. 17:5328–5337.[Abstract]
  42. Wen Z, Zhong Z, Darnell J. 1995 Maximal activation of transcription by stat1 and stat3 requires both tyrosine and serine phosphorylation. Cell. 82:241–250.[CrossRef][Medline]
  43. Flodström M, Eizirik D. 1997 Interferon-{gamma}-induced interferon regulatory factor-1 (IRF-1) expression in rodent and human islet cells precedes nitric oxide production. Endocrinology. 138:2747–2753.[Abstract/Free Full Text]
  44. Darville M, Eizirik D. 1998 Regulation by cytokines of the inducible nitric oxide synthase promoter in insulin-producing cells. Diabetologia. 41:1101–1108.[CrossRef][Medline]
  45. Tada Y, Ho A, Matsuyama T, Mak TW. 1997 Reduced incidence and severity of antigen-induced autoimmune diseases in mice lacking interferon regulatory factor-1. J Exp Med. 2:231–238.
  46. Ona VO, Li M, Vonsattel JPG, et al. 1999 Inhibition of caspase-1 slows disease progression in a mouse model of Huntington’s disease. Nature. 399:263–267.[CrossRef][Medline]
  47. Wilson MR. 1998 Apoptotic signal transduction: emerging pathways. Biochem Cell Biol. 76:573–582.[CrossRef][Medline]
  48. Liu Y, Rabinovitch A, Suarez-Pinzon W, et al. 1996 Expression of the bcl-2 gene from a defective HSV-1 amplicon vector protects pancreatic ß-cells from apoptosis. Hum Gene Ther. 7:1719–1726.[Medline]
  49. Iwahashi H, Hanafusa T, Eguchi Y, et al. 1996 Cytokine-induced apoptotic cell death in a mouse pancreatic beta-cell line: inhibition by Bcl-2. Diabetologia. 39:530–536.[Medline]
  50. Rabinovitch A, Suarez-Pinzon W, Strynadka K, et al. 1999 Transfection of human pancreatic islets with an anti-apoptotic gene (bcl-2) protects beta-cells from cytokine-induced destruction. Diabetes. 48:1223–1229.[Abstract]
  51. Liest M, Single B, Naumann H, et al. 1999 Nitric oxide inhibits execution of apoptosis at two distinct ATP-dependent steps upstream and downstream of mitochondrial cytochrome c release. Biochem Biophys Res Commun. 258:215–221.[CrossRef][Medline]



This article has been cited by other articles:


Home page
J EndocrinolHome page
K. L A Souza, E. Gurgul-Convey, M. Elsner, and S. Lenzen
Interaction between pro-inflammatory and anti-inflammatory cytokines in insulin-producing cells
J. Endocrinol., April 1, 2008; 197(1): 139 - 150.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
M. Cnop, N. Welsh, J.-C. Jonas, A. Jorns, S. Lenzen, and D. L. Eizirik
Mechanisms of Pancreatic {beta}-Cell Death in Type 1 and Type 2 Diabetes: Many Differences, Few Similarities
Diabetes, December 1, 2005; 54(suppl_2): S97 - S107.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. A. Gysemans, L. Ladriere, H. Callewaert, J. Rasschaert, D. Flamez, D. E. Levy, P. Matthys, D. L. Eizirik, and C. Mathieu
Disruption of the {gamma}-Interferon Signaling Pathway at the Level of Signal Transducer and Activator of Transcription-1 Prevents Immune Destruction of {beta}-cells
Diabetes, August 1, 2005; 54(8): 2396 - 2403.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. Bergholdt, C. Taxvig, S. Eising, J. Nerup, and F. Pociot
CBLB variants in type 1 diabetes and their genetic interaction with CTLA4
J. Leukoc. Biol., April 1, 2005; 77(4): 579 - 585.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
T. Sparre, M. R. Larsen, P. E. Heding, A. E. Karlsen, O. N. Jensen, and F. Pociot
Unraveling the Pathogenesis of Type 1 Diabetes with Proteomics: Present And Future Directions
Mol. Cell. Proteomics, April 1, 2005; 4(4): 441 - 457.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Liu and S. I. Abrams
Coordinate Regulation of IFN Consensus Sequence-Binding Protein and Caspase-1 in the Sensitization of Human Colon Carcinoma Cells to Fas-Mediated Apoptosis by IFN-{gamma}
J. Immunol., June 15, 2003; 170(12): 6329 - 6337.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Jambal, S. Masterson, A. Nesterova, R. Bouchard, B. Bergman, J. C. Hutton, L. M. Boxer, J. E.-B. Reusch, and S. Pugazhenthi
Cytokine-mediated Down-regulation of the Transcription Factor cAMP-response Element-binding Protein in Pancreatic {beta}-Cells
J. Biol. Chem., June 13, 2003; 278(25): 23055 - 23065.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Steinbrenner, T.-B.-T. Nguyen, U. Wohlrab, W. A. Scherbaum, and J. Seissler
Effect of Proinflammatory Cytokines on Gene Expression of the Diabetes-Associated Autoantigen IA-2 in INS-1 Cells
Endocrinology, October 1, 2002; 143(10): 3839 - 3845.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Cottet, P. Dupraz, F. Hamburger, W. Dolci, M. Jaquet, and B. Thorens
cFLIP Protein Prevents Tumor Necrosis Factor-{alpha}-Mediated Induction of Caspase-8-Dependent Apoptosis in Insulin-Secreting {beta}Tc-Tet Cells
Diabetes, June 1, 2002; 51(6): 1805 - 1814.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Huo, R.-H. Luo, S. A. Metz, and G. Li
Activation of Caspase-2 Mediates the Apoptosis Induced by GTP-Depletion in Insulin-Secreting (HIT-T15) Cells
Endocrinology, May 1, 2002; 143(5): 1695 - 1704.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. E. Karlsen, S. G. Ronn, K. Lindberg, J. Johannesen, E. D. Galsgaard, F. Pociot, J. H. Nielsen, T. Mandrup-Poulsen, J. Nerup, and N. Billestrup
Suppressor of cytokine signaling 3 (SOCS-3) protects beta -cells against interleukin-1beta - and interferon-gamma -mediated toxicity
PNAS, September 26, 2001; (2001) 211445998.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Yoshikawa, Y. Nakajima, and K. Tasaka
IFN-{gamma} Induces the Apoptosis of WEHI 279 and Normal Pre-B Cell Lines by Expressing Direct Inhibitor of Apoptosis Protein Binding Protein with Low pI
J. Immunol., September 1, 2001; 167(5): 2487 - 2495.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Streetz, B. Fregien, J. Plumpe, K. Korber, S. Kubicka, G. Sass, S. C. Bischoff, M. P. Manns, G. Tiegs, and C. Trautwein
Dissection of the Intracellular Pathways in Hepatocytes Suggests a Role for Jun Kinase and IFN Regulatory Factor-1 in Con A-Induced Liver Failure
J. Immunol., July 1, 2001; 167(1): 514 - 523.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
A. K. Cardozo, M. Kruhøffer, R. Leeman, T. Ørntoft, and D. L. Eizirik
Identification of Novel Cytokine-Induced Genes in Pancreatic {beta}-Cells by High-Density Oligonucleotide Arrays
Diabetes, May 1, 2001; 50(5): 909 - 920.
[Abstract] [Full Text]


Home page
DiabetesHome page
P. M. Larsen, S.J. Fey, M.R. Larsen, A. Nawrocki, H.U. Andersen, H. Kähler, C. Heilmann, M.C. Voss, P. Roepstorff, F. Pociot, et al.
Proteome Analysis of Interleukin-1{beta}-Induced Changes in Protein Expression in Rat Islets of Langerhans
Diabetes, May 1, 2001; 50(5): 1056 - 1063.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
S. Goodbourn, L. Didcock, and R. E. Randall
Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures
J. Gen. Virol., October 1, 2000; 81(10): 2341 - 2364.
[Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. E. Karlsen, S. G. Ronn, K. Lindberg, J. Johannesen, E. D. Galsgaard, F. Pociot, J. H. Nielsen, T. Mandrup-Poulsen, J. Nerup, and N. Bill