help button home button Endocrine Society JCEM
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Segaloff, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Segaloff, D. L.
The Journal of Clinical Endocrinology & Metabolism Vol. 85, No. 12 4799-4805
Copyright © 2000 by The Endocrine Society


Original Studies

Gonadotropin-Independent Precocious Puberty Due to Luteinizing Hormone Receptor Mutations in Brazilian Boys: A Novel Constitutively Activating Mutation in the First Transmembrane Helix1

Ana Claudia Latronico2, Hiromitsu Shinozaki2, Gil Guerra Jr., Maria Adelaide A. Pereira, Sofia Helena V. Lemos Marini, Maria Tereza M. Baptista, Ivo Jorge P. Arnhold, Francesca Fanelli, Berenice B. Mendonca and Deborah L. Segaloff

Department of Physiology and Biophysics (H.S., D.L.S.), The University of Iowa College of Medicine, Iowa City, Iowa 52242; Pediatric Endocrinology Unit (G.G., S.H.V.L.M., M.T.M.B.), State University of Campinas, São Paulo, Brazil 6116111/13081-970; Department of Chemistry (F.F.), University of Modena and Reggio Emilia, 41100 Modena, Italy; and Developmental Endocrinology Unit (A.C.L., M.A.A.P., I.J.P.A., B.B.M.), Hospital das Clínicas, São Paulo University Medical School, São Paulo, 3611/01060-970, Brazil

Address correspondence and requests for reprints to: Ana Claudia Latronico, Hospital das Clínicas, Disciplina de Endocrinologia, Universidade de São Paulo, Caixa Postal: 3671, São Paulo, CEP 01060-970, Brazil. E-mail: anacl{at}usp.br


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Naturally occurring activating mutations in the human LH receptor (hLHR) gene are the cause of sporadic or familial male gonadotropin-independent precocious puberty. We have previously reported three different activating mutations of the hLHR gene in four unrelated Brazilian boys with male-limited precocious puberty. In the current study, we examined three other Brazilian boys, two brothers and one unrelated boy, with gonadotropin-independent precocious puberty. Direct sequencing of the entire exon 11 of the hLHR gene in the two brothers revealed a heterozygous substitution of T for C at nucleotide 1103, resulting in the substitution of leucine at position 368 by proline in the first transmembrane helix. Their mother carried the same mutation, establishing the familial nature of this mutation. Human embryonic 293 cells expressing hLHR(L368P) bound hCG with the same high affinity as cells expressing the wild-type hLHR. Cells expressing the novel L368P mutation displayed up to a 12-fold increase in basal cAMP production compared with cells expressing the same number of cell surface wild-type hLHR, indicating constitutive activation of the mutant receptor. In addition, the cAMP levels in cells expressing the hLHR mutant were further augmented by hCG. Molecular dynamics simulations suggest that substitution of L368 of the hLHR by proline results in lack of a salt bridge interaction between D405 and R464 (distance 9.0 Å vs. 4.7 Å in wild-type hLHR) as well as by the opening of a crevice between the second and third intracellular loops, which may allow G proteins greater accessibility. These structural features were shared by other activating mutants of the hLHR.

Sequencing of exon 11 of the hLHR gene of the unrelated boy revealed that he carried a homozygous nucleotide substitution causing an A568V mutation in the third cytoplasmic loop of the receptor. This mutation was previously found in two unrelated Brazilian boys, but in heterozygous state. Clinical and hormonal data of the patient with the homozygous A568V were not different from those individuals with the Ala568Val mutation in a heterozygous state. Furthermore, the phenotype caused by dominant activating mutations of the hLHR gene are not altered when both alleles carry a mutant sequence. Our studies show that the A568V is the most frequent cause of male-limited precocious puberty in Brazilian boys. Lastly, the identification of a novel activating L368P mutation in the first transmembrane helix of two Brazilian boys with familial male-limited precocious puberty provides further insights into the mechanism of activation of the hLHR.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FAMILIAL MALE-LIMITED PRECOCIOUS puberty, also known as testotoxicosis, is a dominant form of gonadotropin-independent precocious puberty caused by constitutively activating mutations of the human LH receptor (hLHR) (see Ref. 1 for a recent review). Affected males develop rapid virilization, growth acceleration, and skeletal advancement between 2–4 yr of age with elevated levels of testosterone, despite prepubertal levels of LH.

Most of the activating point mutations of the hLHR described thus far have been found in transmembrane helix (TM) VI (1, 2, 3). One of these mutations, D578G, has been the most frequent activating hLHR mutation identified in American boys, suggesting a founder effect for this mutation in the United States (2). Recently, a restricted repertoire of activating mutations of the hLHR gene was also demonstrated in boys originating from different parts of Europe (2). The two activating mutations most frequently identified in this study were M398T and I542L, which affect residues in the second and fifth TMs, respectively.

We have previously reported activating hLHR mutations in four unrelated Brazilian boys with familial or sporadic gonadotropin-independent precocious puberty (4, 5, 6). Two of them carried an A568V mutation in the third intracellular loop (i3), and one carried a T577I mutation in the TM VI (4, 5, 6). The fourth boy carried an unique activating L457R mutation in the third TM of the hLHR (6). In the current study, we examined three other Brazilian boys, two brothers and one unrelated boy, with familial male-limited precocious puberty. The unrelated boy exhibited the previously identified A568V activating mutation. However, whereas individuals with this and all other constitutively activating mutations of the hLHR have previously presented in a heterozygous state, this individual was homozygous for the A568V mutation. We also report the identification of a novel constitutively activating mutation of the hLHR that we identified in the two brothers. This novel L368P substitution in the first TM further increases the repertoire of activating mutations located outside of the sixth TM of the hLHR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

This study was approved by the Ethics Committee of the Division of Endocrinology of Hospital das Clínicas, São Paulo, Brazil. Informed consent was obtained from the parents.

Patients 1 and 2 were brothers who were clinically evaluated for signs of precocious puberty at the Pediatric Endocrinology Unit (State University of Campinas, São Paulo, Brazil). Patient 1 was first seen at 3 yr, 5 months of age. His height was 103 cm (1.2 SD), and his weight was 19 kg. Penile length was 10 cm, testicular volume was 6 cm3, and pubic hair was Tanner stage III. His bone age was 6 yr. At the time of diagnosis, his basal serum testosterone level was 8.6 nmol/L (193 ng/dL). Patient 2 was first seen at 2 yr, 5 months. His height was 93.4 cm (0.8 SD), and his weight was 17 kg. Penile length was 7 cm, testicular volume was 4 cm3 bilaterally, and pubic hair was Tanner II. His bone age was 4 yr, and his basal testosterone level was 10.7 nmol/L (240 ng/dL). Both patients exhibited prepubertal basal and GnRH-stimulated serum LH levels. Plasma concentrations of 17-hydroxyprogesterone, 11-deoxicortisol, dehydroepiandrosterone, and dehydroepiandrosterone sulfate were normal.

Patient 3 was first seen at 7 yr, 11 months of age at the Division of Endocrinology of Hospital das Clínicas in São Paulo. His mother noted frequent erections, penile growth, and enlargement of both testis at 4 yr of age. His height was 142.5 cm (2.8 SD), and his weight was 32 kg. Penile length was 10.5 cm, and testicular size was 3.0 x 2.0 cm (right) and 3.2 x 1.9 cm (left). Pubic hair was Tanner stage II. His bone age was 13 yr, 6 months. Testosterone levels were elevated (11.8 nmol/L or 265 ng/dL), and basal LH levels were prepubertal. A GnRH stimulation test revealed pubertal LH levels (LH peak, 13 U/L; normal prepubertal levels, <9.8 UI/L). The boy’s magnetic resonance imaging brain scan was normal. At this time, the diagnosis of idiopathic gonadotropin-dependent precocious puberty was considered, and the GnRH agonist (leuprolide, 3.75 mg/month) was prescribed. Despite the complete suppression of the gonadotropins with chronic GnRH agonist administration, his testosterone levels remained elevated [ranging from 30 nmol/L (675 ng/dL) to 53 nmol/L (1200 ng/dL)]. These findings suggested the diagnosis of testotoxicosis with secondary maturation of the hypothalamic-pituitary gonadal axis. His family history was negative for consanguinity. His father was not available for clinical examination or DNA analysis. According to the mother, he had short stature (height <155 cm). The family history of the mother was negative for early sexual maturation or short adult height.

DNA analysis

Genomic DNA was isolated from peripheral blood samples of the patients, as well as from both parents of the two brothers and the mother of the patient 3. The entire exon 11 of the hLHR gene was amplified by PCR. Amplification was performed for 30 cycles in a Gene Amp PCR system (2400; Perkin-Elmer Corp., Norwalk, CT) using the following pairs of intronic primers: 5' GAAAATCCCTTACCTCAAGCC 3' and 5' GCAGTTACTGATGTAACAGTTAACAC 3'. The PCR products were pretreated with an enzymatic combination of shrimp alkaline phosphatase and exonuclease I (United States Biochemical Corp., Cleveland, OH) and directly sequenced using sequenced using the BigDye terminator cycle sequencing ready reaction kit (PE Applied Biosystems, Foster City, CA) in an ABI PRISM 310 automatic sequencer (Perkin-Elmer Corp.).

Mutagenesis and transfections

The template for mutagenesis was the hLHR complementary DNA (cDNA), kindly donated by Ares Advanced Technology (Ares-Serono Group, Randolph, MA). After subcloning the cDNA into pcDNA3.1/neo, a T to C substitution of hLHR nucleotide 1103 was accomplished by mutagenesis using the PCR overlap extension method (7, 8). The entire region amplified by PCR, as well as the sites of ligation, were sequenced to ensure the fidelity of the mutant cDNA. DNA sequencing was performed by automated sequencing within the DNA Core of the Diabetes and Endocrinology Research Center of the University of Iowa.

Human embryonic 293 cells were obtained from the American Type Tissue Collection (Manassas, VA) (CRL 1573) and were maintained at 5% CO2 in a culture medium consisting of DMEM containing 50 µg/mL gentamicin, 10 mM HEPES, and 10% newborn calf serum. Cells were transfected at a 60–80% confluence using the transient transfection procedure of Chen and Okayama (9), except that the overnight precipitation was performed in a 5% rather than 2.5% CO2 atmosphere. After 18–20 h the cells were washed with Waymouth’s MB752/1 media modified with 50 µg/mL gentamicin and 1 mg/mL BSA, and then fresh growth medium was added. The cells were used for experiments 24 h later.

125I-hCG binding to intact cells

Human embryonic 293 cells were plated onto gelatin-coated 35-mm wells and transiently transfected as described above. On the day of the experiment, cells were washed two times with warm Waymouth’s MB752/1 containing 50 µg/mL gentamicin and 1 mg/mL BSA. To determine the maximal binding capacity, the cells were then incubated 1 h at 37 C in the same media containing a saturating concentration of 125I-hCG (500 ng/mL final concentration) with or without an excess of unlabeled hCG (50 IU/mL final concentration). To determine the binding affinity, the cells were incubated with increasing concentrations of 125I-hCG in the presence or absence of unlabeled hCG. The assay was finished by washing the cells three times with cold HBSS modified to contain 50 µg/mL gentamicin and 1 mg/mL BSA. The cells were then solubilized in 100 µL 0.5N NaOH and transferred to plastic test tubes with cotton swabs. Apparent binding affinities were determined as the concentrations of 125I-hCG yielding half-maximal binding as calculated by the DeltaGraph software Deltapoint (Monterey, CA) when the data were fit to a sigmoidal equation (10).

Measurement of cAMP production

In the same experiment, 293 cells were assayed both for maximal 125I-hCG binding to intact cells as well as for intracellular cAMP production under basal and hCG-stimulated conditions. Therefore, for any given experiment in which cAMP was determined, the levels of cell surface expression of receptor were also determined. Only those experiments in which the cells expressed comparable numbers of wild-type vs. mutant receptors were used for data analyses. The 293 cells were plated on gelatin-coated 35-mm wells and transfected as described above. On the day of the experiment, cells were washed twice with warm Waymouth MB752/1 media containing 50 µg/mL gentamicin and 1 mg/mL BSA and placed in 1 mL of the same medium containing 0.5 mM isobutylmethylxanthine. After 15 min at 37 C, buffer only or hCG was added. For determining the maximal hCG-stimulated cAMP, a saturating concentration of hCG was added (500 ng/mL). For complete dose-response curves, increasing concentrations of hCG were added. The incubation was then continued for 60 min at 37 C. The cells were then placed on ice, the media were aspirated, and intracellular cAMP was extracted by the addition of 0.5N perchloric acid containing 180 µg/mL theophylline and then measured by RIA. All determinations were performed either in duplicate or triplicate. The dose-response curves were analyzed using the computer software DeltaGraph to calculate the Rmax and EC50 for each curve.

Molecular modeling of the hLHR(L368P) mutant

The initial structure of the hLHR(L368P) mutant was obtained by replacing the target amino acid in the wild-type hLHR input structure previously built (11). Energy minimization and molecular dynamics simulations of the mutant were performed using the program CHARMm (Molecular Simulations Inc., Waltham, MA), following the computational protocol described previously (11).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sequencing of the hLHR gene

Direct sequencing of exon 11 of the hLHR gene in the two brothers (patients 1 and 2) revealed a heterozygous substitution of T for C at nucleotide 1103 that converts Leu-368 (CTG) to proline (CCG) in helix I of the hLHR. Their mother carried the same mutation. A silent polymorphism was also identified at codon D355 in both brothers. One boy was heterozygous and the other was homozygous for this nucleotide substitution.

In patient 3, direct sequencing of exon 11 of the hLHR gene revealed a homozygous substitution of C for T at nucleotide 1703, which converts Ala-568 (GCT) to valine (GTT) in the third intracellular loop (i3) of the hLHR. This mutation was also identified in his mother in a heterozygous state.

Functional studies of the L368P mutation

The A568V mutation identified in patient 3 is a mutation previously shown to cause constitutive activation of the hLHR. Therefore, no further characterization of this mutant was performed. However, the L368P substitution identified in patients 1 and 2 represent a previously uncharacterized hLHR mutation. Therefore, the following studies were performed to study the functional properties of the hLHR resulting from a substitution of Leu-368 with proline.

Human embryonic 293 cells were transiently transfected with cDNAs encoding either the wild-type hLHR or hLHR(L368P). Cells expressing hLHR(L368P) bound hCG with the same high affinity as cells expressing the wild-type hLHR (Kd, 1.12 ± 0.23 and 1.39 ± 0.22 nM, respectively). Subsequent experiments were performed to assess the cAMP produced by these cells under both basal conditions and hCG-stimulated conditions. As shown in Table 1Go, the basal levels of cAMP produced by cells expressing hLHR(L368P) were significantly (11- to 12-fold) higher than the cAMP levels produced by cells expressing comparable levels of wild-type hLHR. The cAMP levels in cells expressing hLHR(L368P) were further augmented by the addition of hCG (Table 2Go and Fig. 1Go). However, the maximal hCG-stimulated cAMP response in hLHR(L368P) cells was not as great as that in hLHR(wt) cells.


View this table:
[in this window]
[in a new window]
 
Table 1. Basal and hCG-stimulated cAMP in cells expressing hLHR(wt) vs. hLHR(L368P)

 

View this table:
[in this window]
[in a new window]
 
Table 2. Constitutively activating mutations of the LHR in Brazilian boys with gonadotropin-independent precocious puberty

 


View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. cAMP dose responses in cells expressing hLHR(wt) vs. hLHR(L368P). The 293 cells were transiently transfected with either hLHR(wt) or hLHR(L368P) cDNAs to generate cells expressing comparable amounts of cell surface receptors. On the day of the experiment, 125I-hCG binding was performed on intact cells, and intracellular cAMP was assayed under both basal conditions and in the presence of increasing concentrations of hCG as described in Materials and Methods. Data are expressed as the cAMP levels relative to the basal cAMP of cells expressing hLHR(wt) and are shown as the mean ± range of two independent experiments. In Exp 1, wt cells bound 11.1 and L368 cells bound 9.2 ng 125I-hCG/106 cells. In Exp 2, wt cells bound 9.6 and L368P cells bound 8.6 ng 125I-hCG/106 cells.

 
Molecular modeling of the hLHR (L368P) mutant

To better understand the molecular basis for the constitutive activation of the hLHR(L368P) mutant, molecular dynamics simulations of the mutant were performed. The results were compared with those previously described for the wild-type hLHR, an inactivating hLHR mutant S616Y, and another constitutively active mutant, M398T, which is representative of the 13 active hLHR mutants previously modeled (11). The average minimized structures of the wild-type hLHR (ground state) and of the S616Y inactive mutant are characterized by the presence of several constraining interactions that include a salt bridge between the conserved D405 (H2:10, the first character and the first digit indicate the helix, whereas the last two digits indicate the position of the residue in the helix) and R464 (H3:25) of the E/DRY sequence (Fig. 2Go). The average distance between the {alpha}-carbon atom of D405 and the {zeta}-carbon atom of R464 is 4.7 Å (for the wild-type hLHR) and 4.0 Å (for the S616Y mutant). Other constraining interactions unique to the wild-type and inactive hLHR forms occur between the second and third intracellular loops (i2 and i3). The consequent arrangement of these two loops as well as the cytosolic extensions of helices V and VI results in the shielding from the cytosol of the side chain of W465 (H3:26), the residue in the hLHR that substitutes for the tyrosine of the highly conserved E/DRY sequence. Like the other constitutively active hLHR mutants, the average structures of which have been deduced by molecular dynamics simulations (11), the constitutively active M398T mutant is characterized by the breakage of the salt bridge interaction found in the wild-type hLHR and the S616Y inactive mutant between D405 and R464 (D405-R464 distance in M398T = 9.6 Å). Also, there is an increase in the distance between i2 and i3 that results in the opening of a cytosolic crevice formed by i2, i3, and the cytosolic extensions of helices III, V, and VI (Fig. 2Go). It was previously shown that an increase in the solvent accessible surface of W465 (SASW465) properly describes the formation of this crevice (11). Thus, the (SASW465) of the M398T mutant is larger (91.0 Å2) as compared with that of the wild-type hLHR (6.0 Å2) and of the S616Y inactive mutant (0.0 Å2).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 2. Molecular dynamics simulations of the structure of hLHR(L368P) predict conformational changes common to activating mutations of the hLHR. Shown are the average minimized structures of the wild-type hLHR (top left), the S616Y inactive mutant (top right), the constitutively active M398T mutant (bottom left), and the novel constitutively active L368P mutant (bottom right). Cartoons of the receptor structures seen in a direction parallel to the membrane surface are shown. The solvent accessible surfaces of the first and second intracellular loops (i2 and i3, respectively) as well as of the cytosolic extensions of helices III, V, and VI, are also represented by dots. The values of the solvent accessible surface of W465 (SASW465, Å2) are also reported in this figure. The intracellular side is at the top of the seven-helix bundle. Helices I, II, III, IV, V, VI, and VII are blue, orange, green, pink, yellow, sky blue, and violet, respectively. The first, second, and third intracellular loops are light green, white, and cyclamen, respectively, whereas the three extracellular loops are carnation. Details of the interactions involving some of the conserved polar amino acids (colored according to their location) in the environment of R464 are also shown. Dashed lines indicate the distances (Å) between D405 and R464 as well as between E463 and R464 (only for the S616Y inactive mutant).

 
Interestingly, the average minimized structure of the hLHR(L368P) (H1:10) mutant shares the same structural properties as the M398T constitutively active mutant (and, therefore, other hLHR constitutively active mutants examined thus far by similar modeling). Thus, it is characterized by the absence of the salt bridge interaction between D405 and R464 (D405-R464 distance of L368P = 9.0 Å) as well as by the opening of a crevice between i2 and i3 (SASW465 of L368P = 91.0 Å2), which allows the solvent exposure of the cytosolic extensions of helices III and VI (Fig. 2Go).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Naturally occurring activating mutations in the hLHR gene are the cause of the sporadic and familial male limited precocious puberty (1). To date, 13 activating mutations of the LHR have been reported in more than 60 patients with precocious puberty (2, 5, 6, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21). The autonomous Leydig cell activity of these patients is generally caused by heterozygous mutations located in the sixth TM or third intracellular loop of the hLHR. In this study, we examined the entire nucleotide sequence of exon 11 of the hLHR gene in three Brazilian boys. In two related boys a heterozygous mutation was found causing substitution of the leucine at codon 368 with proline in the first transmembrane helix of the hLHR. Cells expressing this novel mutation displayed ~12-fold increase in basal cAMP levels compared with cells expressing similar numbers of cell surface wild-type hLHR, indicating constitutive activation of the hLHR by the L368P substitution. A silent polymorphism was also found in this family at codon 355 of the hLHR.

The particular Leu-368 residue found to be mutated in this study is conserved in the LHR sequences among human, bovine, porcine, rat, and mouse, but is not found in the related TSH and FSH receptors (22). Instead, the TSH and FSH receptors exhibit the amino acid phenylalanine at the homologous position. Although, a large number of somatic and/or germ line-activating mutations in the TSH receptor leading to toxic thyroid adenomas and multinodular goiter have been identified (23), no constitutive activating mutations in the first transmembrane helix in the human TSH receptor have been described.

Interestingly, only one other activating mutation of the hLHR in the first TM has been described. This mutation, a substitution of nucleotide 1126 of the hLHR gene, which resulted in a change of the highly conserved amino acid 373 from alanine to valine in TM I, was previously reported in a German boy with sporadic male precocious puberty (14). Transiently transfected COS cells expressing this mutated receptor displayed ~7 fold increase in basal cAMP production compared with cells expressing the wild-type hLHR. These two activating mutations within the first TM (L368P and A373V) reflect substitutions of residues that are located very close to each other in terms of the hLHR linear amino acid sequence. However, based on projections of the TMs as well as on three dimensional models of the hLHR (11, 24, 25), Ala-373 is predicted to face toward helix VII, close to the proline of the functionally important NPXXY motif in helix VII. On the other hand, Leu-368 is predicted to face the outer face of helix I that is contact with the lipid bilayer.

The revised ternary model for G protein-coupled receptor activation predicts an equilibrium of a G protein-coupled receptor between an inactive ground state and an active state. Agonists bind with higher affinity to the active receptor state, thereby shifting the equilibrium toward that state. Increasing evidence, though, suggests that multiple states of intermediate activation probably also exist. Constitutively activating mutations are thought to stabilize an active state of the receptor, thereby increasing the equilibrium toward that conformation (see Ref. 26 for a recent review). Recently, Fanelli (11) characterized the active and inactive states of the hLHR by molecular dynamics simulations. This was accomplished by comparing the average minimized structures of the wild-type hLHR with all 13 naturally occurring activating and 3 inactivating hLHR mutants identified by the time of the study. The comparative analyses suggested that the constitutively active hLHR forms share the common properties of a lack of a salt bridge interaction between D405 and the arginine of the highly conserved E/DRY motif (R464), as well as the opening of a cytosolic site formed by i2, i3, and the cytosolic extensions of helices III, V, and VI. Interestingly, the analyses of the mutant structures led to the definition of very simple molecular descriptors [i.e. the D405-R464 distance and the solvent accessible surface of W465 (SASW465))], which codify the essential features differentiating the active from the inactive hLHR forms. Thus, it was found that values of the SASW465 above or below 30.0 Å2 were found to be associated with the presence or the absence, respectively, of a solvent accessible crevice in between i2 and i3. The presence of such a crevice may allow G proteins greater accessibility to the regions of the receptor necessary for G protein recognition. It was further found that the wild-type and the inactive hLHR mutants are characterized by D405-R464 distances less than 4.7 Å and SASW465 values below 11.0 Å2, whereas the constitutively active mutants are mainly characterized by D405-R464 distances greater than 7.7 Å and SASW465 values above 32.0 Å2.

In the present study, this analysis has now been used to investigate the structural features of the novel constitutively active mutant hLHR(L368P). The substitution of Leu-368 with proline was found to cause an increase in the degrees of freedom of helix I due to the lack of the intrahelical hydrogen bond between the carbonyl oxygen atom of Leu-365 and the nitrogen atom of Pro-368. In the model, Leu-368 is predicted to lie at the same level (with respect to the plasma membrane surface) as Pro-584 (H6:22) and Pro-613 (H7:11), creating a line of prolines in three adjacent helices. The latter two prolines may, therefore, contribute to the transfer of the structural perturbation from the L368P mutation in helix I to the other helices. Consistent with the results of molecular dynamics simulations on the other hLHR activating mutants (11), the substitution of a proline for Leu-368 is predicted to cause a clockwise rotation of helix VI as seen from the intracellular side and movements of helices IV, V, and VI relative to helix III. The arrangement of helix V is the most affected compared with the wild-type receptor. The end result of these perturbations is that, similar to other constitutively active mutants of the hLHR (11), there is an increased distance between D405 and R464 and an increased solvent accessibility of W465. Therefore, the comparative analyses of hLHR(L368P) with other constitutively active hLHR mutant structures support the idea that, in spite of the seemingly disparate nature of these mutations, the predicted conformations of the active states share some remarkably similar structural properties.

In this study, we also report the identification of another Brazilian boy with familial precocious puberty with the previously described A568V mutation in i3 of the hLHR (5, 6). This mutation was surprisingly found in a homozygous state in this boy. To our knowledge, this is the first report of an individual exhibiting an activating mutation of the hLHR in a homozygous state. However, clinical and hormonal data of this patient were not different from those previously reported boys with a heterozygous A568V mutation. The boy with the homozygous A568V mutation exhibited an accelerated bone age (13 yr) and secondary central precocious puberty at first presentation, requiring combined treatment with GnRH agonist and cyproterone acetate. These findings indicated that the activation of the hypothalamic-pituitary gonadal axis was preserved in this patient. The homozygous state of this boy indicated that both parents were carriers of the A568V mutation. Although, his father was not available for clinical examination and DNA analysis, his short stature suggests that he is also affected.

Interestingly, two other Brazilian boys of African descent have the A568V mutation (5, 6). Despite the limited number of cases with gonadotropin-independent precocious puberty examined in Brazil for LHR mutations so far (seven boys from six families), it is noteworthy that 50% of the families have the A568V mutation. Three of the four activating mutations in the hLHR in Brazilian boys with gonadotropin-independent precocious puberty were exclusively found in Brazil. These are the A568V, L457R, and the novel L368P mutations (Table 2Go). Two comprehensive American and European studies of 32 and 17 families with gonadotropin independent precocious puberty, respectively, did not report these mutations. The most recent European study identified seven different mutations, all of them previously reported, suggesting a limited repertoire of LHR mutations in this population (2, 3). The distinct Brazilian population origin, which has a high degree of miscegenation among Africans, Latin Europeans, and Native Brazilians, could explain the great percentage of new mutations identified even in a small series.

In conclusion, our studies thus far indicate that the A568V mutation is the most frequent cause of familial male-limited precocious puberty mutations in Brazilian boys. The phenotype, caused by dominant activating mutations of the hLHR gene, are not altered when both alleles carry a mutant sequence. In addition, a novel L368P mutation at the first TM of the hLHR is also a cause of familial precocious puberty in Brazilian boys, providing further insights into the mechanism of activation of the hLHR.


    Acknowledgments
 
We thank Dr. Catarina Brasil d’Alva Rocha, who assisted in the clinical review of patient 2. The services and facilities of the University of Diabetes and Endocrinology Research Center (supported by NIH Grant DK25295) are also acknowledged.


    Footnotes
 
1 Supported in part by FAPESP Grants 96/02020-1, 96/02040-2, and 97/1196-1; CNPq Grants 300151/96-9 (to A.C.L.) and 301246/95-5 (to B.B.M.); and NIH Grant HD22196 (to D.L.S.). Back

2 These authors contributed equally to this work. Back

Received May 22, 2000.

Revised August 15, 2000.

Accepted September 2, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Latronico A, Segaloff D. 1999 Naturally occurring mutations of the luteinizing-hormone receptor: lessons learned about reproductive physiology and G protein-coupled receptors. Am J Hum Genet. 65:949–958.[CrossRef][Medline]
  2. Laue L, Chan W-C, Hsueh A, et al. 1995 Genetic heterogeneity of constitutively activating mutations of the human luteinizing hormone receptor in familial male-limited precocious puberty. Proc Natl Acad Sci USA. 92:1906–1910.[Abstract/Free Full Text]
  3. Kremer H, Martens JW, van Reen M, et al. 1999 A limited repertoire of mutations of the luteinizing hormone (LH) receptor gene in familial and sporadic patients with male LH-independent precocious puberty. J Clin Endocrinol Metab. 84:1136–1140.[Abstract/Free Full Text]
  4. Latronico AC, Brito VN, Lins TSS, Arnhold IJP, Mendonca BB. 2000 Effects of three distinct activating mutations of the luteinizing hormone receptor gene on the pituitary gonadal axis in both sexes. Clin Endocrinol (Oxf.). In press.
  5. Latronico AC, Anasti J, Arnhold IJP, et al. 1995 A novel mutation of the luteinizing hormone receptor gene causing male gonadotropin-independent precocious puberty. J Clin Endocrin Metab. 80:2490–2494.[Abstract]
  6. Latronico AC, Abell AN, Arnhold IJP, et al. 1998 A unique constitutively activating mutation in the third transmembrane helix of the luteinizing hormone receptor causes sporadic male gonadotropin independent precocious puberty. J Clin Endocrinol Metab. 83:2435–2440.[Abstract/Free Full Text]
  7. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989 Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene. 77:51–59.[CrossRef][Medline]
  8. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR. 1989 Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77:61–68.[CrossRef][Medline]
  9. Chen C, Okayama H. 1987 High-efficiency transformation of mammalian cells by plasmid DNA. Mol Cell Biol. 7:2745–2752.[Abstract/Free Full Text]
  10. De Lean A, Munson PJ, Rodbard D. 1978 Simultaneous analysis of families of sigmoidal curves: application to bioassay, radioligand assay and physiological dose-response curves. Am J Physiol. 235:E97–E102.
  11. Fanelli F. 2000 Theoretical study on mutation-induced activation of the luteinizing hormone receptor. J Mol Biol. 296:1333–1351.[CrossRef][Medline]
  12. Shenker A, Laue L, Kosugi S, Merendino Jr JJ, Minegishi T, Cutler Jr GB. 1993 A constitutively activating mutation of the luteinizing hormone receptor in familial male precocious puberty. Nature. 365:652–654.[CrossRef][Medline]
  13. Kraaij R, Post M, Kremer H, et al. 1995 A missense mutation in the second transmembrane segment of the luteinizing hormone receptor causes familiar male precocious puberty. J Clin Endocrinol Metab. 80:3168–3172.[Abstract]
  14. Gromoll J, Partsch C-J, Simoni M, et al. 1998 A mutation in the first transmembrane domain of the lutropin receptor causes male precocious puberty. J Clin Endocrinol Metab. 83:476–480.[Abstract/Free Full Text]
  15. Kosugi S, Van Dop C, Geffner ME, et al. 1995 Characterization of heterogeneous mutations causing constitutive activation of the luteinizing hormone receptor in familial male precocious puberty. Hum Mol Genet. 4:183–188.[Abstract/Free Full Text]
  16. Kremer H, Mariman E, Otten BJ, et al. 1993 Cosegregation of missense mutations of the luteinizing hormone receptor gene with familial male-limited precocious puberty. Hum Mol Genet. 2:1779–1783.[Abstract/Free Full Text]
  17. Yano K, Hidaka A, Saji M, et al. 1994 A sporadic case of male-limited precocious puberty has the same consitutively activating point mutation in luteinizing hormone/choriogonadotropin receptor gene as familial cases. J Clin Endocrinol Metab. 79:1818–1823.[Abstract]
  18. Yano K, Kohn LD, Saji M, Kataoka N, Okuno A, Cutler Jr GB. 1996 A case of male-limited precocious puberty caused by a point mutation in the second transmembrane domain of the luteinizing hormone choriogonadotropin receptor gene. Biochem Biophys Res Commun. 220:1036–1042.[CrossRef][Medline]
  19. Evans BAJ, Bowen DJ, Smith PJ, Clayton PE, Gregory JW. 1996 A new point mutation in the luteinising hormone receptor gene in familial and sporadic male limited precocious puberty: genotype does not always correlate with phenotype. J Med Genet. 33:143–147.[Abstract/Free Full Text]
  20. Kawate N, Kletter GB, Wilson BE, Netzloff ML, Menon KMJ. 1995 Identification of constitutively activating mutation of the luteinising hormone receptor in a family with male limited gonadotrophin independent precocious puberty (testotoxicosis). J Med Genet. 32:553–554.[Abstract/Free Full Text]
  21. Rosenthal IM, Refetoff S, Rich B, et al. 1996 Response to challenge with gonadotropin-releasing hormone agonist in a mother and her two sons with a constitutively activating mutation of the luteinizing hormone receptor-A clinical research center study. J Clin Endocrinol Metab. 81:3802–3806.[Abstract]
  22. Minegishi T, Nakamura K, Takakura Y, et al. 1990 Cloning and sequencing of human LH/hCG receptor cDNA. Biochem Biophys Res Commun. 172:1049–1054.[CrossRef][Medline]
  23. Paschke R, Ludgate M. 1997 The thyrotropin receptor in thyroid diseases. N Engl J Med. 337:1675–1681.[Free Full Text]
  24. Martens JWM, Verhoef-Post M, Abelin N, et al. 1998 A homozygous mutation of the luteinizing hormone receptor causes partial Leydig cell hypoplasia: correlation between receptor activity and phenotype. Mol Endocrinol. 12:775–784.[Abstract/Free Full Text]
  25. Lin Z, Shenker A, Pearlstein R. 1997 A model of the lutropin/choriogonadotropin receptor: insights into the structure and functional aspects of constitutively activating mutations. Prot Eng. 10:501–510.[Abstract/Free Full Text]
  26. Gether U. 2000 Uncovering molecular mechanisms involved in activation of G protein- coupled receptors. Endocr Rev. 21:90–113.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
ReproductionHome page
A. P N Themmen
An update of the pathophysiology of human gonadotrophin subunit and receptor gene mutations and polymorphisms
Reproduction, September 1, 2005; 130(3): 263 - 274.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zhang, D. Mizrachi, F. Fanelli, and D. L. Segaloff
The Formation of a Salt Bridge Between Helices 3 and 6 Is Responsible for the Constitutive Activity and Lack of Hormone Responsiveness of the Naturally Occurring L457R Mutation of the Human Lutropin Receptor
J. Biol. Chem., July 15, 2005; 280(28): 26169 - 26176.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Fanelli, M. Verhoef-Post, M. Timmerman, A. Zeilemaker, J. W. M. Martens, and A. P. N. Themmen
Insight into Mutation-Induced Activation of the Luteinizing Hormone Receptor: Molecular Simulations Predict the Functional Behavior of Engineered Mutants at M398
Mol. Endocrinol., June 1, 2004; 18(6): 1499 - 1508.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
H. Shinozaki, F. Fanelli, X. Liu, J. Jaquette, K. Nakamura, and D. L. Segaloff
Pleiotropic Effects of Substitutions of a Highly Conserved Leucine in Transmembrane Helix III of the Human Lutropin/Choriogonadotropin Receptor with Respect to Constitutive Activation and Hormone Responsiveness
Mol. Endocrinol., June 1, 2001; 15(6): 972 - 984.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Segaloff, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latronico, A. C.
Right arrow Articles by Segaloff, D. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals