| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Original Studies |
Department of Physiology and Biophysics (H.S., D.L.S.), The University of Iowa College of Medicine, Iowa City, Iowa 52242; Pediatric Endocrinology Unit (G.G., S.H.V.L.M., M.T.M.B.), State University of Campinas, São Paulo, Brazil 6116111/13081-970; Department of Chemistry (F.F.), University of Modena and Reggio Emilia, 41100 Modena, Italy; and Developmental Endocrinology Unit (A.C.L., M.A.A.P., I.J.P.A., B.B.M.), Hospital das Clínicas, São Paulo University Medical School, São Paulo, 3611/01060-970, Brazil
Address correspondence and requests for reprints to: Ana Claudia Latronico, Hospital das Clínicas, Disciplina de Endocrinologia, Universidade de São Paulo, Caixa Postal: 3671, São Paulo, CEP 01060-970, Brazil. E-mail: anacl{at}usp.br
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Sequencing of exon 11 of the hLHR gene of the unrelated boy revealed that he carried a homozygous nucleotide substitution causing an A568V mutation in the third cytoplasmic loop of the receptor. This mutation was previously found in two unrelated Brazilian boys, but in heterozygous state. Clinical and hormonal data of the patient with the homozygous A568V were not different from those individuals with the Ala568Val mutation in a heterozygous state. Furthermore, the phenotype caused by dominant activating mutations of the hLHR gene are not altered when both alleles carry a mutant sequence. Our studies show that the A568V is the most frequent cause of male-limited precocious puberty in Brazilian boys. Lastly, the identification of a novel activating L368P mutation in the first transmembrane helix of two Brazilian boys with familial male-limited precocious puberty provides further insights into the mechanism of activation of the hLHR.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Most of the activating point mutations of the hLHR described thus far have been found in transmembrane helix (TM) VI (1, 2, 3). One of these mutations, D578G, has been the most frequent activating hLHR mutation identified in American boys, suggesting a founder effect for this mutation in the United States (2). Recently, a restricted repertoire of activating mutations of the hLHR gene was also demonstrated in boys originating from different parts of Europe (2). The two activating mutations most frequently identified in this study were M398T and I542L, which affect residues in the second and fifth TMs, respectively.
We have previously reported activating hLHR mutations in four unrelated Brazilian boys with familial or sporadic gonadotropin-independent precocious puberty (4, 5, 6). Two of them carried an A568V mutation in the third intracellular loop (i3), and one carried a T577I mutation in the TM VI (4, 5, 6). The fourth boy carried an unique activating L457R mutation in the third TM of the hLHR (6). In the current study, we examined three other Brazilian boys, two brothers and one unrelated boy, with familial male-limited precocious puberty. The unrelated boy exhibited the previously identified A568V activating mutation. However, whereas individuals with this and all other constitutively activating mutations of the hLHR have previously presented in a heterozygous state, this individual was homozygous for the A568V mutation. We also report the identification of a novel constitutively activating mutation of the hLHR that we identified in the two brothers. This novel L368P substitution in the first TM further increases the repertoire of activating mutations located outside of the sixth TM of the hLHR.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This study was approved by the Ethics Committee of the Division of Endocrinology of Hospital das Clínicas, São Paulo, Brazil. Informed consent was obtained from the parents.
Patients 1 and 2 were brothers who were clinically evaluated for signs of precocious puberty at the Pediatric Endocrinology Unit (State University of Campinas, São Paulo, Brazil). Patient 1 was first seen at 3 yr, 5 months of age. His height was 103 cm (1.2 SD), and his weight was 19 kg. Penile length was 10 cm, testicular volume was 6 cm3, and pubic hair was Tanner stage III. His bone age was 6 yr. At the time of diagnosis, his basal serum testosterone level was 8.6 nmol/L (193 ng/dL). Patient 2 was first seen at 2 yr, 5 months. His height was 93.4 cm (0.8 SD), and his weight was 17 kg. Penile length was 7 cm, testicular volume was 4 cm3 bilaterally, and pubic hair was Tanner II. His bone age was 4 yr, and his basal testosterone level was 10.7 nmol/L (240 ng/dL). Both patients exhibited prepubertal basal and GnRH-stimulated serum LH levels. Plasma concentrations of 17-hydroxyprogesterone, 11-deoxicortisol, dehydroepiandrosterone, and dehydroepiandrosterone sulfate were normal.
Patient 3 was first seen at 7 yr, 11 months of age at the Division of Endocrinology of Hospital das Clínicas in São Paulo. His mother noted frequent erections, penile growth, and enlargement of both testis at 4 yr of age. His height was 142.5 cm (2.8 SD), and his weight was 32 kg. Penile length was 10.5 cm, and testicular size was 3.0 x 2.0 cm (right) and 3.2 x 1.9 cm (left). Pubic hair was Tanner stage II. His bone age was 13 yr, 6 months. Testosterone levels were elevated (11.8 nmol/L or 265 ng/dL), and basal LH levels were prepubertal. A GnRH stimulation test revealed pubertal LH levels (LH peak, 13 U/L; normal prepubertal levels, <9.8 UI/L). The boy’s magnetic resonance imaging brain scan was normal. At this time, the diagnosis of idiopathic gonadotropin-dependent precocious puberty was considered, and the GnRH agonist (leuprolide, 3.75 mg/month) was prescribed. Despite the complete suppression of the gonadotropins with chronic GnRH agonist administration, his testosterone levels remained elevated [ranging from 30 nmol/L (675 ng/dL) to 53 nmol/L (1200 ng/dL)]. These findings suggested the diagnosis of testotoxicosis with secondary maturation of the hypothalamic-pituitary gonadal axis. His family history was negative for consanguinity. His father was not available for clinical examination or DNA analysis. According to the mother, he had short stature (height <155 cm). The family history of the mother was negative for early sexual maturation or short adult height.
DNA analysis
Genomic DNA was isolated from peripheral blood samples of the patients, as well as from both parents of the two brothers and the mother of the patient 3. The entire exon 11 of the hLHR gene was amplified by PCR. Amplification was performed for 30 cycles in a Gene Amp PCR system (2400; Perkin-Elmer Corp., Norwalk, CT) using the following pairs of intronic primers: 5' GAAAATCCCTTACCTCAAGCC 3' and 5' GCAGTTACTGATGTAACAGTTAACAC 3'. The PCR products were pretreated with an enzymatic combination of shrimp alkaline phosphatase and exonuclease I (United States Biochemical Corp., Cleveland, OH) and directly sequenced using sequenced using the BigDye terminator cycle sequencing ready reaction kit (PE Applied Biosystems, Foster City, CA) in an ABI PRISM 310 automatic sequencer (Perkin-Elmer Corp.).
Mutagenesis and transfections
The template for mutagenesis was the hLHR complementary DNA (cDNA), kindly donated by Ares Advanced Technology (Ares-Serono Group, Randolph, MA). After subcloning the cDNA into pcDNA3.1/neo, a T to C substitution of hLHR nucleotide 1103 was accomplished by mutagenesis using the PCR overlap extension method (7, 8). The entire region amplified by PCR, as well as the sites of ligation, were sequenced to ensure the fidelity of the mutant cDNA. DNA sequencing was performed by automated sequencing within the DNA Core of the Diabetes and Endocrinology Research Center of the University of Iowa.
Human embryonic 293 cells were obtained from the American Type Tissue Collection (Manassas, VA) (CRL 1573) and were maintained at 5% CO2 in a culture medium consisting of DMEM containing 50 µg/mL gentamicin, 10 mM HEPES, and 10% newborn calf serum. Cells were transfected at a 60–80% confluence using the transient transfection procedure of Chen and Okayama (9), except that the overnight precipitation was performed in a 5% rather than 2.5% CO2 atmosphere. After 18–20 h the cells were washed with Waymouth’s MB752/1 media modified with 50 µg/mL gentamicin and 1 mg/mL BSA, and then fresh growth medium was added. The cells were used for experiments 24 h later.
125I-hCG binding to intact cells
Human embryonic 293 cells were plated onto gelatin-coated 35-mm wells and transiently transfected as described above. On the day of the experiment, cells were washed two times with warm Waymouth’s MB752/1 containing 50 µg/mL gentamicin and 1 mg/mL BSA. To determine the maximal binding capacity, the cells were then incubated 1 h at 37 C in the same media containing a saturating concentration of 125I-hCG (500 ng/mL final concentration) with or without an excess of unlabeled hCG (50 IU/mL final concentration). To determine the binding affinity, the cells were incubated with increasing concentrations of 125I-hCG in the presence or absence of unlabeled hCG. The assay was finished by washing the cells three times with cold HBSS modified to contain 50 µg/mL gentamicin and 1 mg/mL BSA. The cells were then solubilized in 100 µL 0.5N NaOH and transferred to plastic test tubes with cotton swabs. Apparent binding affinities were determined as the concentrations of 125I-hCG yielding half-maximal binding as calculated by the DeltaGraph software Deltapoint (Monterey, CA) when the data were fit to a sigmoidal equation (10).
Measurement of cAMP production
In the same experiment, 293 cells were assayed both for maximal 125I-hCG binding to intact cells as well as for intracellular cAMP production under basal and hCG-stimulated conditions. Therefore, for any given experiment in which cAMP was determined, the levels of cell surface expression of receptor were also determined. Only those experiments in which the cells expressed comparable numbers of wild-type vs. mutant receptors were used for data analyses. The 293 cells were plated on gelatin-coated 35-mm wells and transfected as described above. On the day of the experiment, cells were washed twice with warm Waymouth MB752/1 media containing 50 µg/mL gentamicin and 1 mg/mL BSA and placed in 1 mL of the same medium containing 0.5 mM isobutylmethylxanthine. After 15 min at 37 C, buffer only or hCG was added. For determining the maximal hCG-stimulated cAMP, a saturating concentration of hCG was added (500 ng/mL). For complete dose-response curves, increasing concentrations of hCG were added. The incubation was then continued for 60 min at 37 C. The cells were then placed on ice, the media were aspirated, and intracellular cAMP was extracted by the addition of 0.5N perchloric acid containing 180 µg/mL theophylline and then measured by RIA. All determinations were performed either in duplicate or triplicate. The dose-response curves were analyzed using the computer software DeltaGraph to calculate the Rmax and EC50 for each curve.
Molecular modeling of the hLHR(L368P) mutant
The initial structure of the hLHR(L368P) mutant was obtained by replacing the target amino acid in the wild-type hLHR input structure previously built (11). Energy minimization and molecular dynamics simulations of the mutant were performed using the program CHARMm (Molecular Simulations Inc., Waltham, MA), following the computational protocol described previously (11).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Direct sequencing of exon 11 of the hLHR gene in the two brothers (patients 1 and 2) revealed a heterozygous substitution of T for C at nucleotide 1103 that converts Leu-368 (CTG) to proline (CCG) in helix I of the hLHR. Their mother carried the same mutation. A silent polymorphism was also identified at codon D355 in both brothers. One boy was heterozygous and the other was homozygous for this nucleotide substitution.
In patient 3, direct sequencing of exon 11 of the hLHR gene revealed a homozygous substitution of C for T at nucleotide 1703, which converts Ala-568 (GCT) to valine (GTT) in the third intracellular loop (i3) of the hLHR. This mutation was also identified in his mother in a heterozygous state.
Functional studies of the L368P mutation
The A568V mutation identified in patient 3 is a mutation previously shown to cause constitutive activation of the hLHR. Therefore, no further characterization of this mutant was performed. However, the L368P substitution identified in patients 1 and 2 represent a previously uncharacterized hLHR mutation. Therefore, the following studies were performed to study the functional properties of the hLHR resulting from a substitution of Leu-368 with proline.
Human embryonic 293 cells were transiently transfected with cDNAs
encoding either the wild-type hLHR or hLHR(L368P). Cells expressing
hLHR(L368P) bound hCG with the same high affinity as cells expressing
the wild-type hLHR (Kd, 1.12 ± 0.23 and
1.39 ± 0.22 nM, respectively). Subsequent experiments
were performed to assess the cAMP produced by these cells under both
basal conditions and hCG-stimulated conditions. As shown in Table 1
, the basal levels of cAMP produced by
cells expressing hLHR(L368P) were significantly (11- to 12-fold) higher
than the cAMP levels produced by cells expressing comparable levels of
wild-type hLHR. The cAMP levels in cells expressing hLHR(L368P) were
further augmented by the addition of hCG (Table 2 and Fig. 1). However, the maximal hCG-stimulated
cAMP response in hLHR(L368P) cells was not as great as that in hLHR(wt)
cells.
|
|
|
To better understand the molecular basis for the constitutive
activation of the hLHR(L368P) mutant, molecular dynamics simulations of
the mutant were performed. The results were compared with those
previously described for the wild-type hLHR, an inactivating hLHR
mutant S616Y, and another constitutively active mutant, M398T, which is
representative of the 13 active hLHR mutants previously modeled
(11). The average minimized structures of the wild-type
hLHR (ground state) and of the S616Y inactive mutant are characterized
by the presence of several constraining interactions that include a
salt bridge between the conserved D405 (H2:10, the first character and
the first digit indicate the helix, whereas the last two digits
indicate the position of the residue in the helix) and R464 (H3:25) of
the E/DRY sequence (Fig. 2). The average
distance between the 
-carbon atom of D405 and the 
-carbon atom of
R464 is 4.7 Å (for the wild-type hLHR) and 4.0 Å (for the S616Y
mutant). Other constraining interactions unique to the wild-type and
inactive hLHR forms occur between the second and third intracellular
loops (i2 and i3). The consequent arrangement of these two loops as
well as the cytosolic extensions of helices V and VI results in the
shielding from the cytosol of the side chain of W465 (H3:26), the
residue in the hLHR that substitutes for the tyrosine of the highly
conserved E/DRY sequence. Like the other constitutively active hLHR
mutants, the average structures of which have been deduced by molecular
dynamics simulations (11), the constitutively active M398T
mutant is characterized by the breakage of the salt bridge interaction
found in the wild-type hLHR and the S616Y inactive mutant between D405
and R464 (D405-R464 distance in M398T = 9.6 Å). Also, there is an
increase in the distance between i2 and i3 that results in the opening
of a cytosolic crevice formed by i2, i3, and the cytosolic extensions
of helices III, V, and VI (Fig. 2). It was previously shown that an
increase in the solvent accessible surface of W465
(SASW465) properly describes the formation of
this crevice (11). Thus, the
(SASW465) of the M398T mutant is larger (91.0
Å2) as compared with that of the wild-type hLHR
(6.0 Å2) and of the S616Y inactive mutant (0.0
Å2).
|
). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
12-fold increase in basal cAMP levels compared
with cells expressing similar numbers of cell surface wild-type hLHR,
indicating constitutive activation of the hLHR by the L368P
substitution. A silent polymorphism was also found in this family at
codon 355 of the hLHR. The particular Leu-368 residue found to be mutated in this study is conserved in the LHR sequences among human, bovine, porcine, rat, and mouse, but is not found in the related TSH and FSH receptors (22). Instead, the TSH and FSH receptors exhibit the amino acid phenylalanine at the homologous position. Although, a large number of somatic and/or germ line-activating mutations in the TSH receptor leading to toxic thyroid adenomas and multinodular goiter have been identified (23), no constitutive activating mutations in the first transmembrane helix in the human TSH receptor have been described.
Interestingly, only one other activating mutation of the hLHR in the
first TM has been described. This mutation, a substitution of
nucleotide 1126 of the hLHR gene, which resulted in a change of the
highly conserved amino acid 373 from alanine to valine in TM I, was
previously reported in a German boy with sporadic male precocious
puberty (14). Transiently transfected COS cells expressing
this mutated receptor displayed 7 fold increase in basal cAMP
production compared with cells expressing the wild-type hLHR. These two
activating mutations within the first TM (L368P and A373V) reflect
substitutions of residues that are located very close to each other in
terms of the hLHR linear amino acid sequence. However, based on
projections of the TMs as well as on three dimensional models of the
hLHR (11, 24, 25), Ala-373 is predicted to face toward
helix VII, close to the proline of the functionally important NPXXY
motif in helix VII. On the other hand, Leu-368 is predicted to face the
outer face of helix I that is contact with the lipid bilayer.
The revised ternary model for G protein-coupled receptor activation predicts an equilibrium of a G protein-coupled receptor between an inactive ground state and an active state. Agonists bind with higher affinity to the active receptor state, thereby shifting the equilibrium toward that state. Increasing evidence, though, suggests that multiple states of intermediate activation probably also exist. Constitutively activating mutations are thought to stabilize an active state of the receptor, thereby increasing the equilibrium toward that conformation (see Ref. 26 for a recent review). Recently, Fanelli (11) characterized the active and inactive states of the hLHR by molecular dynamics simulations. This was accomplished by comparing the average minimized structures of the wild-type hLHR with all 13 naturally occurring activating and 3 inactivating hLHR mutants identified by the time of the study. The comparative analyses suggested that the constitutively active hLHR forms share the common properties of a lack of a salt bridge interaction between D405 and the arginine of the highly conserved E/DRY motif (R464), as well as the opening of a cytosolic site formed by i2, i3, and the cytosolic extensions of helices III, V, and VI. Interestingly, the analyses of the mutant structures led to the definition of very simple molecular descriptors [i.e. the D405-R464 distance and the solvent accessible surface of W465 (SASW465))], which codify the essential features differentiating the active from the inactive hLHR forms. Thus, it was found that values of the SASW465 above or below 30.0 Å2 were found to be associated with the presence or the absence, respectively, of a solvent accessible crevice in between i2 and i3. The presence of such a crevice may allow G proteins greater accessibility to the regions of the receptor necessary for G protein recognition. It was further found that the wild-type and the inactive hLHR mutants are characterized by D405-R464 distances less than 4.7 Å and SASW465 values below 11.0 Å2, whereas the constitutively active mutants are mainly characterized by D405-R464 distances greater than 7.7 Å and SASW465 values above 32.0 Å2.
In the present study, this analysis has now been used to investigate the structural features of the novel constitutively active mutant hLHR(L368P). The substitution of Leu-368 with proline was found to cause an increase in the degrees of freedom of helix I due to the lack of the intrahelical hydrogen bond between the carbonyl oxygen atom of Leu-365 and the nitrogen atom of Pro-368. In the model, Leu-368 is predicted to lie at the same level (with respect to the plasma membrane surface) as Pro-584 (H6:22) and Pro-613 (H7:11), creating a line of prolines in three adjacent helices. The latter two prolines may, therefore, contribute to the transfer of the structural perturbation from the L368P mutation in helix I to the other helices. Consistent with the results of molecular dynamics simulations on the other hLHR activating mutants (11), the substitution of a proline for Leu-368 is predicted to cause a clockwise rotation of helix VI as seen from the intracellular side and movements of helices IV, V, and VI relative to helix III. The arrangement of helix V is the most affected compared with the wild-type receptor. The end result of these perturbations is that, similar to other constitutively active mutants of the hLHR (11), there is an increased distance between D405 and R464 and an increased solvent accessibility of W465. Therefore, the comparative analyses of hLHR(L368P) with other constitutively active hLHR mutant structures support the idea that, in spite of the seemingly disparate nature of these mutations, the predicted conformations of the active states share some remarkably similar structural properties.
In this study, we also report the identification of another Brazilian boy with familial precocious puberty with the previously described A568V mutation in i3 of the hLHR (5, 6). This mutation was surprisingly found in a homozygous state in this boy. To our knowledge, this is the first report of an individual exhibiting an activating mutation of the hLHR in a homozygous state. However, clinical and hormonal data of this patient were not different from those previously reported boys with a heterozygous A568V mutation. The boy with the homozygous A568V mutation exhibited an accelerated bone age (13 yr) and secondary central precocious puberty at first presentation, requiring combined treatment with GnRH agonist and cyproterone acetate. These findings indicated that the activation of the hypothalamic-pituitary gonadal axis was preserved in this patient. The homozygous state of this boy indicated that both parents were carriers of the A568V mutation. Although, his father was not available for clinical examination and DNA analysis, his short stature suggests that he is also affected.
Interestingly, two other Brazilian boys of African descent have the
A568V mutation (5, 6). Despite the limited number of cases
with gonadotropin-independent precocious puberty examined in Brazil for
LHR mutations so far (seven boys from six families), it is noteworthy
that 50% of the families have the A568V mutation. Three of the four
activating mutations in the hLHR in Brazilian boys with
gonadotropin-independent precocious puberty were exclusively found in
Brazil. These are the A568V, L457R, and the novel L368P mutations
(Table 2). Two comprehensive American and European studies of 32 and 17
families with gonadotropin independent precocious puberty,
respectively, did not report these mutations. The most recent European
study identified seven different mutations, all of them previously
reported, suggesting a limited repertoire of LHR mutations in this
population (2, 3). The distinct Brazilian population
origin, which has a high degree of miscegenation among Africans, Latin
Europeans, and Native Brazilians, could explain the great percentage of
new mutations identified even in a small series.
In conclusion, our studies thus far indicate that the A568V mutation is the most frequent cause of familial male-limited precocious puberty mutations in Brazilian boys. The phenotype, caused by dominant activating mutations of the hLHR gene, are not altered when both alleles carry a mutant sequence. In addition, a novel L368P mutation at the first TM of the hLHR is also a cause of familial precocious puberty in Brazilian boys, providing further insights into the mechanism of activation of the hLHR.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 These authors contributed equally to this work.
Received May 22, 2000.
Revised August 15, 2000.
Accepted September 2, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  A. P N Themmen An update of the pathophysiology of human gonadotrophin subunit and receptor gene mutations and polymorphisms Reproduction, September 1, 2005; 130(3): 263 - 274. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, D. Mizrachi, F. Fanelli, and D. L. Segaloff The Formation of a Salt Bridge Between Helices 3 and 6 Is Responsible for the Constitutive Activity and Lack of Hormone Responsiveness of the Naturally Occurring L457R Mutation of the Human Lutropin Receptor J. Biol. Chem., July 15, 2005; 280(28): 26169 - 26176. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Fanelli, M. Verhoef-Post, M. Timmerman, A. Zeilemaker, J. W. M. Martens, and A. P. N. Themmen Insight into Mutation-Induced Activation of the Luteinizing Hormone Receptor: Molecular Simulations Predict the Functional Behavior of Engineered Mutants at M398 Mol. Endocrinol., June 1, 2004; 18(6): 1499 - 1508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Shinozaki, F. Fanelli, X. Liu, J. Jaquette, K. Nakamura, and D. L. Segaloff Pleiotropic Effects of Substitutions of a Highly Conserved Leucine in Transmembrane Helix III of the Human Lutropin/Choriogonadotropin Receptor with Respect to Constitutive Activation and Hormone Responsiveness Mol. Endocrinol., June 1, 2001; 15(6): 972 - 984. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
